Review



proteome profiler mouse phospho rtk array kit r d systems cat  (R&D Systems)


Bioz Verified Symbol R&D Systems is a verified supplier
Bioz Manufacturer Symbol R&D Systems manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 94

    Structured Review

    R&D Systems proteome profiler mouse phospho rtk array kit r d systems cat
    Proteome Profiler Mouse Phospho Rtk Array Kit R D Systems Cat, supplied by R&D Systems, used in various techniques. Bioz Stars score: 94/100, based on 78 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/phospho+rtk+array/Proteome+Profiler+Mouse+Phospho-RTK+Array+Kit/pm41762656-249-72-78
    Average 94 stars, based on 78 article reviews
    proteome profiler mouse phospho rtk array kit r d systems cat - by Bioz Stars, 2026-09
    94/100 stars

    Images

    Related Articles

    other:

    Article Title: Therapeutic targeting of syndecan-1 axis overcomes acquired resistance to KRAS-targeted therapy in gastrointestinal cancers
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Critical commercial assays Proteome Profiler Human Phospho-RTK Array Kit R&D Systems Cat#ARY001B Proteome Profiler Mouse Phospho-RTK Array Kit R&D Systems Cat#ARY014 Annexin V-fluorescein isothiocyanate (FITC) apoptosis detection kit BioVision Cat#K101 Experimental models: Cell lines AsPC-1 ATCC RRID:CVCL_0152 HuP-T4 ATCC RRID:CVCL_1300 MIA PaCa-2 ATCC RRID:CVCL_0428

    Viability Assay:

    Article Title: Lipocalin 2 orchestrates resistance to ferroptosis via AXL.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Rabbit anti-GPX4 Cell Signaling Technology Cat #52455S; RRID:AB_2924984 Rabbit anti-pAXL (Y702) ThermoFisher Cat #PA5-64862; RRID:AB_2662770 Rabbit anti-AXL (C terminus) LS Bio Cat # LS-B12012-100 hFAB TM Rhodamine Anti-Actin Bio-Rad Cat #120041163 Goat anti-rabbit StarBright Blue 700 Bio-Rad Cat #12004161; RRID:AB_2721073 Rabbit anti-BCL-XL Cell Signaling Technology Cat #2764T; RRID:AB_2228008 Rabbit anti-BIM Cell Signaling Technology Cat #2819S; RRID:AB_10692515 Rabbit anti-BAK Cell Signaling Technology Cat #3814S; RRID:AB_2290287 Rabbit anti-lipocalin-2 antibody Abcam Cat #ab63929; RRID:AB_1140965 Chicken anti-GFP Aves Labs Cat #GFP-1020; RRID:AB_10000240 Mouse anti-Beta III Tubulin Promega Cat #G7121; RRID:AB_430874 Rabbit anti-Phosphorylated Histone H3 Cell Signaling Technology Cat #4499; RRID:AB_10544537 Rabbit anti-Cleaved Caspase 3 Cell Signaling Technology Cat #9661; RRID:AB_2341188 Bacterial and virus strains psPAX2 (lentiviral packaging plasmid) Addgene (Didier Trono) Cat #12260; RRID:Addgene_12260 pMD2.G (lentiviral packaging plasmid) Addgene (Didier Trono) Cat #12259; RRID:Addgene_12259 MISSION pLKO.1-puro Non-Mammalian shRNA Control Sigma TRC #SHC002 Lcn2 shRNA KD1 Sigma TRC #TRCN0000055328 Lcn2 shRNA KD2 Sigma TRC #TRCN0000055331 Lcn2 shRNA KD3 Sigma TRC #TRCN0000055332 Biological samples Human glioblastoma patient tissue This paper, Cleveland Clinic See STAR Methods Human non-tumor patient tissue This paper, Cleveland Clinic See STAR Methods Primary mouse astrocytes Silver et al. 80 See STAR Methods Chemicals, peptides, and recombinant proteins RPMI 1640 medium Cleveland Clinic Media Preparation Core N/A Fetal bovine serum Cleveland Clinic Media Preparation Core N/A Penicillin-Streptomycin Cleveland Clinic Media Preparation Core N/A Trypsin-EDTA Cleveland Clinic Media Preparation Core N/A Trypan Blue ThermoFisher Cat #15250061 Image-It Lipid Peroxidation Kit Invitrogen Cat #C10445 CellRox Deep Red ThermoFisher Cat #C10422 Deferoxamine (DFO) Sigma Cat #D9533-1G RSL3 (GPX4 inhibitor) SelleckChem Cat #S8155 Erastin SelleckChem Cat #S7242 Ferrostatin-1 (Fer-1) SelleckChem Cat #S7243 Liproxstatin-1 (Lip-1) SelleckChem Cat #S7699 Necrostatin-1 SelleckChem Cat #ab141053 Z-VAD-FMK InvivoGen Cat #tlrl-vad PAC-1 SelleckChem Cat #S2738 Bemcentinib (R428, BGB324) SelleckChem Cat #S2841 1x NP-40 lysis buffer ThermoFisher Cat #J60766.AP Protease inhibitor cocktail Sigma-Aldrich Cat #P8340 (Continued on next page) 16 Cell Reports 45, 116965, March 24, 2026 .. REAGENT or RESOURCE SOURCE IDENTIFIER Phosphatase inhibitor cocktail Sigma-Aldrich Cat #P5725 PMSF Sigma-Aldrich Cat #10837091001 Sodium acetate ThermoFisher Cat #A13184-30 Thioglycolic acid Fisher Scientific Cat #M0052252G Chromogenic solution (FerroZine) MedChemExpress Cat #HY-137805 FITC-annexin V BioLegend Cat #640914 DRAQ7 ThermoFisher Cat #D15105 Critical commercial assays CellTiter Glo Cell Viability Assay Promega Cat #G7573 RNeasy Mini Kit Qiagen Cat #74106 qScript cDNA SuperMix Quanta Biosciences Cat #95048-100 Fast SYBR Green Mastermix ThermoFisher Cat #4385618 Proteome Profiler Mouse Phospho-RTK Array Kit R&D Systems CatARY014 Experimental models: Cell lines OL61 (mouse glioma) Castro-Lowenstein Laboratory, Univ. .. Michigan See STAR Methods KR158 (mouse glioma) Deleyrolle Laboratory, Mayo Clinic See STAR Methods CPA (mouse glioma) Deleyrolle Laboratory, Mayo Clinic See STAR Methods Experimental models: Organisms/strains C57BL/6 JAX RRID:IMSR_JAX:000664 NOD.Cg-Prkdc scid Il2rg tm1Wjl /SzJ Biological Resources Unit, Lerner Research Institute; Cleveland Clinic – B6.129P2-Lcn2 tm1Aade /AkiJ KAX RRID:IMSR_JAX:024630 Oligonucleotides LCN2 Forward: AGCCGTGGTAGATGGCTAGG This paper See Table S1 LCN2 Reverse: TTCCGCGGGTGACAGGGCTTC This paper See Table S1 GAPDH Forward: AGGCTGGTGACGAGGATTTG This paper See Table S1 GAPDH Reverse: TGTAGACCAGTATGTTGAGGTCA This paper See Table S1 LCN2 Forward: AGCCGTGGTAGATGGCTAGG This paper See Table S1 AXL Forward: ATGGCCGACATTGCCAGTG This paper See Table S1 AXL Reverse: CGGTAGTAATCCCCGTTGTAGA This paper See Table S1 OPCML Forward: CCACCCTCAGGTGTACCATAG This paper See Table S1 OPCML Reverse: GTAGGCGTGTTGACCAAAATGA This paper See Table S1 Gas6 Forward: TGCTGGCTTCCGAGTCTTC This paper See Table S1 Gas6 Reverse: CGGGGTCGTTCTCGAACAC This paper See Table S1 TENC1 Forward: TGAACCACTCAAAGCAACGCA This paper See Table S1 TENC1 Reverse: CGTTACATAGGTGAGGTCCAAGT This paper See Table S1 Recombinant DNA psPAX2 Addgene (Didier Trono) RRID:Addgene_12260; Cat# 12260 pMD2.G Addgene (Didier Trono) RRID:Addgene_12259; Cat# 12259 MISSION pLKO.1-puro Non-Mammalian shRNA Control Sigma TRC #SHC002 Lcn2 shRNA KD1 Sigma TRC #TRCN0000055328 Lcn2 shRNA KD2 Sigma TRC #TRCN0000055331 Lcn2 shRNA KD3 Sigma TRC #TRCN0000055332 Software and algorithms PRISM GraphPad https://www.graphpad.com/ FlowJo v10 BD Biosciences https://www.flowjo.com/ (Continued on next page) Cell Reports 45, 116965, March 24, 2026 17

    SYBR Green Assay:

    Article Title: Lipocalin 2 orchestrates resistance to ferroptosis via AXL.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Rabbit anti-GPX4 Cell Signaling Technology Cat #52455S; RRID:AB_2924984 Rabbit anti-pAXL (Y702) ThermoFisher Cat #PA5-64862; RRID:AB_2662770 Rabbit anti-AXL (C terminus) LS Bio Cat # LS-B12012-100 hFAB TM Rhodamine Anti-Actin Bio-Rad Cat #120041163 Goat anti-rabbit StarBright Blue 700 Bio-Rad Cat #12004161; RRID:AB_2721073 Rabbit anti-BCL-XL Cell Signaling Technology Cat #2764T; RRID:AB_2228008 Rabbit anti-BIM Cell Signaling Technology Cat #2819S; RRID:AB_10692515 Rabbit anti-BAK Cell Signaling Technology Cat #3814S; RRID:AB_2290287 Rabbit anti-lipocalin-2 antibody Abcam Cat #ab63929; RRID:AB_1140965 Chicken anti-GFP Aves Labs Cat #GFP-1020; RRID:AB_10000240 Mouse anti-Beta III Tubulin Promega Cat #G7121; RRID:AB_430874 Rabbit anti-Phosphorylated Histone H3 Cell Signaling Technology Cat #4499; RRID:AB_10544537 Rabbit anti-Cleaved Caspase 3 Cell Signaling Technology Cat #9661; RRID:AB_2341188 Bacterial and virus strains psPAX2 (lentiviral packaging plasmid) Addgene (Didier Trono) Cat #12260; RRID:Addgene_12260 pMD2.G (lentiviral packaging plasmid) Addgene (Didier Trono) Cat #12259; RRID:Addgene_12259 MISSION pLKO.1-puro Non-Mammalian shRNA Control Sigma TRC #SHC002 Lcn2 shRNA KD1 Sigma TRC #TRCN0000055328 Lcn2 shRNA KD2 Sigma TRC #TRCN0000055331 Lcn2 shRNA KD3 Sigma TRC #TRCN0000055332 Biological samples Human glioblastoma patient tissue This paper, Cleveland Clinic See STAR Methods Human non-tumor patient tissue This paper, Cleveland Clinic See STAR Methods Primary mouse astrocytes Silver et al. 80 See STAR Methods Chemicals, peptides, and recombinant proteins RPMI 1640 medium Cleveland Clinic Media Preparation Core N/A Fetal bovine serum Cleveland Clinic Media Preparation Core N/A Penicillin-Streptomycin Cleveland Clinic Media Preparation Core N/A Trypsin-EDTA Cleveland Clinic Media Preparation Core N/A Trypan Blue ThermoFisher Cat #15250061 Image-It Lipid Peroxidation Kit Invitrogen Cat #C10445 CellRox Deep Red ThermoFisher Cat #C10422 Deferoxamine (DFO) Sigma Cat #D9533-1G RSL3 (GPX4 inhibitor) SelleckChem Cat #S8155 Erastin SelleckChem Cat #S7242 Ferrostatin-1 (Fer-1) SelleckChem Cat #S7243 Liproxstatin-1 (Lip-1) SelleckChem Cat #S7699 Necrostatin-1 SelleckChem Cat #ab141053 Z-VAD-FMK InvivoGen Cat #tlrl-vad PAC-1 SelleckChem Cat #S2738 Bemcentinib (R428, BGB324) SelleckChem Cat #S2841 1x NP-40 lysis buffer ThermoFisher Cat #J60766.AP Protease inhibitor cocktail Sigma-Aldrich Cat #P8340 (Continued on next page) 16 Cell Reports 45, 116965, March 24, 2026 .. REAGENT or RESOURCE SOURCE IDENTIFIER Phosphatase inhibitor cocktail Sigma-Aldrich Cat #P5725 PMSF Sigma-Aldrich Cat #10837091001 Sodium acetate ThermoFisher Cat #A13184-30 Thioglycolic acid Fisher Scientific Cat #M0052252G Chromogenic solution (FerroZine) MedChemExpress Cat #HY-137805 FITC-annexin V BioLegend Cat #640914 DRAQ7 ThermoFisher Cat #D15105 Critical commercial assays CellTiter Glo Cell Viability Assay Promega Cat #G7573 RNeasy Mini Kit Qiagen Cat #74106 qScript cDNA SuperMix Quanta Biosciences Cat #95048-100 Fast SYBR Green Mastermix ThermoFisher Cat #4385618 Proteome Profiler Mouse Phospho-RTK Array Kit R&D Systems CatARY014 Experimental models: Cell lines OL61 (mouse glioma) Castro-Lowenstein Laboratory, Univ. .. Michigan See STAR Methods KR158 (mouse glioma) Deleyrolle Laboratory, Mayo Clinic See STAR Methods CPA (mouse glioma) Deleyrolle Laboratory, Mayo Clinic See STAR Methods Experimental models: Organisms/strains C57BL/6 JAX RRID:IMSR_JAX:000664 NOD.Cg-Prkdc scid Il2rg tm1Wjl /SzJ Biological Resources Unit, Lerner Research Institute; Cleveland Clinic – B6.129P2-Lcn2 tm1Aade /AkiJ KAX RRID:IMSR_JAX:024630 Oligonucleotides LCN2 Forward: AGCCGTGGTAGATGGCTAGG This paper See Table S1 LCN2 Reverse: TTCCGCGGGTGACAGGGCTTC This paper See Table S1 GAPDH Forward: AGGCTGGTGACGAGGATTTG This paper See Table S1 GAPDH Reverse: TGTAGACCAGTATGTTGAGGTCA This paper See Table S1 LCN2 Forward: AGCCGTGGTAGATGGCTAGG This paper See Table S1 AXL Forward: ATGGCCGACATTGCCAGTG This paper See Table S1 AXL Reverse: CGGTAGTAATCCCCGTTGTAGA This paper See Table S1 OPCML Forward: CCACCCTCAGGTGTACCATAG This paper See Table S1 OPCML Reverse: GTAGGCGTGTTGACCAAAATGA This paper See Table S1 Gas6 Forward: TGCTGGCTTCCGAGTCTTC This paper See Table S1 Gas6 Reverse: CGGGGTCGTTCTCGAACAC This paper See Table S1 TENC1 Forward: TGAACCACTCAAAGCAACGCA This paper See Table S1 TENC1 Reverse: CGTTACATAGGTGAGGTCCAAGT This paper See Table S1 Recombinant DNA psPAX2 Addgene (Didier Trono) RRID:Addgene_12260; Cat# 12260 pMD2.G Addgene (Didier Trono) RRID:Addgene_12259; Cat# 12259 MISSION pLKO.1-puro Non-Mammalian shRNA Control Sigma TRC #SHC002 Lcn2 shRNA KD1 Sigma TRC #TRCN0000055328 Lcn2 shRNA KD2 Sigma TRC #TRCN0000055331 Lcn2 shRNA KD3 Sigma TRC #TRCN0000055332 Software and algorithms PRISM GraphPad https://www.graphpad.com/ FlowJo v10 BD Biosciences https://www.flowjo.com/ (Continued on next page) Cell Reports 45, 116965, March 24, 2026 17

    Phospho-proteomics:

    Article Title: Therapeutic targeting of
    Article Snippet: IRDye 800-labeled goat anti-rabbit IgG (LI-COR, 926-32211) and IRDye 680-labeled goat anti-mouse IgG (LI-COR, 926-68070) secondary antibodies, and membranes were detected with an Odyssey detection system (LI-COR Biosciences). .. Phospho-RTK Array The Mouse Phospho-RTK Array Kit (R&D Systems, ARY014) was used to determine the relative levels of tyrosine phosphorylation of 39 distinct receptor tyrosine kinase (RTK) in organoids, cell lines and tumor nodules, according to the manufacturer's protocol. .. Chemiluminescent signals were captured with a Chemidoc MP Imaging System (Bio-Rad Laboratories) and images were analyzed using Image Studio Lite (LI-COR Biosciences).

    Article Title: Tumorigenesis Driven by BRAF V600E Requires Secondary Mutations That Overcome Its Feedback Inhibition of RAC1 and Migration
    Article Snippet: GTP-bound RAC1 was detected using the PAK1-p21–binding domain pull-down and detection kit (Thermo Scientific, #16118) as instructed by the manufacturer. .. Receptor tyrosine kinase (RTK) phosphorylation was measured using the Proteome Profiler Mouse Phospho-RTK Array Kit (R&D Systems, #ARY014) as instructed by the manufacturer. .. Gelatin degradation was measured using the QCM Gelatin Invadopodia Assay (Green; EMD Millipore, #ECM 670) following the manufacturer’s instructions.

    Activation Assay:

    Article Title: Polychlorinated Biphenyls Alter Estrogen Receptor β-mediated Epigenetic Regulation, Promoting Endometriosis
    Article Snippet: .. To assess differential receptor tyrosine kinase (RTK) activation between normal and endometriotic tissues, as well as between ectopic lesions exposed to PCB126 or vehicle, the Mouse Phospho-RTK Array Kit (R&D Systems, catalog number: ARY014) was used according to the manufacturer's instructions. ..



    Similar Products

    96
    R&D Systems proteome profiler human phospho rtk array kit
    Proteome Profiler Human Phospho Rtk Array Kit, supplied by R&D Systems, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/phospho+rtk+array/Proteome+Profiler+Human+Phospho-RTK+Array+Kit/pm41991671-211-6-16
    Average 96 stars, based on 1 article reviews
    proteome profiler human phospho rtk array kit - by Bioz Stars, 2026-09
    96/100 stars
      Buy from Supplier

    86
    Cell Signaling Technology Inc phospho rtk array kit
    A) Si-Control and Si-HIWI2 661W cell lysates were added <t>to</t> <t>Phospho-RTK</t> arrays. Spots are in duplicate and each pair corresponds to a specific Phospho-RTK. i) The top panel corresponds to control, and ii) while the bottom one corresponds to Si-HIWI2 cells. Phospho-Ephs corresponds to the doublet at E and F rows (marked with red box) showing decreased expression after knockdown of HIWI2. B) and C) Western blot analysis and D) and E) quantification of total and phospho form of EphA2 and EphB2 respectively upon knockdown of HIWI2 in 661W cells. The results were quantified and generated by Graph pad prism software. The students’ t-test was used for statistical analysis. Values are means ± SEM, n = 3. *p < 0.05 and **p < 0.01, ***p < 0.001 were considered statistically significant. Original blots for , and , are given in supplementary Fig.S2B, and C.
    Phospho Rtk Array Kit, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/phospho+rtk+array/bio_rxiv__64898__2026__03__09__710476-49-11-15
    Average 86 stars, based on 1 article reviews
    phospho rtk array kit - by Bioz Stars, 2026-09
    86/100 stars
      Buy from Supplier

    86
    Cell Signaling Technology Inc phospho rtk array
    A) Si-Control and Si-HIWI2 661W cell lysates were added <t>to</t> <t>Phospho-RTK</t> arrays. Spots are in duplicate and each pair corresponds to a specific Phospho-RTK. i) The top panel corresponds to control, and ii) while the bottom one corresponds to Si-HIWI2 cells. Phospho-Ephs corresponds to the doublet at E and F rows (marked with red box) showing decreased expression after knockdown of HIWI2. B) and C) Western blot analysis and D) and E) quantification of total and phospho form of EphA2 and EphB2 respectively upon knockdown of HIWI2 in 661W cells. The results were quantified and generated by Graph pad prism software. The students’ t-test was used for statistical analysis. Values are means ± SEM, n = 3. *p < 0.05 and **p < 0.01, ***p < 0.001 were considered statistically significant. Original blots for , and , are given in supplementary Fig.S2B, and C.
    Phospho Rtk Array, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/phospho+rtk+array/bio_rxiv__64898__2026__03__09__710476-60-1-4
    Average 86 stars, based on 1 article reviews
    phospho rtk array - by Bioz Stars, 2026-09
    86/100 stars
      Buy from Supplier

    94
    R&D Systems proteome profiler mouse phospho rtk array kit r d systems cat
    A) Si-Control and Si-HIWI2 661W cell lysates were added <t>to</t> <t>Phospho-RTK</t> arrays. Spots are in duplicate and each pair corresponds to a specific Phospho-RTK. i) The top panel corresponds to control, and ii) while the bottom one corresponds to Si-HIWI2 cells. Phospho-Ephs corresponds to the doublet at E and F rows (marked with red box) showing decreased expression after knockdown of HIWI2. B) and C) Western blot analysis and D) and E) quantification of total and phospho form of EphA2 and EphB2 respectively upon knockdown of HIWI2 in 661W cells. The results were quantified and generated by Graph pad prism software. The students’ t-test was used for statistical analysis. Values are means ± SEM, n = 3. *p < 0.05 and **p < 0.01, ***p < 0.001 were considered statistically significant. Original blots for , and , are given in supplementary Fig.S2B, and C.
    Proteome Profiler Mouse Phospho Rtk Array Kit R D Systems Cat, supplied by R&D Systems, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/phospho+rtk+array/Proteome+Profiler+Mouse+Phospho-RTK+Array+Kit/pm41762656-249-72-78
    Average 94 stars, based on 1 article reviews
    proteome profiler mouse phospho rtk array kit r d systems cat - by Bioz Stars, 2026-09
    94/100 stars
      Buy from Supplier

    96
    R&D Systems proteome profilertm human phospho rtk array kit
    STAT3 is required for survival of melanoma cells treated with active RAS(ON) inhibitors. (A) Signaling responses to RAS(ON) inhibition in isogenic MeWo cells expressing WT, Q61R, Q61K, or Q61L NRAS. Bubble plot summarizing Western blot–derived signaling changes after 8-hour treatment with the indicated inhibitors. Band intensities were quantified by densitometry, normalized to vehicle controls (set to 100%), and represented as bubble size. Cells were treated with dose ranges appropriate for each inhibitor class: sotorasib and adagrasib (0.1, 1, 10 μM); ADT-007, BI-2865, RMC-6236, and RMC-7977 (0.01, 0.1, 1, 10 μM). (B) Western blot analysis of phospho-STAT3 (Tyr705) in MeWo isogenic cells treated with 1 μM RMC-6236 or RMC-7977 for 0, 12, or 24 hours. (C) Apoptosis followed by STAT3 knockdown combined with RAS(ON) inhibition. (i) Representative Annexin V–FITC/PI density plot of MeWo NRAS WT , NRAS Q61R , NRAS Q61K , and NRAS Q61L cells treated for 48 hours with 1 μM RMC-6236, 1 μM RMC-7977, or DMSO. Red gate denotes apoptotic cells (Annexin VL). (ii) Quantification of total apoptotic cells. Data are presented as mean ± SD (n = 3). Statistical significance was assessed using Two-way ANOVA with Sidak’s multiple-comparisons test (*p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001). (D) Western blot of MYC, p-STAT3, and cleaved PARP following siSTAT3 combined with 24-hour treatment with 1 μM RMC-6236 or RMC-7977. From (A) to (D), data were confirmed with independent experiments. (E) Receptor Tyrosine Kinase activation following RAS(ON) inhibitor treatment. (i) <t>Representative</t> <t>phospho-RTK</t> array from NRAS Q61R MeWo cells treated with 1 μM RMC-6236 or vehicle for 18 hours. (ii) Quantification of significantly upregulated RTKs. Data are mean ± SD. Statistical significance was determined by Two-way ANOVA with Sidak’s multiple-comparisons test (*p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001).
    Proteome Profilertm Human Phospho Rtk Array Kit, supplied by R&D Systems, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/phospho+rtk+array/Proteome+Profiler+Human+Phospho-RTK+Array+Kit/bio_rxiv__64898__2026__02__18__706707-193-6-12
    Average 96 stars, based on 1 article reviews
    proteome profilertm human phospho rtk array kit - by Bioz Stars, 2026-09
    96/100 stars
      Buy from Supplier

    94
    R&D Systems proteome profiler mouse phospho rtk array kit
    NaJa cells differ in their response to drug treatment. A, Colony formation assay of NaJa cells treated with vemurafenib (V), encorafenib (E), and trametinib (T) at the indicated concentrations for 10 days. Shown is a representative result from three biological replicates. B–D, Quantification of the data shown in A . Data are presented as the mean ± SD and were normalized to the DMSO control ( n = 3). Statistical significance was calculated using one-way ANOVA and Dunnett multiple comparisons test. *, P < 0.05; **, P < 0.01; ****, P < 0.0001. <t>E,</t> <t>Phospho-RTK</t> array of NaJa cells treated with 1 μmol/L vemurafenib (Vem), 0.5 μmol/L encorafenib (Enco), or 50 nmol/L trametinib (Tram) for 5 days. Shown are the log 2 FCs of treated cells versus DMSO control. Array membranes and cell line specific heatmaps are displayed in Supplementary Fig. S7. F, Western blot showing the effect of a 5-day treatment of the NaJa cells on various signaling pathways. G, Western blot and quantification of HER2 and HER3 ( n = 4). Basal EGFR expression was quantified based on data in ( F ), and five additional biological replicates normalized to the internal loading control. Data are presented as the mean ± SD and were normalized to NaJa-F for comparison. Statistical significance was calculated using one-way ANOVA and Tukey multiple comparisons test. *, P < 0.05; **, P < 0.01; ****, P < 0.0001. H, Bulk RNA-seq of NaJa cells treated with 0.5 μmol/L encorafenib for 1 day or 5 days showing upregulation (red) or downregulation (blue) of ERK target genes and the adjusted P value (bubble size).
    Proteome Profiler Mouse Phospho Rtk Array Kit, supplied by R&D Systems, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/phospho+rtk+array/Proteome+Profiler+Mouse+Phospho-RTK+Array+Kit/pmc13037773-150-14-21
    Average 94 stars, based on 1 article reviews
    proteome profiler mouse phospho rtk array kit - by Bioz Stars, 2026-09
    94/100 stars
      Buy from Supplier

    96
    R&D Systems tyrosine kinase activity
    NaJa cells differ in their response to drug treatment. A, Colony formation assay of NaJa cells treated with vemurafenib (V), encorafenib (E), and trametinib (T) at the indicated concentrations for 10 days. Shown is a representative result from three biological replicates. B–D, Quantification of the data shown in A . Data are presented as the mean ± SD and were normalized to the DMSO control ( n = 3). Statistical significance was calculated using one-way ANOVA and Dunnett multiple comparisons test. *, P < 0.05; **, P < 0.01; ****, P < 0.0001. <t>E,</t> <t>Phospho-RTK</t> array of NaJa cells treated with 1 μmol/L vemurafenib (Vem), 0.5 μmol/L encorafenib (Enco), or 50 nmol/L trametinib (Tram) for 5 days. Shown are the log 2 FCs of treated cells versus DMSO control. Array membranes and cell line specific heatmaps are displayed in Supplementary Fig. S7. F, Western blot showing the effect of a 5-day treatment of the NaJa cells on various signaling pathways. G, Western blot and quantification of HER2 and HER3 ( n = 4). Basal EGFR expression was quantified based on data in ( F ), and five additional biological replicates normalized to the internal loading control. Data are presented as the mean ± SD and were normalized to NaJa-F for comparison. Statistical significance was calculated using one-way ANOVA and Tukey multiple comparisons test. *, P < 0.05; **, P < 0.01; ****, P < 0.0001. H, Bulk RNA-seq of NaJa cells treated with 0.5 μmol/L encorafenib for 1 day or 5 days showing upregulation (red) or downregulation (blue) of ERK target genes and the adjusted P value (bubble size).
    Tyrosine Kinase Activity, supplied by R&D Systems, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/phospho+rtk+array/Proteome+Profiler+Human+Phospho-RTK+Array+Kit/us12508293-281-19-22
    Average 96 stars, based on 1 article reviews
    tyrosine kinase activity - by Bioz Stars, 2026-09
    96/100 stars
      Buy from Supplier

    96
    R&D Systems proteome profiler human p rtk array kit
    NaJa cells differ in their response to drug treatment. A, Colony formation assay of NaJa cells treated with vemurafenib (V), encorafenib (E), and trametinib (T) at the indicated concentrations for 10 days. Shown is a representative result from three biological replicates. B–D, Quantification of the data shown in A . Data are presented as the mean ± SD and were normalized to the DMSO control ( n = 3). Statistical significance was calculated using one-way ANOVA and Dunnett multiple comparisons test. *, P < 0.05; **, P < 0.01; ****, P < 0.0001. <t>E,</t> <t>Phospho-RTK</t> array of NaJa cells treated with 1 μmol/L vemurafenib (Vem), 0.5 μmol/L encorafenib (Enco), or 50 nmol/L trametinib (Tram) for 5 days. Shown are the log 2 FCs of treated cells versus DMSO control. Array membranes and cell line specific heatmaps are displayed in Supplementary Fig. S7. F, Western blot showing the effect of a 5-day treatment of the NaJa cells on various signaling pathways. G, Western blot and quantification of HER2 and HER3 ( n = 4). Basal EGFR expression was quantified based on data in ( F ), and five additional biological replicates normalized to the internal loading control. Data are presented as the mean ± SD and were normalized to NaJa-F for comparison. Statistical significance was calculated using one-way ANOVA and Tukey multiple comparisons test. *, P < 0.05; **, P < 0.01; ****, P < 0.0001. H, Bulk RNA-seq of NaJa cells treated with 0.5 μmol/L encorafenib for 1 day or 5 days showing upregulation (red) or downregulation (blue) of ERK target genes and the adjusted P value (bubble size).
    Proteome Profiler Human P Rtk Array Kit, supplied by R&D Systems, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/phospho+rtk+array/Proteome+Profiler+Human+Phospho-RTK+Array+Kit/pm41232487-300-24-31
    Average 96 stars, based on 1 article reviews
    proteome profiler human p rtk array kit - by Bioz Stars, 2026-09
    96/100 stars
      Buy from Supplier

    Image Search Results


    A) Si-Control and Si-HIWI2 661W cell lysates were added to Phospho-RTK arrays. Spots are in duplicate and each pair corresponds to a specific Phospho-RTK. i) The top panel corresponds to control, and ii) while the bottom one corresponds to Si-HIWI2 cells. Phospho-Ephs corresponds to the doublet at E and F rows (marked with red box) showing decreased expression after knockdown of HIWI2. B) and C) Western blot analysis and D) and E) quantification of total and phospho form of EphA2 and EphB2 respectively upon knockdown of HIWI2 in 661W cells. The results were quantified and generated by Graph pad prism software. The students’ t-test was used for statistical analysis. Values are means ± SEM, n = 3. *p < 0.05 and **p < 0.01, ***p < 0.001 were considered statistically significant. Original blots for , and , are given in supplementary Fig.S2B, and C.

    Journal: bioRxiv

    Article Title: HIWI2 Influences Endosomal Trafficking and Eph Receptor Signaling in Photoreceptor Cells

    doi: 10.64898/2026.03.09.710476

    Figure Lengend Snippet: A) Si-Control and Si-HIWI2 661W cell lysates were added to Phospho-RTK arrays. Spots are in duplicate and each pair corresponds to a specific Phospho-RTK. i) The top panel corresponds to control, and ii) while the bottom one corresponds to Si-HIWI2 cells. Phospho-Ephs corresponds to the doublet at E and F rows (marked with red box) showing decreased expression after knockdown of HIWI2. B) and C) Western blot analysis and D) and E) quantification of total and phospho form of EphA2 and EphB2 respectively upon knockdown of HIWI2 in 661W cells. The results were quantified and generated by Graph pad prism software. The students’ t-test was used for statistical analysis. Values are means ± SEM, n = 3. *p < 0.05 and **p < 0.01, ***p < 0.001 were considered statistically significant. Original blots for , and , are given in supplementary Fig.S2B, and C.

    Article Snippet: Proteins that were altered after HIWI2 silencing were screened using the Phospho-RTK array kit (ARY001B, CST).

    Techniques: Control, Expressing, Knockdown, Western Blot, Generated, Software

    STAT3 is required for survival of melanoma cells treated with active RAS(ON) inhibitors. (A) Signaling responses to RAS(ON) inhibition in isogenic MeWo cells expressing WT, Q61R, Q61K, or Q61L NRAS. Bubble plot summarizing Western blot–derived signaling changes after 8-hour treatment with the indicated inhibitors. Band intensities were quantified by densitometry, normalized to vehicle controls (set to 100%), and represented as bubble size. Cells were treated with dose ranges appropriate for each inhibitor class: sotorasib and adagrasib (0.1, 1, 10 μM); ADT-007, BI-2865, RMC-6236, and RMC-7977 (0.01, 0.1, 1, 10 μM). (B) Western blot analysis of phospho-STAT3 (Tyr705) in MeWo isogenic cells treated with 1 μM RMC-6236 or RMC-7977 for 0, 12, or 24 hours. (C) Apoptosis followed by STAT3 knockdown combined with RAS(ON) inhibition. (i) Representative Annexin V–FITC/PI density plot of MeWo NRAS WT , NRAS Q61R , NRAS Q61K , and NRAS Q61L cells treated for 48 hours with 1 μM RMC-6236, 1 μM RMC-7977, or DMSO. Red gate denotes apoptotic cells (Annexin VL). (ii) Quantification of total apoptotic cells. Data are presented as mean ± SD (n = 3). Statistical significance was assessed using Two-way ANOVA with Sidak’s multiple-comparisons test (*p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001). (D) Western blot of MYC, p-STAT3, and cleaved PARP following siSTAT3 combined with 24-hour treatment with 1 μM RMC-6236 or RMC-7977. From (A) to (D), data were confirmed with independent experiments. (E) Receptor Tyrosine Kinase activation following RAS(ON) inhibitor treatment. (i) Representative phospho-RTK array from NRAS Q61R MeWo cells treated with 1 μM RMC-6236 or vehicle for 18 hours. (ii) Quantification of significantly upregulated RTKs. Data are mean ± SD. Statistical significance was determined by Two-way ANOVA with Sidak’s multiple-comparisons test (*p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001).

    Journal: bioRxiv

    Article Title: Mutation-Resolved Drug Sensitivity Atlas Reveals Broad RAS(ON) Inhibitor Vulnerabilities and a STAT3 Co-Dependency in NRAS-Mutant Melanoma

    doi: 10.64898/2026.02.18.706707

    Figure Lengend Snippet: STAT3 is required for survival of melanoma cells treated with active RAS(ON) inhibitors. (A) Signaling responses to RAS(ON) inhibition in isogenic MeWo cells expressing WT, Q61R, Q61K, or Q61L NRAS. Bubble plot summarizing Western blot–derived signaling changes after 8-hour treatment with the indicated inhibitors. Band intensities were quantified by densitometry, normalized to vehicle controls (set to 100%), and represented as bubble size. Cells were treated with dose ranges appropriate for each inhibitor class: sotorasib and adagrasib (0.1, 1, 10 μM); ADT-007, BI-2865, RMC-6236, and RMC-7977 (0.01, 0.1, 1, 10 μM). (B) Western blot analysis of phospho-STAT3 (Tyr705) in MeWo isogenic cells treated with 1 μM RMC-6236 or RMC-7977 for 0, 12, or 24 hours. (C) Apoptosis followed by STAT3 knockdown combined with RAS(ON) inhibition. (i) Representative Annexin V–FITC/PI density plot of MeWo NRAS WT , NRAS Q61R , NRAS Q61K , and NRAS Q61L cells treated for 48 hours with 1 μM RMC-6236, 1 μM RMC-7977, or DMSO. Red gate denotes apoptotic cells (Annexin VL). (ii) Quantification of total apoptotic cells. Data are presented as mean ± SD (n = 3). Statistical significance was assessed using Two-way ANOVA with Sidak’s multiple-comparisons test (*p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001). (D) Western blot of MYC, p-STAT3, and cleaved PARP following siSTAT3 combined with 24-hour treatment with 1 μM RMC-6236 or RMC-7977. From (A) to (D), data were confirmed with independent experiments. (E) Receptor Tyrosine Kinase activation following RAS(ON) inhibitor treatment. (i) Representative phospho-RTK array from NRAS Q61R MeWo cells treated with 1 μM RMC-6236 or vehicle for 18 hours. (ii) Quantification of significantly upregulated RTKs. Data are mean ± SD. Statistical significance was determined by Two-way ANOVA with Sidak’s multiple-comparisons test (*p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001).

    Article Snippet: RTK activation was evaluated using the Proteome ProfilerTM Human Phospho-RTK Array Kit (R&D Systems, Cat. No. ARY001B).

    Techniques: Inhibition, Expressing, Western Blot, Derivative Assay, Knockdown, Activation Assay

    NaJa cells differ in their response to drug treatment. A, Colony formation assay of NaJa cells treated with vemurafenib (V), encorafenib (E), and trametinib (T) at the indicated concentrations for 10 days. Shown is a representative result from three biological replicates. B–D, Quantification of the data shown in A . Data are presented as the mean ± SD and were normalized to the DMSO control ( n = 3). Statistical significance was calculated using one-way ANOVA and Dunnett multiple comparisons test. *, P < 0.05; **, P < 0.01; ****, P < 0.0001. E, Phospho-RTK array of NaJa cells treated with 1 μmol/L vemurafenib (Vem), 0.5 μmol/L encorafenib (Enco), or 50 nmol/L trametinib (Tram) for 5 days. Shown are the log 2 FCs of treated cells versus DMSO control. Array membranes and cell line specific heatmaps are displayed in Supplementary Fig. S7. F, Western blot showing the effect of a 5-day treatment of the NaJa cells on various signaling pathways. G, Western blot and quantification of HER2 and HER3 ( n = 4). Basal EGFR expression was quantified based on data in ( F ), and five additional biological replicates normalized to the internal loading control. Data are presented as the mean ± SD and were normalized to NaJa-F for comparison. Statistical significance was calculated using one-way ANOVA and Tukey multiple comparisons test. *, P < 0.05; **, P < 0.01; ****, P < 0.0001. H, Bulk RNA-seq of NaJa cells treated with 0.5 μmol/L encorafenib for 1 day or 5 days showing upregulation (red) or downregulation (blue) of ERK target genes and the adjusted P value (bubble size).

    Journal: Cancer Research Communications

    Article Title: Novel Syngeneic Cell Lines for Studying High-Risk BRAF V600E -Driven Colorectal Cancer In Vivo

    doi: 10.1158/2767-9764.CRC-25-0599

    Figure Lengend Snippet: NaJa cells differ in their response to drug treatment. A, Colony formation assay of NaJa cells treated with vemurafenib (V), encorafenib (E), and trametinib (T) at the indicated concentrations for 10 days. Shown is a representative result from three biological replicates. B–D, Quantification of the data shown in A . Data are presented as the mean ± SD and were normalized to the DMSO control ( n = 3). Statistical significance was calculated using one-way ANOVA and Dunnett multiple comparisons test. *, P < 0.05; **, P < 0.01; ****, P < 0.0001. E, Phospho-RTK array of NaJa cells treated with 1 μmol/L vemurafenib (Vem), 0.5 μmol/L encorafenib (Enco), or 50 nmol/L trametinib (Tram) for 5 days. Shown are the log 2 FCs of treated cells versus DMSO control. Array membranes and cell line specific heatmaps are displayed in Supplementary Fig. S7. F, Western blot showing the effect of a 5-day treatment of the NaJa cells on various signaling pathways. G, Western blot and quantification of HER2 and HER3 ( n = 4). Basal EGFR expression was quantified based on data in ( F ), and five additional biological replicates normalized to the internal loading control. Data are presented as the mean ± SD and were normalized to NaJa-F for comparison. Statistical significance was calculated using one-way ANOVA and Tukey multiple comparisons test. *, P < 0.05; **, P < 0.01; ****, P < 0.0001. H, Bulk RNA-seq of NaJa cells treated with 0.5 μmol/L encorafenib for 1 day or 5 days showing upregulation (red) or downregulation (blue) of ERK target genes and the adjusted P value (bubble size).

    Article Snippet: From each sample, the recommended amounts (250 μg) of protein were used for the Proteome Profiler Mouse Phospho-RTK Array Kit (ARY0141, R&D systems).

    Techniques: Colony Assay, Control, Western Blot, Protein-Protein interactions, Expressing, Comparison, RNA Sequencing