plpcx empty vector (TaKaRa)
TaKaRa is a verified supplier 
TaKaRa manufactures this product 
95
Structured Review
TaKaRa
plpcx empty vector
Plpcx Empty Vector, supplied by TaKaRa, used in various techniques. Bioz Stars score: 95/100, based on 26 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/plpcx+empty+vector/LRCX+Retroviral+Vector+Set/pmc08666140-78-0-4
Average 95 stars, based on 26 article reviews
Plpcx Empty Vector, supplied by TaKaRa, used in various techniques. Bioz Stars score: 95/100, based on 26 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/plpcx+empty+vector/LRCX+Retroviral+Vector+Set/pmc08666140-78-0-4
Average 95 stars, based on 26 article reviews
plpcx empty vector - by Bioz Stars,
2026-09
95/100 stars
Images
1) Product Images from "TRIM5α Restricts Flavivirus Replication by Targeting the Viral Protease for Proteasomal Degradation"
Article Title: TRIM5α Restricts Flavivirus Replication by Targeting the Viral Protease for Proteasomal Degradation
Journal: Cell reports
doi: 10.1016/j.celrep.2019.05.040
Figure Legend Snippet: KEY RESOURCES TABLE
Techniques Used: Transduction, Recombinant, Modification, Protease Inhibitor, Staining, Transfection, Clone Assay, Construct, shRNA, Sequencing, Luciferase, Plasmid Preparation, Expressing, Software, Imaging, Western Blot
Related Articles
Expressing:Article Title: A molecular optomechanics approach reveals functional relevance of force transduction across talin and desmoplakin. Article Snippet: The following cDNA templates were used: human talin-1 (GeneBank BC042923), mCherry-AsLOV2 (Addgene #81041), mCherryAsLOV2(I427T) (Addgene #81035), Zdk2 (Addgene #81011), YPet (pCEP4-YPet; amino acids 1 to 228), PhoCl-mCherry (Addgene #87691), PhoCl2c-mCherry (Addgene #164037), and human DspII (Addgene #32227). .. Final cDNA sequences were assembled in expression vectors pLPCX or Article Title: A conformational change in α-catenin's actin-binding domain governs adherens junction maturation. Article Snippet: .. Final cDNA sequences were assembled in the Article Title: A molecular optomechanics approach reveals functional relevance of force transduction across talin and desmoplakin Article Snippet: The following cDNA templates were used: human talin-1 (GeneBank BC042923), mCherry-AsLOV2 (Addgene #81041), mCherry-AsLOV2(I427T) (Addgene #81035), Zdk2 (Addgene #81011), YPet (pCEP4-YPet; amino acids 1 to 228), PhoCl-mCherry (Addgene #87691), PhoCl2c-mCherry (Addgene #164037), and human DspII (Addgene #32227). .. Final cDNA sequences were assembled in expression vectors pLPCX or Article Title: A conformational change in α-catenin’s actin-binding domain governs adherens junction maturation Article Snippet: .. Final cDNA sequences were assembled in the Construct:Article Title: A molecular optomechanics approach reveals functional relevance of force transduction across talin and desmoplakin. Article Snippet: The following cDNA templates were used: human talin-1 (GeneBank BC042923), mCherry-AsLOV2 (Addgene #81041), mCherryAsLOV2(I427T) (Addgene #81035), Zdk2 (Addgene #81011), YPet (pCEP4-YPet; amino acids 1 to 228), PhoCl-mCherry (Addgene #87691), PhoCl2c-mCherry (Addgene #164037), and human DspII (Addgene #32227). .. Final cDNA sequences were assembled in expression vectors pLPCX or Article Title: A molecular optomechanics approach reveals functional relevance of force transduction across talin and desmoplakin Article Snippet: The following cDNA templates were used: human talin-1 (GeneBank BC042923), mCherry-AsLOV2 (Addgene #81041), mCherry-AsLOV2(I427T) (Addgene #81035), Zdk2 (Addgene #81011), YPet (pCEP4-YPet; amino acids 1 to 228), PhoCl-mCherry (Addgene #87691), PhoCl2c-mCherry (Addgene #164037), and human DspII (Addgene #32227). .. Final cDNA sequences were assembled in expression vectors pLPCX or other:Article Title: EGFR-phosphorylated GDH1 harmonizes with RSK2 to drive CREB activation and tumor metastasis in EGFR-activated lung cancer. Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Experimental models: Organisms/strains Mouse: Hsd:Athymic Nude-Foxn1nu Envigo Cat#069 Mouse: 129S1/Svlmj The Jackson Laboratory Cat#002448 Mouse: C57BL/6JOlaHsd Envigo Cat#057 Oligonucleotides shRNA targeting sense sequence: RSK2 #1: CGCTGAGAATGGACAGCAAAT Horizon Discovery Cat#TRCN0000040144 shRNA targeting sense sequence: RSK2 #2: GCCTGAAGATACATTCTATTT Horizon Discovery Cat#TRCN0000040147 shRNA targeting sense sequence: GDH1 #1: GCCATTGAGAAAGTCTTCAAA Horizon Discovery Cat#TRCN0000028600 shRNA targeting sense sequence: GDH1 #2: CCCAAGAACTATACTGATAAT Horizon Discovery Cat#TRCN0000028588 shRNA targeting sense sequence: CREB #1: GCTCGATAAATCTAACAGTTA Horizon Discovery Cat#TRCN0000007308 shRNA targeting sense sequence: CREB #2: CGTCTAATGAAGAACAGGGAA Horizon Discovery Cat#TRCN0000007310 Primer: Fascin-1 Forward AGCCAGGGGCGGGACA Integrated DNA Technologies N/A Primer: Fascin-1 Reverse CGCTCCACAAAGCCCAGCTA Integrated DNA Technologies N/A Primer: PTK6 Forward TGCTCTGGAGCGCCTGT Integrated DNA Technologies N/A Primer: PTK6 Reverse TGTGGCCCAGCTGGAGCA Integrated DNA Technologies N/A Primer: ING3 Forward AGAAAACTACATTTCCCACAGAGG Integrated DNA Technologies N/A Primer: ING3 Reverse AAAAAAAACCACTTTGGCGCCTGAG Integrated DNA Technologies N/A Primer: GAPDH Forward GACATCAAGAAGGTGGTG Integrated DNA Technologies N/A Primer: GAPDH Reverse GTCATACCAGGAAATGAGC Integrated DNA Technologies N/A Recombinant DNA Plasmid: Gateway pDEST27 Invitrogen Cat#11812013 Plasmid: Plasmid Preparation:Article Title: A conformational change in α-catenin's actin-binding domain governs adherens junction maturation. Article Snippet: .. Final cDNA sequences were assembled in the Article Title: EGFR-phosphorylated GDH1 harmonizes with RSK2 to drive CREB activation and tumor metastasis in EGFR-activated lung cancer Article Snippet: Plasmid: Gateway pDEST27 , Invitrogen , Cat#11812013. .. Article Title: A conformational change in α-catenin’s actin-binding domain governs adherens junction maturation Article Snippet: .. Final cDNA sequences were assembled in the Sequencing:Article Title: FOXC2 promotes vasculogenic mimicry and resistance to anti-angiogenic therapy. Article Snippet: The CellTag vector (pSMAL-CellTag-V1) was purchased from addgene (#115643), transduced cells were sorted on GFP. .. For cDNA over-expression, the coding sequence of murine Foxc2, fused to a C-terminal FLAG tag, was cloned into FLAG-tag:Article Title: FOXC2 promotes vasculogenic mimicry and resistance to anti-angiogenic therapy. Article Snippet: The CellTag vector (pSMAL-CellTag-V1) was purchased from addgene (#115643), transduced cells were sorted on GFP. .. For cDNA over-expression, the coding sequence of murine Foxc2, fused to a C-terminal FLAG tag, was cloned into Clone Assay:Article Title: FOXC2 promotes vasculogenic mimicry and resistance to anti-angiogenic therapy. Article Snippet: The CellTag vector (pSMAL-CellTag-V1) was purchased from addgene (#115643), transduced cells were sorted on GFP. .. For cDNA over-expression, the coding sequence of murine Foxc2, fused to a C-terminal FLAG tag, was cloned into |