p53 brca1 knockout rpe 1 cells oligonucleotides encoding guide rnas targeting tp53 (Addgene inc)
Structured Review
P53 Brca1 Knockout Rpe 1 Cells Oligonucleotides Encoding Guide Rnas Targeting Tp53, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 29 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/plasmids+encoding+brca1/BRCA1+(1-304)+(Plasmid+%2312645)/us12263166-500-2-20
Average 93 stars, based on 29 article reviews
Images
Related Articles
Activity Assay:Article Title: Efficient suppression of premature termination codons with alanine by engineered chimeric pyrrolysine tRNAs Article Snippet: .. For measuring Article Title: Efficient suppression of premature termination codons with alanine by engineered chimeric pyrrolysine tRNAs. Article Snippet: .. For measuring Plasmid Preparation:Article Title: Efficient suppression of premature termination codons with alanine by engineered chimeric pyrrolysine tRNAs Article Snippet: .. For measuring Article Title: MRN–CtIP, EXO1, and DNA2–WRN/BLM act bidirectionally to process DNA gaps in PARPi-treated cells without strand cleavage Article Snippet: Cells were infected with virus in media containing 4 μg/ml polybrene via spin infection Thermo Fisher Sorvall ST16R Centrifuge with an rotor and Microplate Carrier attachment at 650 x g for 30 min. SUM149PT cells were infected with guides cloned into lentiCRISPR v2-blast (#83480, Addgene). .. Since Article Title: Efficient suppression of premature termination codons with alanine by engineered chimeric pyrrolysine tRNAs. Article Snippet: .. For measuring Article Title: The human RIF1-Long isoform interacts with BRCA1 to promote recombinational fork repair under DNA replication stress Article Snippet: .. The Article Title: Distinct Mechanisms of Recognition of Phosphorylated RNAPII C- Terminal Domain by BRCT Repeats of the BRCA1–BARD1 Complex: Insights from Structural and Functional Analyses Article Snippet: To express the DNA binding region of BRCA1 (amino acids 421-1079), the fragment of DNA, containing the coding sequence was amplified by PCR and cloned into 438C (pFastBac His6 MBP Asn10 TEV cloning vector with BioBrick PolyPromoter LIC Subcloning, addgene #55220). .. To generate a vector for co-expression of the Article Title: The human RIF1-Long isoform interacts with BRCA1 to promote recombinational fork repair under DNA replication stress Article Snippet: .. The Construct:Article Title: MRN–CtIP, EXO1, and DNA2–WRN/BLM act bidirectionally to process DNA gaps in PARPi-treated cells without strand cleavage Article Snippet: Cells were infected with virus in media containing 4 μg/ml polybrene via spin infection Thermo Fisher Sorvall ST16R Centrifuge with an rotor and Microplate Carrier attachment at 650 x g for 30 min. SUM149PT cells were infected with guides cloned into lentiCRISPR v2-blast (#83480, Addgene). .. Since Article Title: Distinct Mechanisms of Recognition of Phosphorylated RNAPII C- Terminal Domain by BRCT Repeats of the BRCA1–BARD1 Complex: Insights from Structural and Functional Analyses Article Snippet: To express the DNA binding region of BRCA1 (amino acids 421-1079), the fragment of DNA, containing the coding sequence was amplified by PCR and cloned into 438C (pFastBac His6 MBP Asn10 TEV cloning vector with BioBrick PolyPromoter LIC Subcloning, addgene #55220). .. To generate a vector for co-expression of the Selection:Article Title: MRN–CtIP, EXO1, and DNA2–WRN/BLM act bidirectionally to process DNA gaps in PARPi-treated cells without strand cleavage Article Snippet: Cells were infected with virus in media containing 4 μg/ml polybrene via spin infection Thermo Fisher Sorvall ST16R Centrifuge with an rotor and Microplate Carrier attachment at 650 x g for 30 min. SUM149PT cells were infected with guides cloned into lentiCRISPR v2-blast (#83480, Addgene). .. Since Infection:Article Title: MRN–CtIP, EXO1, and DNA2–WRN/BLM act bidirectionally to process DNA gaps in PARPi-treated cells without strand cleavage Article Snippet: Cells were infected with virus in media containing 4 μg/ml polybrene via spin infection Thermo Fisher Sorvall ST16R Centrifuge with an rotor and Microplate Carrier attachment at 650 x g for 30 min. SUM149PT cells were infected with guides cloned into lentiCRISPR v2-blast (#83480, Addgene). .. Since Clone Assay:Article Title: MRN–CtIP, EXO1, and DNA2–WRN/BLM act bidirectionally to process DNA gaps in PARPi-treated cells without strand cleavage Article Snippet: Cells were infected with virus in media containing 4 μg/ml polybrene via spin infection Thermo Fisher Sorvall ST16R Centrifuge with an rotor and Microplate Carrier attachment at 650 x g for 30 min. SUM149PT cells were infected with guides cloned into lentiCRISPR v2-blast (#83480, Addgene). .. Since Article Title: Distinct Mechanisms of Recognition of Phosphorylated RNAPII C- Terminal Domain by BRCT Repeats of the BRCA1–BARD1 Complex: Insights from Structural and Functional Analyses Article Snippet: To express the DNA binding region of BRCA1 (amino acids 421-1079), the fragment of DNA, containing the coding sequence was amplified by PCR and cloned into 438C (pFastBac His6 MBP Asn10 TEV cloning vector with BioBrick PolyPromoter LIC Subcloning, addgene #55220). .. To generate a vector for co-expression of the other:Article Title: Methods of treating cancers having a BRCA1 and/or BRCA2 mutation(s) Article Snippet: The targeted genomic sequences were GATCCACTCACAGTTTCCAT (SEQ ID NO: 4) for TP53 and TCTTGTGCTGACTTACCAGA (SEQ ID NO: 5) for BRCAL RPE-1 cells were transfected with the CRISPR-Cas9 targeting construct to TP53 using Lipofectamine 2000 (Invitrogen, Carlsbad, CA Cat #11668). Cloning:Article Title: Distinct Mechanisms of Recognition of Phosphorylated RNAPII C- Terminal Domain by BRCT Repeats of the BRCA1–BARD1 Complex: Insights from Structural and Functional Analyses Article Snippet: To express the DNA binding region of BRCA1 (amino acids 421-1079), the fragment of DNA, containing the coding sequence was amplified by PCR and cloned into 438C (pFastBac His6 MBP Asn10 TEV cloning vector with BioBrick PolyPromoter LIC Subcloning, addgene #55220). .. To generate a vector for co-expression of the |


