Review



p53 brca1 knockout rpe 1 cells oligonucleotides encoding guide rnas targeting tp53  (Addgene inc)


Bioz Verified Symbol Addgene inc is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 93

    Structured Review

    Addgene inc p53 brca1 knockout rpe 1 cells oligonucleotides encoding guide rnas targeting tp53
    P53 Brca1 Knockout Rpe 1 Cells Oligonucleotides Encoding Guide Rnas Targeting Tp53, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 29 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/plasmids+encoding+brca1/BRCA1+(1-304)+(Plasmid+%2312645)/us12263166-500-2-20
    Average 93 stars, based on 29 article reviews
    p53 brca1 knockout rpe 1 cells oligonucleotides encoding guide rnas targeting tp53 - by Bioz Stars, 2026-10
    93/100 stars

    Images

    Related Articles

    Activity Assay:

    Article Title: Efficient suppression of premature termination codons with alanine by engineered chimeric pyrrolysine tRNAs
    Article Snippet: .. For measuring BRCA1 activity, HEK 293 cells were seeded in a white, clear-bottom 96-well plate and co-transfected with the Gal4-BRCA1 plasmid (22 ng), 5xGal4-TATA-luciferase (87 ng, a gift from Richard Maurer; Addgene Plasmid #46756; http://n2t.net/addgene:46756 ; RRID:Addgene_46756) and pLX313- Renilla (8.7 ng, a gift from William Hahn and David Root; Addgene plasmid #118016; http://n2t.net/addgene:118016 ; RRID:Addgene_118016) using Lipofectamine TM 3000 according to the manufacturer’s protocol. .. Fluc and Rluc activity were quantified 24 h after transfection using the Dual-Glo ® Luciferase Assay Kit (Promega) in a BioTek Synergy H1 microplate reader.

    Article Title: Efficient suppression of premature termination codons with alanine by engineered chimeric pyrrolysine tRNAs.
    Article Snippet: .. For measuring BRCA1 activity, HEK 293 cells were seeded in a white, clear-bottom 96-well plate and co-transfected with the Gal4-BRCA1 plasmid (22 ng), 5xGal4-T A T A-luciferase (87 ng, a gift from Richard Maurer; Addgene Plasmid #46756; http:// n2t.net/ addgene:46756 ; RRID:Addgene_46756) and pLX313- Renilla (8.7 ng, a gift from William Hahn and David Root; Addgene plasmid #118016; http:// n2t.net/ addgene: 118016 ; RRID:Addgene_118016) using Lipofectamine TM 3000 according to the manufacturer’s protocol. .. Fluc and Rluc activity were quantified 24 h after transfection using the DualGlo ® Luciferase Assay Kit (Promega) in a BioTek Synergy H1 microplate reader.

    Plasmid Preparation:

    Article Title: Efficient suppression of premature termination codons with alanine by engineered chimeric pyrrolysine tRNAs
    Article Snippet: .. For measuring BRCA1 activity, HEK 293 cells were seeded in a white, clear-bottom 96-well plate and co-transfected with the Gal4-BRCA1 plasmid (22 ng), 5xGal4-TATA-luciferase (87 ng, a gift from Richard Maurer; Addgene Plasmid #46756; http://n2t.net/addgene:46756 ; RRID:Addgene_46756) and pLX313- Renilla (8.7 ng, a gift from William Hahn and David Root; Addgene plasmid #118016; http://n2t.net/addgene:118016 ; RRID:Addgene_118016) using Lipofectamine TM 3000 according to the manufacturer’s protocol. .. Fluc and Rluc activity were quantified 24 h after transfection using the Dual-Glo ® Luciferase Assay Kit (Promega) in a BioTek Synergy H1 microplate reader.

    Article Title: MRN–CtIP, EXO1, and DNA2–WRN/BLM act bidirectionally to process DNA gaps in PARPi-treated cells without strand cleavage
    Article Snippet: Cells were infected with virus in media containing 4 μg/ml polybrene via spin infection Thermo Fisher Sorvall ST16R Centrifuge with an rotor and Microplate Carrier attachment at 650 x g for 30 min. SUM149PT cells were infected with guides cloned into lentiCRISPR v2-blast (#83480, Addgene). .. Since SUM149PT+BRCA1 cells already expressed a doxycycline-inducible CAS9 construct under puromycin selection and a sgRNA plasmid targeting BRCA1 used to re-establish BRCA1proficiency under blast selection, these cells were infected with guides cloned into LRG2.1 (#108098, Addgene) (Wang et al. 2016). ..

    Article Title: Efficient suppression of premature termination codons with alanine by engineered chimeric pyrrolysine tRNAs.
    Article Snippet: .. For measuring BRCA1 activity, HEK 293 cells were seeded in a white, clear-bottom 96-well plate and co-transfected with the Gal4-BRCA1 plasmid (22 ng), 5xGal4-T A T A-luciferase (87 ng, a gift from Richard Maurer; Addgene Plasmid #46756; http:// n2t.net/ addgene:46756 ; RRID:Addgene_46756) and pLX313- Renilla (8.7 ng, a gift from William Hahn and David Root; Addgene plasmid #118016; http:// n2t.net/ addgene: 118016 ; RRID:Addgene_118016) using Lipofectamine TM 3000 according to the manufacturer’s protocol. .. Fluc and Rluc activity were quantified 24 h after transfection using the DualGlo ® Luciferase Assay Kit (Promega) in a BioTek Synergy H1 microplate reader.

    Article Title: The human RIF1-Long isoform interacts with BRCA1 to promote recombinational fork repair under DNA replication stress
    Article Snippet: .. The FLAG-BRCA1 plasmid was obtained from Addgene (#52504, pDEST 3x Flag-pcDNA5-FRT/TO-BRCA1 ). .. The BARD1 plasmid was obtained from GenScript (Clone ID: OHu22612, Accession: NM_000465.4 , Vector: pcDNA3.1-C-(k)DYK).

    Article Title: Distinct Mechanisms of Recognition of Phosphorylated RNAPII C- Terminal Domain by BRCT Repeats of the BRCA1–BARD1 Complex: Insights from Structural and Functional Analyses
    Article Snippet: To express the DNA binding region of BRCA1 (amino acids 421-1079), the fragment of DNA, containing the coding sequence was amplified by PCR and cloned into 438C (pFastBac His6 MBP Asn10 TEV cloning vector with BioBrick PolyPromoter LIC Subcloning, addgene #55220). .. To generate a vector for co-expression of the full-length human BRCA1-BARD1 complex in insect cells, fragment of DNA, containing FLAG-tagged BRCA1 was first cloned into 2BcT plasmid (pET His6 LIC cloning vector; addgene #37236) to add C-terminal (His) 6 tag to the construct. .. Subsequently, FLAG-BRCA1-His was subcloned into plasmid 438A (pFastBac cloning vector with BioBrick PolyPromoter LIC Subcloning, addgene #55218).

    Article Title: The human RIF1-Long isoform interacts with BRCA1 to promote recombinational fork repair under DNA replication stress
    Article Snippet: .. The FLAG-BRCA1 plasmid was obtained from Addgene (#52504, pDEST 3x Flag-pcDNA5-FRT/TO-BRCA1 ). .. The BARD1 plasmid was obtained from GenScript (Clone ID: OHu22612, Accession: NM_000465.4 , Vector: pcDNA3.1-C-(k)DYK).

    Construct:

    Article Title: MRN–CtIP, EXO1, and DNA2–WRN/BLM act bidirectionally to process DNA gaps in PARPi-treated cells without strand cleavage
    Article Snippet: Cells were infected with virus in media containing 4 μg/ml polybrene via spin infection Thermo Fisher Sorvall ST16R Centrifuge with an rotor and Microplate Carrier attachment at 650 x g for 30 min. SUM149PT cells were infected with guides cloned into lentiCRISPR v2-blast (#83480, Addgene). .. Since SUM149PT+BRCA1 cells already expressed a doxycycline-inducible CAS9 construct under puromycin selection and a sgRNA plasmid targeting BRCA1 used to re-establish BRCA1proficiency under blast selection, these cells were infected with guides cloned into LRG2.1 (#108098, Addgene) (Wang et al. 2016). ..

    Article Title: Distinct Mechanisms of Recognition of Phosphorylated RNAPII C- Terminal Domain by BRCT Repeats of the BRCA1–BARD1 Complex: Insights from Structural and Functional Analyses
    Article Snippet: To express the DNA binding region of BRCA1 (amino acids 421-1079), the fragment of DNA, containing the coding sequence was amplified by PCR and cloned into 438C (pFastBac His6 MBP Asn10 TEV cloning vector with BioBrick PolyPromoter LIC Subcloning, addgene #55220). .. To generate a vector for co-expression of the full-length human BRCA1-BARD1 complex in insect cells, fragment of DNA, containing FLAG-tagged BRCA1 was first cloned into 2BcT plasmid (pET His6 LIC cloning vector; addgene #37236) to add C-terminal (His) 6 tag to the construct. .. Subsequently, FLAG-BRCA1-His was subcloned into plasmid 438A (pFastBac cloning vector with BioBrick PolyPromoter LIC Subcloning, addgene #55218).

    Selection:

    Article Title: MRN–CtIP, EXO1, and DNA2–WRN/BLM act bidirectionally to process DNA gaps in PARPi-treated cells without strand cleavage
    Article Snippet: Cells were infected with virus in media containing 4 μg/ml polybrene via spin infection Thermo Fisher Sorvall ST16R Centrifuge with an rotor and Microplate Carrier attachment at 650 x g for 30 min. SUM149PT cells were infected with guides cloned into lentiCRISPR v2-blast (#83480, Addgene). .. Since SUM149PT+BRCA1 cells already expressed a doxycycline-inducible CAS9 construct under puromycin selection and a sgRNA plasmid targeting BRCA1 used to re-establish BRCA1proficiency under blast selection, these cells were infected with guides cloned into LRG2.1 (#108098, Addgene) (Wang et al. 2016). ..

    Infection:

    Article Title: MRN–CtIP, EXO1, and DNA2–WRN/BLM act bidirectionally to process DNA gaps in PARPi-treated cells without strand cleavage
    Article Snippet: Cells were infected with virus in media containing 4 μg/ml polybrene via spin infection Thermo Fisher Sorvall ST16R Centrifuge with an rotor and Microplate Carrier attachment at 650 x g for 30 min. SUM149PT cells were infected with guides cloned into lentiCRISPR v2-blast (#83480, Addgene). .. Since SUM149PT+BRCA1 cells already expressed a doxycycline-inducible CAS9 construct under puromycin selection and a sgRNA plasmid targeting BRCA1 used to re-establish BRCA1proficiency under blast selection, these cells were infected with guides cloned into LRG2.1 (#108098, Addgene) (Wang et al. 2016). ..

    Clone Assay:

    Article Title: MRN–CtIP, EXO1, and DNA2–WRN/BLM act bidirectionally to process DNA gaps in PARPi-treated cells without strand cleavage
    Article Snippet: Cells were infected with virus in media containing 4 μg/ml polybrene via spin infection Thermo Fisher Sorvall ST16R Centrifuge with an rotor and Microplate Carrier attachment at 650 x g for 30 min. SUM149PT cells were infected with guides cloned into lentiCRISPR v2-blast (#83480, Addgene). .. Since SUM149PT+BRCA1 cells already expressed a doxycycline-inducible CAS9 construct under puromycin selection and a sgRNA plasmid targeting BRCA1 used to re-establish BRCA1proficiency under blast selection, these cells were infected with guides cloned into LRG2.1 (#108098, Addgene) (Wang et al. 2016). ..

    Article Title: Distinct Mechanisms of Recognition of Phosphorylated RNAPII C- Terminal Domain by BRCT Repeats of the BRCA1–BARD1 Complex: Insights from Structural and Functional Analyses
    Article Snippet: To express the DNA binding region of BRCA1 (amino acids 421-1079), the fragment of DNA, containing the coding sequence was amplified by PCR and cloned into 438C (pFastBac His6 MBP Asn10 TEV cloning vector with BioBrick PolyPromoter LIC Subcloning, addgene #55220). .. To generate a vector for co-expression of the full-length human BRCA1-BARD1 complex in insect cells, fragment of DNA, containing FLAG-tagged BRCA1 was first cloned into 2BcT plasmid (pET His6 LIC cloning vector; addgene #37236) to add C-terminal (His) 6 tag to the construct. .. Subsequently, FLAG-BRCA1-His was subcloned into plasmid 438A (pFastBac cloning vector with BioBrick PolyPromoter LIC Subcloning, addgene #55218).

    other:

    Article Title: Methods of treating cancers having a BRCA1 and/or BRCA2 mutation(s)
    Article Snippet: The targeted genomic sequences were GATCCACTCACAGTTTCCAT (SEQ ID NO: 4) for TP53 and TCTTGTGCTGACTTACCAGA (SEQ ID NO: 5) for BRCAL RPE-1 cells were transfected with the CRISPR-Cas9 targeting construct to TP53 using Lipofectamine 2000 (Invitrogen, Carlsbad, CA Cat #11668).

    Cloning:

    Article Title: Distinct Mechanisms of Recognition of Phosphorylated RNAPII C- Terminal Domain by BRCT Repeats of the BRCA1–BARD1 Complex: Insights from Structural and Functional Analyses
    Article Snippet: To express the DNA binding region of BRCA1 (amino acids 421-1079), the fragment of DNA, containing the coding sequence was amplified by PCR and cloned into 438C (pFastBac His6 MBP Asn10 TEV cloning vector with BioBrick PolyPromoter LIC Subcloning, addgene #55220). .. To generate a vector for co-expression of the full-length human BRCA1-BARD1 complex in insect cells, fragment of DNA, containing FLAG-tagged BRCA1 was first cloned into 2BcT plasmid (pET His6 LIC cloning vector; addgene #37236) to add C-terminal (His) 6 tag to the construct. .. Subsequently, FLAG-BRCA1-His was subcloned into plasmid 438A (pFastBac cloning vector with BioBrick PolyPromoter LIC Subcloning, addgene #55218).



    Similar Products

    93
    Addgene inc p53 brca1 knockout rpe 1 cells oligonucleotides encoding guide rnas targeting tp53
    P53 Brca1 Knockout Rpe 1 Cells Oligonucleotides Encoding Guide Rnas Targeting Tp53, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/plasmids+encoding+brca1/BRCA1+(1-304)+(Plasmid+%2312645)/us12263166-500-2-20
    Average 93 stars, based on 1 article reviews
    p53 brca1 knockout rpe 1 cells oligonucleotides encoding guide rnas targeting tp53 - by Bioz Stars, 2026-10
    93/100 stars
      Buy from Supplier

    94
    Addgene inc plasmid pdest mcherry lacr brca1 encoding mcherry
    Plasmid Pdest Mcherry Lacr Brca1 Encoding Mcherry, supplied by Addgene inc, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/plasmids+encoding+brca1/pDEST-mCherry-LacR-BRCA1+(Plasmid+%2371102)/pm36833189-65-1-18
    Average 94 stars, based on 1 article reviews
    plasmid pdest mcherry lacr brca1 encoding mcherry - by Bioz Stars, 2026-10
    94/100 stars
      Buy from Supplier

    94
    Addgene inc plasmids encoding brca1
    (a) Size and (b) zeta potential measurement. NPs, <t>BRCA1</t> + NPs, and BRCA2 + NPs formed with addition of 4 mM of exogeneous Ca 2+ in 1 mL DMEM medium with 1 µg of BRCA1 or BRCA2 plasmid DNA, followed by incubation for 30 min at 37 °C. Each of the measurements was performed three times and mean and standard deviation were calculated.
    Plasmids Encoding Brca1, supplied by Addgene inc, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/plasmids+encoding+brca1/pcBRCA1-385+(Plasmid+%2361586)/pmc09834397-151-1-18
    Average 94 stars, based on 1 article reviews
    plasmids encoding brca1 - by Bioz Stars, 2026-10
    94/100 stars
      Buy from Supplier

    90
    Shanghai Genechem Ltd brca1 -encoding lxsn plasmid
    (A–C) Level of <t>BRCA1</t> and PKM2 was tested by Western blot and quantification analysis. (D) Number of apoptotic cells was measured at 2 days via the annexin V assay. (E) Immunofluorescence imaging of the PKM2 expression and the nucleus (DAPI, blue). Values are represented as mean ± SD, n = 3 (** P < 0.01 and *** P < 0.001).
    Brca1 Encoding Lxsn Plasmid, supplied by Shanghai Genechem Ltd, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/plasmids+encoding+brca1/brca1++encoding+lxsn+plasmid/pmc09526413-29-7-11
    Average 90 stars, based on 1 article reviews
    brca1 -encoding lxsn plasmid - by Bioz Stars, 2026-10
    90/100 stars
      Buy from Supplier

    93
    Addgene inc plasmid pbabepuro ha brca1 encoding ha tagged wt brca1
    ( A ) Western blot analysis of PP2Cδ, phosphorylation and protein levels of ATM and <t>BRCA1,</t> and acetylation and protein levels of p53 in MCF-10A and MCF-7 cells. Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was used as a loading control. ( B ) Human normal mammary epithelial cells (MCF-10A) transfected with empty vector (EV) or plasmid expressing wild-type (WT) PP2Cδ (PP2Cδ-WT) were exposed to Dox (0.1 μM) for 24 hours. Cells were then collected and processed for apoptotic cell analysis using flow cytometry after annexin V–fluorescein isothiocyanate (FITC)/propidium iodide (PI) staining. An average from three replicates for each treatment (±SD) is shown. * P < 0.05 versus EV/Dox (−); # P < 0.05 versus EV/Dox (+). ( C ) MCF-10A cells were transfected with EV or plasmid expressing WT PP2Cδ. Cells were lysed and subjected to Western blot analysis with the indicated antibodies. ( D ) MCF-10A cells transfected with EV or plasmid expressing WT PP2Cδ were exposed to Dox (0.1 μM) for 24 and 48 hours. Whole-cell lysates were collected, resolved by SDS–polyacrylamide gel electrophoresis (PAGE), and immunoblotted with antibodies specific for caspase-3 and cleaved caspase-3, which is an apoptotic indicator. Equal loading was confirmed by β-actin immunoblot. The bar graphs above are densitometry analyses of the bands. Data presented are mean ± SD from three independent experiments, with nontreated controls set to 1. * P < 0.05 versus EV/Dox (−); # P < 0.05 versus their corresponding EV/Dox (+). ( E ) MCF-7 cells were transfected with control siRNA or PP2Cδ siRNA for 24 hours, followed by incubation with Dox (1.0 μM) for 48 hours. Cells were then collected and processed for apoptotic cell analysis using flow cytometry after annexin V–FITC/PI staining. The down-regulation of PP2Cδ expression by siRNA was confirmed by Western blot analysis (right). An average from three replicates for each treatment (±SD) is shown. * P < 0.05 versus siRNA-control/Dox (−); # P < 0.05 versus siRNA-control/Dox (+). ( F ) MCF-7 cells were transfected with control siRNA or PP2Cδ siRNA for 24 hours, followed by incubation with vehicle or Dox (0.5 μM) for 24 hours. Cell lysates underwent immunoblotting for the proteins as indicated. * P < 0.05 versus siRNA-control/Dox (−); # P < 0.05 versus siRNA-control/Dox (+). ( G ) MCF-7 cells were transiently transfected with 0.5 μg of pG13-LUC reporter plasmid. About 6 hours after transfection, cells were treated as in (F). Luciferase activity was determined from the transfected cell extracts. Values (mean ± SD) are expressed as fold over untreated control. * P < 0.05 versus siRNA-control/Dox (−); # P < 0.05 versus siRNA-control/Dox (+). ( H ) The p21 and Noxa mRNA for each treatment were analyzed by reverse transcription quantitative PCR (RT-qPCR). All mRNAs are normalized to PUM1 and presented as fold (mean ± SD) over untreated cells based on three experiments. * P < 0.05 versus siRNA-control/Dox (−); # P < 0.05 versus siRNA-control/Dox (+).
    Plasmid Pbabepuro Ha Brca1 Encoding Ha Tagged Wt Brca1, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/plasmids+encoding+brca1/pBABEpuro+HA+Brca1+(Plasmid+%2314999)/pmc06795508-215-1-26
    Average 93 stars, based on 1 article reviews
    plasmid pbabepuro ha brca1 encoding ha tagged wt brca1 - by Bioz Stars, 2026-10
    93/100 stars
      Buy from Supplier

    Image Search Results


    (a) Size and (b) zeta potential measurement. NPs, BRCA1 + NPs, and BRCA2 + NPs formed with addition of 4 mM of exogeneous Ca 2+ in 1 mL DMEM medium with 1 µg of BRCA1 or BRCA2 plasmid DNA, followed by incubation for 30 min at 37 °C. Each of the measurements was performed three times and mean and standard deviation were calculated.

    Journal: Scientific Reports

    Article Title: Retarding breast tumor growth with nanoparticle-facilitated intravenous delivery of BRCA1 and BRCA2 tumor suppressor genes

    doi: 10.1038/s41598-022-25511-9

    Figure Lengend Snippet: (a) Size and (b) zeta potential measurement. NPs, BRCA1 + NPs, and BRCA2 + NPs formed with addition of 4 mM of exogeneous Ca 2+ in 1 mL DMEM medium with 1 µg of BRCA1 or BRCA2 plasmid DNA, followed by incubation for 30 min at 37 °C. Each of the measurements was performed three times and mean and standard deviation were calculated.

    Article Snippet: The plasmids encoding BRCA1 (catalog no. 61586) and BRCA2 (catalog no. 16245) tumor suppressor genes were ordered from ‘Addgene’ (USA), where pc BRCA1-385 was a gift from Lawrence Brody and p CIN BRCA2 WT was a gift from Mien-Chie Hung , .

    Techniques: Zeta Potential Analyzer, Plasmid Preparation, Incubation, Standard Deviation

    Cell viability assessment of BRCA1 and BRCA2 plasmid delivery in (a) MCF-7 (b) MDA-MB-231 and (c) 4T1 cells treated with BRCA1 + NP, and BRCA2 + NP formulations for 48 h. The experiments were performed three times in each of the cell lines and values were presented as mean ± SD of triplicates in MTT assay. * indicated p < 0.05 compared to NPs control.

    Journal: Scientific Reports

    Article Title: Retarding breast tumor growth with nanoparticle-facilitated intravenous delivery of BRCA1 and BRCA2 tumor suppressor genes

    doi: 10.1038/s41598-022-25511-9

    Figure Lengend Snippet: Cell viability assessment of BRCA1 and BRCA2 plasmid delivery in (a) MCF-7 (b) MDA-MB-231 and (c) 4T1 cells treated with BRCA1 + NP, and BRCA2 + NP formulations for 48 h. The experiments were performed three times in each of the cell lines and values were presented as mean ± SD of triplicates in MTT assay. * indicated p < 0.05 compared to NPs control.

    Article Snippet: The plasmids encoding BRCA1 (catalog no. 61586) and BRCA2 (catalog no. 16245) tumor suppressor genes were ordered from ‘Addgene’ (USA), where pc BRCA1-385 was a gift from Lawrence Brody and p CIN BRCA2 WT was a gift from Mien-Chie Hung , .

    Techniques: Plasmid Preparation, MTT Assay, Control

    Cytotoxicity imposed by  BRCA1  + NP and BRCA2 + NP formulations in three  breast cancer  cell lines.

    Journal: Scientific Reports

    Article Title: Retarding breast tumor growth with nanoparticle-facilitated intravenous delivery of BRCA1 and BRCA2 tumor suppressor genes

    doi: 10.1038/s41598-022-25511-9

    Figure Lengend Snippet: Cytotoxicity imposed by BRCA1 + NP and BRCA2 + NP formulations in three breast cancer cell lines.

    Article Snippet: The plasmids encoding BRCA1 (catalog no. 61586) and BRCA2 (catalog no. 16245) tumor suppressor genes were ordered from ‘Addgene’ (USA), where pc BRCA1-385 was a gift from Lawrence Brody and p CIN BRCA2 WT was a gift from Mien-Chie Hung , .

    Techniques:

    Light microscopic images of two different cell lines following treatment with NP, BRCA1 + NP and BRCA2 + NP. Cells treated with BRCA1 + NP and BRCA2 + NP, revealed decrease in cellular density in MCF-7 (upper panel) and 4T1 (lower panel) cell line, compared to the untreated control cells (concentrated).

    Journal: Scientific Reports

    Article Title: Retarding breast tumor growth with nanoparticle-facilitated intravenous delivery of BRCA1 and BRCA2 tumor suppressor genes

    doi: 10.1038/s41598-022-25511-9

    Figure Lengend Snippet: Light microscopic images of two different cell lines following treatment with NP, BRCA1 + NP and BRCA2 + NP. Cells treated with BRCA1 + NP and BRCA2 + NP, revealed decrease in cellular density in MCF-7 (upper panel) and 4T1 (lower panel) cell line, compared to the untreated control cells (concentrated).

    Article Snippet: The plasmids encoding BRCA1 (catalog no. 61586) and BRCA2 (catalog no. 16245) tumor suppressor genes were ordered from ‘Addgene’ (USA), where pc BRCA1-385 was a gift from Lawrence Brody and p CIN BRCA2 WT was a gift from Mien-Chie Hung , .

    Techniques: Control

    (a) Western Blot image following intracellular delivery of BRCA1 + NP and BRCA2 + NP in MCF-7 cell line. Cells were incubated with NPs with loaded BRCA1 and BRCA2 plasmids for 48 h prior to cell lysis for protein extraction and Western blotting analysis. Detection of P-MAPK, T-MAPK and GAPDH (housekeeping protein) was performed using respective primary antibodies. (b) Densitometry analysis showing ratio of P-MAPK/total MAPK expression. * indicates p < 0.05, with significant change in protein expression profile.

    Journal: Scientific Reports

    Article Title: Retarding breast tumor growth with nanoparticle-facilitated intravenous delivery of BRCA1 and BRCA2 tumor suppressor genes

    doi: 10.1038/s41598-022-25511-9

    Figure Lengend Snippet: (a) Western Blot image following intracellular delivery of BRCA1 + NP and BRCA2 + NP in MCF-7 cell line. Cells were incubated with NPs with loaded BRCA1 and BRCA2 plasmids for 48 h prior to cell lysis for protein extraction and Western blotting analysis. Detection of P-MAPK, T-MAPK and GAPDH (housekeeping protein) was performed using respective primary antibodies. (b) Densitometry analysis showing ratio of P-MAPK/total MAPK expression. * indicates p < 0.05, with significant change in protein expression profile.

    Article Snippet: The plasmids encoding BRCA1 (catalog no. 61586) and BRCA2 (catalog no. 16245) tumor suppressor genes were ordered from ‘Addgene’ (USA), where pc BRCA1-385 was a gift from Lawrence Brody and p CIN BRCA2 WT was a gift from Mien-Chie Hung , .

    Techniques: Western Blot, Incubation, Lysis, Protein Extraction, Expressing

    Tumor regression study following intravenous delivery of NP, BRCA1 + NP, and BRCA2 + NP in 4T1 cells-induced tumor mouse model. 4T1 cells were inoculated subcutaneously on the mammary pad of mice. On day 8, as the tumor reached an approximate volume of ~ 25 mm 3 , mice were treated intravenously through tail-vein injection with 100 μL of NP (8 M Ca 2+ ), BRCA1 + NP (40 µg of plasmid) and BRCA2 + NP (40 µg of plasmid); followed by the 2nd dose at day 10. The tumor outgrowth was monitored until day 22. Five mice were used per group and data were represented as mean ± SD. Compared to NP control group, statistical analysis was significant, * when p < 0.05. (* p < 0.05 (NP control and BRCA1 + NP), * p < 0.05 (NP control and BRCA2 + NP).

    Journal: Scientific Reports

    Article Title: Retarding breast tumor growth with nanoparticle-facilitated intravenous delivery of BRCA1 and BRCA2 tumor suppressor genes

    doi: 10.1038/s41598-022-25511-9

    Figure Lengend Snippet: Tumor regression study following intravenous delivery of NP, BRCA1 + NP, and BRCA2 + NP in 4T1 cells-induced tumor mouse model. 4T1 cells were inoculated subcutaneously on the mammary pad of mice. On day 8, as the tumor reached an approximate volume of ~ 25 mm 3 , mice were treated intravenously through tail-vein injection with 100 μL of NP (8 M Ca 2+ ), BRCA1 + NP (40 µg of plasmid) and BRCA2 + NP (40 µg of plasmid); followed by the 2nd dose at day 10. The tumor outgrowth was monitored until day 22. Five mice were used per group and data were represented as mean ± SD. Compared to NP control group, statistical analysis was significant, * when p < 0.05. (* p < 0.05 (NP control and BRCA1 + NP), * p < 0.05 (NP control and BRCA2 + NP).

    Article Snippet: The plasmids encoding BRCA1 (catalog no. 61586) and BRCA2 (catalog no. 16245) tumor suppressor genes were ordered from ‘Addgene’ (USA), where pc BRCA1-385 was a gift from Lawrence Brody and p CIN BRCA2 WT was a gift from Mien-Chie Hung , .

    Techniques: Injection, Plasmid Preparation, Control

    Transgene delivery of BRCA1 + NP and BRCA2 + NP in 4T1-induced tumor mouse model inhibited tumor growth. ( a ) Tumor images captured following sacrifice at day 22. ( b ) Quantitation of tumor volumes in NP control, BRCA1 plasmid-treated mice and BRCA2 plasmid-treated mice. ( c ) Quantitation of tumor weights. Statistical analysis was found significant compared to NP control group, * when p < 0.05.

    Journal: Scientific Reports

    Article Title: Retarding breast tumor growth with nanoparticle-facilitated intravenous delivery of BRCA1 and BRCA2 tumor suppressor genes

    doi: 10.1038/s41598-022-25511-9

    Figure Lengend Snippet: Transgene delivery of BRCA1 + NP and BRCA2 + NP in 4T1-induced tumor mouse model inhibited tumor growth. ( a ) Tumor images captured following sacrifice at day 22. ( b ) Quantitation of tumor volumes in NP control, BRCA1 plasmid-treated mice and BRCA2 plasmid-treated mice. ( c ) Quantitation of tumor weights. Statistical analysis was found significant compared to NP control group, * when p < 0.05.

    Article Snippet: The plasmids encoding BRCA1 (catalog no. 61586) and BRCA2 (catalog no. 16245) tumor suppressor genes were ordered from ‘Addgene’ (USA), where pc BRCA1-385 was a gift from Lawrence Brody and p CIN BRCA2 WT was a gift from Mien-Chie Hung , .

    Techniques: Quantitation Assay, Control, Plasmid Preparation

    (A–C) Level of BRCA1 and PKM2 was tested by Western blot and quantification analysis. (D) Number of apoptotic cells was measured at 2 days via the annexin V assay. (E) Immunofluorescence imaging of the PKM2 expression and the nucleus (DAPI, blue). Values are represented as mean ± SD, n = 3 (** P < 0.01 and *** P < 0.001).

    Journal: PeerJ

    Article Title: BRCA1 overexpression attenuates breast cancer cell growth and migration by regulating the pyruvate kinase M2-mediated Warburg effect via the PI3K/AKT signaling pathway

    doi: 10.7717/peerj.14052

    Figure Lengend Snippet: (A–C) Level of BRCA1 and PKM2 was tested by Western blot and quantification analysis. (D) Number of apoptotic cells was measured at 2 days via the annexin V assay. (E) Immunofluorescence imaging of the PKM2 expression and the nucleus (DAPI, blue). Values are represented as mean ± SD, n = 3 (** P < 0.01 and *** P < 0.001).

    Article Snippet: MCF-7- BRCA1 was stably transfected using a BRCA1 -encoding LXSN plasmid (Shanghai GeneChem Co., Ltd., Shanghai, China) ( ).

    Techniques: Western Blot, Annexin V Assay, Immunofluorescence, Imaging, Expressing

    (A and B) The effects of BRCA1 on migration of MCF-7 cells was measured via transwell method. Values are represented as mean ± SD, n = 3 (** P < 0.01).

    Journal: PeerJ

    Article Title: BRCA1 overexpression attenuates breast cancer cell growth and migration by regulating the pyruvate kinase M2-mediated Warburg effect via the PI3K/AKT signaling pathway

    doi: 10.7717/peerj.14052

    Figure Lengend Snippet: (A and B) The effects of BRCA1 on migration of MCF-7 cells was measured via transwell method. Values are represented as mean ± SD, n = 3 (** P < 0.01).

    Article Snippet: MCF-7- BRCA1 was stably transfected using a BRCA1 -encoding LXSN plasmid (Shanghai GeneChem Co., Ltd., Shanghai, China) ( ).

    Techniques: Migration

    LXSN group was demonstrated to be less response compared to BRCA1-MCF-7 group to (A) Doxorubicin, (B) Paclitaxel, (C) Cisplatin. LXSN and BRCA1 MCF-7 cells response to treatment was meassured by IC 50 for 24h with anti-cancer agents. Values are represented as mean ± SD, n = 3 (* P < 0.05).

    Journal: PeerJ

    Article Title: BRCA1 overexpression attenuates breast cancer cell growth and migration by regulating the pyruvate kinase M2-mediated Warburg effect via the PI3K/AKT signaling pathway

    doi: 10.7717/peerj.14052

    Figure Lengend Snippet: LXSN group was demonstrated to be less response compared to BRCA1-MCF-7 group to (A) Doxorubicin, (B) Paclitaxel, (C) Cisplatin. LXSN and BRCA1 MCF-7 cells response to treatment was meassured by IC 50 for 24h with anti-cancer agents. Values are represented as mean ± SD, n = 3 (* P < 0.05).

    Article Snippet: MCF-7- BRCA1 was stably transfected using a BRCA1 -encoding LXSN plasmid (Shanghai GeneChem Co., Ltd., Shanghai, China) ( ).

    Techniques:

    ( A ) Western blot analysis of PP2Cδ, phosphorylation and protein levels of ATM and BRCA1, and acetylation and protein levels of p53 in MCF-10A and MCF-7 cells. Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was used as a loading control. ( B ) Human normal mammary epithelial cells (MCF-10A) transfected with empty vector (EV) or plasmid expressing wild-type (WT) PP2Cδ (PP2Cδ-WT) were exposed to Dox (0.1 μM) for 24 hours. Cells were then collected and processed for apoptotic cell analysis using flow cytometry after annexin V–fluorescein isothiocyanate (FITC)/propidium iodide (PI) staining. An average from three replicates for each treatment (±SD) is shown. * P < 0.05 versus EV/Dox (−); # P < 0.05 versus EV/Dox (+). ( C ) MCF-10A cells were transfected with EV or plasmid expressing WT PP2Cδ. Cells were lysed and subjected to Western blot analysis with the indicated antibodies. ( D ) MCF-10A cells transfected with EV or plasmid expressing WT PP2Cδ were exposed to Dox (0.1 μM) for 24 and 48 hours. Whole-cell lysates were collected, resolved by SDS–polyacrylamide gel electrophoresis (PAGE), and immunoblotted with antibodies specific for caspase-3 and cleaved caspase-3, which is an apoptotic indicator. Equal loading was confirmed by β-actin immunoblot. The bar graphs above are densitometry analyses of the bands. Data presented are mean ± SD from three independent experiments, with nontreated controls set to 1. * P < 0.05 versus EV/Dox (−); # P < 0.05 versus their corresponding EV/Dox (+). ( E ) MCF-7 cells were transfected with control siRNA or PP2Cδ siRNA for 24 hours, followed by incubation with Dox (1.0 μM) for 48 hours. Cells were then collected and processed for apoptotic cell analysis using flow cytometry after annexin V–FITC/PI staining. The down-regulation of PP2Cδ expression by siRNA was confirmed by Western blot analysis (right). An average from three replicates for each treatment (±SD) is shown. * P < 0.05 versus siRNA-control/Dox (−); # P < 0.05 versus siRNA-control/Dox (+). ( F ) MCF-7 cells were transfected with control siRNA or PP2Cδ siRNA for 24 hours, followed by incubation with vehicle or Dox (0.5 μM) for 24 hours. Cell lysates underwent immunoblotting for the proteins as indicated. * P < 0.05 versus siRNA-control/Dox (−); # P < 0.05 versus siRNA-control/Dox (+). ( G ) MCF-7 cells were transiently transfected with 0.5 μg of pG13-LUC reporter plasmid. About 6 hours after transfection, cells were treated as in (F). Luciferase activity was determined from the transfected cell extracts. Values (mean ± SD) are expressed as fold over untreated control. * P < 0.05 versus siRNA-control/Dox (−); # P < 0.05 versus siRNA-control/Dox (+). ( H ) The p21 and Noxa mRNA for each treatment were analyzed by reverse transcription quantitative PCR (RT-qPCR). All mRNAs are normalized to PUM1 and presented as fold (mean ± SD) over untreated cells based on three experiments. * P < 0.05 versus siRNA-control/Dox (−); # P < 0.05 versus siRNA-control/Dox (+).

    Journal: Science Advances

    Article Title: PP2Cδ inhibits p300-mediated p53 acetylation via ATM/BRCA1 pathway to impede DNA damage response in breast cancer

    doi: 10.1126/sciadv.aaw8417

    Figure Lengend Snippet: ( A ) Western blot analysis of PP2Cδ, phosphorylation and protein levels of ATM and BRCA1, and acetylation and protein levels of p53 in MCF-10A and MCF-7 cells. Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was used as a loading control. ( B ) Human normal mammary epithelial cells (MCF-10A) transfected with empty vector (EV) or plasmid expressing wild-type (WT) PP2Cδ (PP2Cδ-WT) were exposed to Dox (0.1 μM) for 24 hours. Cells were then collected and processed for apoptotic cell analysis using flow cytometry after annexin V–fluorescein isothiocyanate (FITC)/propidium iodide (PI) staining. An average from three replicates for each treatment (±SD) is shown. * P < 0.05 versus EV/Dox (−); # P < 0.05 versus EV/Dox (+). ( C ) MCF-10A cells were transfected with EV or plasmid expressing WT PP2Cδ. Cells were lysed and subjected to Western blot analysis with the indicated antibodies. ( D ) MCF-10A cells transfected with EV or plasmid expressing WT PP2Cδ were exposed to Dox (0.1 μM) for 24 and 48 hours. Whole-cell lysates were collected, resolved by SDS–polyacrylamide gel electrophoresis (PAGE), and immunoblotted with antibodies specific for caspase-3 and cleaved caspase-3, which is an apoptotic indicator. Equal loading was confirmed by β-actin immunoblot. The bar graphs above are densitometry analyses of the bands. Data presented are mean ± SD from three independent experiments, with nontreated controls set to 1. * P < 0.05 versus EV/Dox (−); # P < 0.05 versus their corresponding EV/Dox (+). ( E ) MCF-7 cells were transfected with control siRNA or PP2Cδ siRNA for 24 hours, followed by incubation with Dox (1.0 μM) for 48 hours. Cells were then collected and processed for apoptotic cell analysis using flow cytometry after annexin V–FITC/PI staining. The down-regulation of PP2Cδ expression by siRNA was confirmed by Western blot analysis (right). An average from three replicates for each treatment (±SD) is shown. * P < 0.05 versus siRNA-control/Dox (−); # P < 0.05 versus siRNA-control/Dox (+). ( F ) MCF-7 cells were transfected with control siRNA or PP2Cδ siRNA for 24 hours, followed by incubation with vehicle or Dox (0.5 μM) for 24 hours. Cell lysates underwent immunoblotting for the proteins as indicated. * P < 0.05 versus siRNA-control/Dox (−); # P < 0.05 versus siRNA-control/Dox (+). ( G ) MCF-7 cells were transiently transfected with 0.5 μg of pG13-LUC reporter plasmid. About 6 hours after transfection, cells were treated as in (F). Luciferase activity was determined from the transfected cell extracts. Values (mean ± SD) are expressed as fold over untreated control. * P < 0.05 versus siRNA-control/Dox (−); # P < 0.05 versus siRNA-control/Dox (+). ( H ) The p21 and Noxa mRNA for each treatment were analyzed by reverse transcription quantitative PCR (RT-qPCR). All mRNAs are normalized to PUM1 and presented as fold (mean ± SD) over untreated cells based on three experiments. * P < 0.05 versus siRNA-control/Dox (−); # P < 0.05 versus siRNA-control/Dox (+).

    Article Snippet: The plasmid pBABEpuro HA Brca1 encoding HA-tagged WT BRCA1 and plasmid pBABEpuro Brca1 S1423A S1524A HA encoding HA-tagged BRCA1 S1423A/S1524A mutant were gifts from S. Elledge (Addgene plasmid nos.

    Techniques: Western Blot, Phospho-proteomics, Control, Transfection, Plasmid Preparation, Expressing, Cell Analysis, Flow Cytometry, Staining, Polyacrylamide Gel Electrophoresis, Incubation, Luciferase, Activity Assay, Reverse Transcription, Real-time Polymerase Chain Reaction, Quantitative RT-PCR

    ( A ) p53 acetylation was decreased upon BRCA1 knockdown. MCF-7 cells were transfected with scramble or BRCA1 siRNA, followed by UV treatment (20 J/m 2 for an 8-hour recovery). p53 protein level was normalized by MG132 (20 μM). p53 acetylation level on Lys 373 and levels of BRCA1, p53, and vinculin were detected with specific antibodies. The data represent mean ± SD from three separate experiments. * P < 0.05 versus control; # P < 0.05 versus UV + scramble siRNA. ( B ) Coimmunoprecipitation of BRCA1, p300, and p53 in MCF-7 cells transfected with the WT BRCA1 expression plasmid (WT BRCA1). Aliquots of cellular lysate were subjected to immunoprecipitations using anti-BRCA1, p53 antibodies, or control immunoglobulin G (IgG), followed by immunoblotting with antibodies against BRCA1, p300, or p53. ( C ) Schematic outline of CRISPR-Cas9 genome editing design to knock out BRCA1 exon 5. sgRNA1/2 specifically bind the introns before and after exon 5. The arrows represent location of primers for deletion PCR. Deletion of exon 5 results in frameshift, with early translational termination, mimicking a known BRCA1 pathogenic mutation. ( D ) Sorting for Cas9/guide transfected (GFP + ) cells. ( E ) PCR confirms the deletion of BRCA1 exon 5 in the hTERT-HME1-BRCA1 (E5) −/− line. bp, base pairs. ( F ) BRCA1 KO decreases basal and UV-induced p300’s binding to total p53 and p53 acetylation. Twenty-four hours after cotransfection of the indicated plasmids, cells were treated with or without UV. Aliquots of cellular lysate were subjected to immunoprecipitations (IP) using anti-p300 antibody or control IgG, followed by immunoblotting with antibodies against p53 or p300. BRCA1, p53, and Ac-p53 were measured by immunoblotting. ( G ) HME1-BRCA1 −/− cells were transfected with 2 μg of hemagglutinin (HA)–tagged WT, S1423A (SA), ∆224-500, and ∆1560-1863 mutant. Twenty-four hours after transfection of the indicated plasmids, cells were treated with or without UV. Cell extracts were prepared and underwent immunoblotting for the proteins as indicated, and signal intensity was quantified. Steady-state levels of transfected protein were determined by Western blot analysis using antibody against the HA epitope tag (α-HA). The data represent mean ± SD from three separate experiments. * P < 0.05 versus UV/EV. ( H ) Schematic diagram of BRCA1 deletion mutants used in (D). ( I ) H1299 cells were transfected with p53 WT and internal control GFP (lane 1) or cotransfected with c-myc–tagged p300 (lane 2) or c-myc–tagged p300 and the indicated amounts of BRCA1 WT (lanes 3 and 4), ∆224-500 mutant (lanes 5 and 6), and ∆1560-1863 mutant (lanes 7 and 8). Cell extracts were prepared (36 hours after transfection), and the levels of acetylation and total p53 protein were determined by Western blotting as described in Materials and Methods. p300 levels were determined by anti-p300 (RW128). The data represent mean ± SD from three separate experiments. * P < 0.05 versus control; # P < 0.05 versus corresponding controls in WT.

    Journal: Science Advances

    Article Title: PP2Cδ inhibits p300-mediated p53 acetylation via ATM/BRCA1 pathway to impede DNA damage response in breast cancer

    doi: 10.1126/sciadv.aaw8417

    Figure Lengend Snippet: ( A ) p53 acetylation was decreased upon BRCA1 knockdown. MCF-7 cells were transfected with scramble or BRCA1 siRNA, followed by UV treatment (20 J/m 2 for an 8-hour recovery). p53 protein level was normalized by MG132 (20 μM). p53 acetylation level on Lys 373 and levels of BRCA1, p53, and vinculin were detected with specific antibodies. The data represent mean ± SD from three separate experiments. * P < 0.05 versus control; # P < 0.05 versus UV + scramble siRNA. ( B ) Coimmunoprecipitation of BRCA1, p300, and p53 in MCF-7 cells transfected with the WT BRCA1 expression plasmid (WT BRCA1). Aliquots of cellular lysate were subjected to immunoprecipitations using anti-BRCA1, p53 antibodies, or control immunoglobulin G (IgG), followed by immunoblotting with antibodies against BRCA1, p300, or p53. ( C ) Schematic outline of CRISPR-Cas9 genome editing design to knock out BRCA1 exon 5. sgRNA1/2 specifically bind the introns before and after exon 5. The arrows represent location of primers for deletion PCR. Deletion of exon 5 results in frameshift, with early translational termination, mimicking a known BRCA1 pathogenic mutation. ( D ) Sorting for Cas9/guide transfected (GFP + ) cells. ( E ) PCR confirms the deletion of BRCA1 exon 5 in the hTERT-HME1-BRCA1 (E5) −/− line. bp, base pairs. ( F ) BRCA1 KO decreases basal and UV-induced p300’s binding to total p53 and p53 acetylation. Twenty-four hours after cotransfection of the indicated plasmids, cells were treated with or without UV. Aliquots of cellular lysate were subjected to immunoprecipitations (IP) using anti-p300 antibody or control IgG, followed by immunoblotting with antibodies against p53 or p300. BRCA1, p53, and Ac-p53 were measured by immunoblotting. ( G ) HME1-BRCA1 −/− cells were transfected with 2 μg of hemagglutinin (HA)–tagged WT, S1423A (SA), ∆224-500, and ∆1560-1863 mutant. Twenty-four hours after transfection of the indicated plasmids, cells were treated with or without UV. Cell extracts were prepared and underwent immunoblotting for the proteins as indicated, and signal intensity was quantified. Steady-state levels of transfected protein were determined by Western blot analysis using antibody against the HA epitope tag (α-HA). The data represent mean ± SD from three separate experiments. * P < 0.05 versus UV/EV. ( H ) Schematic diagram of BRCA1 deletion mutants used in (D). ( I ) H1299 cells were transfected with p53 WT and internal control GFP (lane 1) or cotransfected with c-myc–tagged p300 (lane 2) or c-myc–tagged p300 and the indicated amounts of BRCA1 WT (lanes 3 and 4), ∆224-500 mutant (lanes 5 and 6), and ∆1560-1863 mutant (lanes 7 and 8). Cell extracts were prepared (36 hours after transfection), and the levels of acetylation and total p53 protein were determined by Western blotting as described in Materials and Methods. p300 levels were determined by anti-p300 (RW128). The data represent mean ± SD from three separate experiments. * P < 0.05 versus control; # P < 0.05 versus corresponding controls in WT.

    Article Snippet: The plasmid pBABEpuro HA Brca1 encoding HA-tagged WT BRCA1 and plasmid pBABEpuro Brca1 S1423A S1524A HA encoding HA-tagged BRCA1 S1423A/S1524A mutant were gifts from S. Elledge (Addgene plasmid nos.

    Techniques: Knockdown, Transfection, Control, Expressing, Plasmid Preparation, Western Blot, CRISPR, Knock-Out, Mutagenesis, Binding Assay, Cotransfection

    ( A ) Glutathione S -transferase (GST)–p53 was acetylated by recombinant p300 in the presence of the indicated amounts of purified BRCA1 or bovine serum albumin (BSA) and analyzed by SDS ± PAGE followed by autoradiography. The intensity of the acetylated GST-p53 was quantified by phosphoimager analysis and plotted. The intensity of acetylated GST-p53 in the absence of BRCA1 or BSA was set to 1. The data represent mean ± SD from three separate experiments. * P < 0.05 versus control; # P < 0.05 versus WT BRCA1. ( B ) H1299 cells were transfected with plasmids encoding p53 (0.3 μg), p300 (0.5 μg), and/or WT BRCA1, BRCA1 S1423A, and BRCA1 S1423D (1 μg) as indicated at the bottom. Cell lysates were prepared 36 hours after transfection for Western blot analysis; 200 μg of proteins was loaded onto a 10% SDS gel. ( C ) As indicated, plasmids encoding no protein as a control (1 μg; control), p53 (50 ng) alone, or with p300 (0.15 μg) or with BRCA1 (WT, S1423A, or S1423D), and with a pG13-LUC plasmid (0.2 μg) were introduced into H1299 cells by using Lipofectamine. Forty-eight hours after transfection, cells were harvested for luciferase assays. Each column represents the mean data of three experiments. ( D ) The p21 and Noxa mRNAs for each treatment were analyzed by RT-qPCR. All mRNAs are normalized to PUM1 and presented as fold (mean ± SD) over untreated cells based on three experiments. * P < 0.05 versus p53(+); # P < 0.05 versus p53(+)/p300(+)/WT BRCA1(+).

    Journal: Science Advances

    Article Title: PP2Cδ inhibits p300-mediated p53 acetylation via ATM/BRCA1 pathway to impede DNA damage response in breast cancer

    doi: 10.1126/sciadv.aaw8417

    Figure Lengend Snippet: ( A ) Glutathione S -transferase (GST)–p53 was acetylated by recombinant p300 in the presence of the indicated amounts of purified BRCA1 or bovine serum albumin (BSA) and analyzed by SDS ± PAGE followed by autoradiography. The intensity of the acetylated GST-p53 was quantified by phosphoimager analysis and plotted. The intensity of acetylated GST-p53 in the absence of BRCA1 or BSA was set to 1. The data represent mean ± SD from three separate experiments. * P < 0.05 versus control; # P < 0.05 versus WT BRCA1. ( B ) H1299 cells were transfected with plasmids encoding p53 (0.3 μg), p300 (0.5 μg), and/or WT BRCA1, BRCA1 S1423A, and BRCA1 S1423D (1 μg) as indicated at the bottom. Cell lysates were prepared 36 hours after transfection for Western blot analysis; 200 μg of proteins was loaded onto a 10% SDS gel. ( C ) As indicated, plasmids encoding no protein as a control (1 μg; control), p53 (50 ng) alone, or with p300 (0.15 μg) or with BRCA1 (WT, S1423A, or S1423D), and with a pG13-LUC plasmid (0.2 μg) were introduced into H1299 cells by using Lipofectamine. Forty-eight hours after transfection, cells were harvested for luciferase assays. Each column represents the mean data of three experiments. ( D ) The p21 and Noxa mRNAs for each treatment were analyzed by RT-qPCR. All mRNAs are normalized to PUM1 and presented as fold (mean ± SD) over untreated cells based on three experiments. * P < 0.05 versus p53(+); # P < 0.05 versus p53(+)/p300(+)/WT BRCA1(+).

    Article Snippet: The plasmid pBABEpuro HA Brca1 encoding HA-tagged WT BRCA1 and plasmid pBABEpuro Brca1 S1423A S1524A HA encoding HA-tagged BRCA1 S1423A/S1524A mutant were gifts from S. Elledge (Addgene plasmid nos.

    Techniques: Recombinant, Purification, SDS Page, Autoradiography, Control, Transfection, Western Blot, SDS-Gel, Plasmid Preparation, Luciferase, Quantitative RT-PCR

    ( A ) MCF-10A cells were transfected with scramble or ATM siRNA, followed by UV treatment (20 J/m 2 for an 8-hour recovery). BRCA1 phosphorylation level on Ser 1423 and levels of BRCA1, p53 acetylation, ATM, and actin were detected with specific antibodies. The data represent mean ± SD from three separate experiments. * P < 0.05 versus control; # P < 0.05 versus UV+ scramble siRNA. ( B ) MCF-10A cells were pretreated with 10 μM KU-55933 for 1 hour, followed by UV treatment. BRCA1 phosphorylation and p53 acetylation were detected with specific antibodies. The data represent mean ± SD from three separate experiments. * P < 0.05 versus control; # P < 0.05 versus UV alone. ( C ) MCF-7 cells were pretreated with 10 μM KU-55933 or 2.5 μM C23 for 1 hour, followed by UV treatment. p53 protein level was normalized by MG132 (20 μM). Treated cells were lysed and Western blotted against indicated antibodies. The data represent mean ± SD from three separate experiments. * P < 0.05 versus control; # P < 0.05 versus UV alone.

    Journal: Science Advances

    Article Title: PP2Cδ inhibits p300-mediated p53 acetylation via ATM/BRCA1 pathway to impede DNA damage response in breast cancer

    doi: 10.1126/sciadv.aaw8417

    Figure Lengend Snippet: ( A ) MCF-10A cells were transfected with scramble or ATM siRNA, followed by UV treatment (20 J/m 2 for an 8-hour recovery). BRCA1 phosphorylation level on Ser 1423 and levels of BRCA1, p53 acetylation, ATM, and actin were detected with specific antibodies. The data represent mean ± SD from three separate experiments. * P < 0.05 versus control; # P < 0.05 versus UV+ scramble siRNA. ( B ) MCF-10A cells were pretreated with 10 μM KU-55933 for 1 hour, followed by UV treatment. BRCA1 phosphorylation and p53 acetylation were detected with specific antibodies. The data represent mean ± SD from three separate experiments. * P < 0.05 versus control; # P < 0.05 versus UV alone. ( C ) MCF-7 cells were pretreated with 10 μM KU-55933 or 2.5 μM C23 for 1 hour, followed by UV treatment. p53 protein level was normalized by MG132 (20 μM). Treated cells were lysed and Western blotted against indicated antibodies. The data represent mean ± SD from three separate experiments. * P < 0.05 versus control; # P < 0.05 versus UV alone.

    Article Snippet: The plasmid pBABEpuro HA Brca1 encoding HA-tagged WT BRCA1 and plasmid pBABEpuro Brca1 S1423A S1524A HA encoding HA-tagged BRCA1 S1423A/S1524A mutant were gifts from S. Elledge (Addgene plasmid nos.

    Techniques: Transfection, Phospho-proteomics, Control, Western Blot

    ( A ) PP2Cδ dephosphorylates intact ATM at phospho-Ser 1981 . An in vitro phosphatase assay was performed by incubating immunoprecipitated ATM and purified PP2Cδ, followed by Western blot probing with antibodies to ATM phospho-Ser 1981 . The data represent mean ± SD from three separate experiments. * P < 0.05 versus control. ( B ) Phosphopeptides from p38 MAPK (positive control), UNG2 (negative control), BRCA1 (phospho-Ser 1423 ), and ATM (phospho-Ser 1981 ) were incubated with PP2Cδ in an in vitro phosphatase assay. Release of free phosphate was measured by absorbance at 630 nm in the presence of molybdate dye. Reactions were also carried out without magnesium or peptide. ( C ) MCF-10A cells were transfected with EV or plasmid expressing WT PP2Cδ, followed by UV treatment (20 J/m 2 for an 8-hour recovery). Cells were lysed, and the ATM phosphorylation and protein levels were detected by Western blotting with specific antibodies. The data represent mean ± SD from three separate experiments. * P < 0.05 versus EV/UV (−); # P < 0.05 versus EV/UV (+).

    Journal: Science Advances

    Article Title: PP2Cδ inhibits p300-mediated p53 acetylation via ATM/BRCA1 pathway to impede DNA damage response in breast cancer

    doi: 10.1126/sciadv.aaw8417

    Figure Lengend Snippet: ( A ) PP2Cδ dephosphorylates intact ATM at phospho-Ser 1981 . An in vitro phosphatase assay was performed by incubating immunoprecipitated ATM and purified PP2Cδ, followed by Western blot probing with antibodies to ATM phospho-Ser 1981 . The data represent mean ± SD from three separate experiments. * P < 0.05 versus control. ( B ) Phosphopeptides from p38 MAPK (positive control), UNG2 (negative control), BRCA1 (phospho-Ser 1423 ), and ATM (phospho-Ser 1981 ) were incubated with PP2Cδ in an in vitro phosphatase assay. Release of free phosphate was measured by absorbance at 630 nm in the presence of molybdate dye. Reactions were also carried out without magnesium or peptide. ( C ) MCF-10A cells were transfected with EV or plasmid expressing WT PP2Cδ, followed by UV treatment (20 J/m 2 for an 8-hour recovery). Cells were lysed, and the ATM phosphorylation and protein levels were detected by Western blotting with specific antibodies. The data represent mean ± SD from three separate experiments. * P < 0.05 versus EV/UV (−); # P < 0.05 versus EV/UV (+).

    Article Snippet: The plasmid pBABEpuro HA Brca1 encoding HA-tagged WT BRCA1 and plasmid pBABEpuro Brca1 S1423A S1524A HA encoding HA-tagged BRCA1 S1423A/S1524A mutant were gifts from S. Elledge (Addgene plasmid nos.

    Techniques: In Vitro, Phosphatase Assay, Immunoprecipitation, Purification, Western Blot, Control, Positive Control, Negative Control, Incubation, Transfection, Plasmid Preparation, Expressing, Phospho-proteomics

    ( A to C ) Paraffin sections of mouse normal breast and MCF-7 xenograft tumor tissues were subjected to IHC staining using the antibodies indicated. Correlation between tumor tissue PP2Cδ level, p-BRCA1, and Ac-p53 staining score was tested by Pearson’s rank correlation analysis, with r and P values indicated. n = 12 mice per cohort. ( D ) Breast cancer tissue microarrays (TMAs) with adjacent normal breast tissue and breast cancer tissues from 103 breast cancer patients were subjected to IHC staining using the antibodies indicated. ( E ) IHC analysis of PP2Cδ staining score in normal adjacent breast tissue and breast cancer tissues. P value was calculated by one-way analysis of variance (ANOVA). * P < 0.01 versus normal tissue. ( F and G ) Correlation between tissue PP2Cδ level and p-BRCA1 or Ac-p53 staining score was tested by Spearman’s rank correlation analysis, with r and P values indicated. ( H ) Female nude mice inoculated with MCF-7 cells were treated with C23 (3 mg/kg, intraperitoneally), Dox (1.70 mg/kg, intraperitoneally; five times per week every 2 weeks), or C23 + Dox. Control animals received intraperitoneal saline injections. Values represent the average tumor size (mean ± SD) at intervals after initiation of Dox administration ( n = 12 animals per treatment group). ( I ) Tumor weights from (H). Values represent mean ± SD; * P < 0.05 versus control; # P < 0.05 versus Dox. ( J ) Xenograft tumor tissues were excised from each animal and prepared for Western blot analysis. The protein expressions of PP2Cδ, p-ATM, p-BRCA1, Ac-p53, and cleaved caspase-3 were identified, and relative intensities were measured. β-Actin was used as a loading control. Data presented are mean ± SD from four independent experiments, with nontreated controls set to 1. * P < 0.05 versus control; # P < 0.05 versus Dox. ( K ) The identified signaling pathway in this study indicated that BRCA1 facilitates p300-mediated p53 acetylation and activation by complexing with these two proteins and that S1423/1524 phosphorylation is indispensable for this regulatory process. Aberrant PP2Cδ activity, via directly dephosphorylating ATM, suppresses DNA damage–induced BRCA1 phosphorylation and subsequently inhibits p300-mediated p53 acetylation and activation, leading to cancer development or resistance to chemotherapy. C23 represses this process by inhibiting PP2Cδ activity.

    Journal: Science Advances

    Article Title: PP2Cδ inhibits p300-mediated p53 acetylation via ATM/BRCA1 pathway to impede DNA damage response in breast cancer

    doi: 10.1126/sciadv.aaw8417

    Figure Lengend Snippet: ( A to C ) Paraffin sections of mouse normal breast and MCF-7 xenograft tumor tissues were subjected to IHC staining using the antibodies indicated. Correlation between tumor tissue PP2Cδ level, p-BRCA1, and Ac-p53 staining score was tested by Pearson’s rank correlation analysis, with r and P values indicated. n = 12 mice per cohort. ( D ) Breast cancer tissue microarrays (TMAs) with adjacent normal breast tissue and breast cancer tissues from 103 breast cancer patients were subjected to IHC staining using the antibodies indicated. ( E ) IHC analysis of PP2Cδ staining score in normal adjacent breast tissue and breast cancer tissues. P value was calculated by one-way analysis of variance (ANOVA). * P < 0.01 versus normal tissue. ( F and G ) Correlation between tissue PP2Cδ level and p-BRCA1 or Ac-p53 staining score was tested by Spearman’s rank correlation analysis, with r and P values indicated. ( H ) Female nude mice inoculated with MCF-7 cells were treated with C23 (3 mg/kg, intraperitoneally), Dox (1.70 mg/kg, intraperitoneally; five times per week every 2 weeks), or C23 + Dox. Control animals received intraperitoneal saline injections. Values represent the average tumor size (mean ± SD) at intervals after initiation of Dox administration ( n = 12 animals per treatment group). ( I ) Tumor weights from (H). Values represent mean ± SD; * P < 0.05 versus control; # P < 0.05 versus Dox. ( J ) Xenograft tumor tissues were excised from each animal and prepared for Western blot analysis. The protein expressions of PP2Cδ, p-ATM, p-BRCA1, Ac-p53, and cleaved caspase-3 were identified, and relative intensities were measured. β-Actin was used as a loading control. Data presented are mean ± SD from four independent experiments, with nontreated controls set to 1. * P < 0.05 versus control; # P < 0.05 versus Dox. ( K ) The identified signaling pathway in this study indicated that BRCA1 facilitates p300-mediated p53 acetylation and activation by complexing with these two proteins and that S1423/1524 phosphorylation is indispensable for this regulatory process. Aberrant PP2Cδ activity, via directly dephosphorylating ATM, suppresses DNA damage–induced BRCA1 phosphorylation and subsequently inhibits p300-mediated p53 acetylation and activation, leading to cancer development or resistance to chemotherapy. C23 represses this process by inhibiting PP2Cδ activity.

    Article Snippet: The plasmid pBABEpuro HA Brca1 encoding HA-tagged WT BRCA1 and plasmid pBABEpuro Brca1 S1423A S1524A HA encoding HA-tagged BRCA1 S1423A/S1524A mutant were gifts from S. Elledge (Addgene plasmid nos.

    Techniques: Immunohistochemistry, Staining, Control, Saline, Western Blot, Activation Assay, Phospho-proteomics, Activity Assay