pgemex-2 e. coli expression vector (Promega)
90
Structured Review
Promega
pgemex-2 e. coli expression vector
Pgemex 2 E. Coli Expression Vector, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pgemex-2+expression+vector/pgem+t+easy/pmc10693968-46-10-15
Average 90 stars, based on 1 article reviews
Pgemex 2 E. Coli Expression Vector, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pgemex-2+expression+vector/pgem+t+easy/pmc10693968-46-10-15
Average 90 stars, based on 1 article reviews
pgemex-2 e. coli expression vector - by Bioz Stars,
2026-09
90/100 stars
Images
Related Articles
other:Article Title: MEG3 Enhances Survival of Developing Human Neurons with CLCN4 -Linked Autophagy Impairment Article Snippet: PCR products were subcloned into Article Title: VapA/Scs2 sustains polarized growth in Aspergillus nidulans by maintaining AP-2-mediated apical endocytosis Article Snippet: Gene cassettes were generated by sequential cloning of the relevant fragments in the Article Title: Tc BDF6 deficiency compromises intracellular amastigote development and infectivity in Trypanosoma cruzi Article Snippet: A pGEM-T plasmid ( Article Title: HLA binding vaccine moieties and uses thereof Article Snippet: The PCR products for the light chain and heavy chain were ligated into individual Article Title: Supporting Information for Invasive mussels fashion silk-like byssus via mechanical processing of massive horizontally acquired coiled coils Article Snippet: These fragments were cloned and sequenced using Article Title: Synergistic DNA and RNA binding of the Hox transcription factor Ultrabithorax coordinates splicing and shapes in vivo homeotic functions. Article Snippet: In vitro transcription with Cy3-UTP labelling For in vitro transcription, we employed selected fragments of alternatively spliced exons that were cloned into the Article Title: Supporting Information for FAN1 removes triplet repeat extrusions via a PCNA and RFC- dependent mechanism Article Snippet: Plasmid name* Sense strand sequence Cloning site(s) pGB1mr77 5ʹTCGACCTAGCAGCTGCTGATCTCGAGTCTAGAAATTCG pGBmr78 5ʹTCGACCTAGCAGATCTCGAGTCTAGAAATTCG pGB1mr77 4xLacO 5ʹGCTAATTGTGAGCGGATAACAATTGTTAGGGAGGAATTGTGAGCGGATAACAATTTGGAG TTGATAATTGTGAGCGGATAACAATTGGCTTCAACGTAATTGTGAGCGGATAACAATTGCTCTTCC SapI pGB1mr78 4xLacO 5ʹGCTAATTGTGAGCGGATAACAATTGTTAGGGAGGAATTGTGAGCGGATAACAATTTGGAG TTGATAATTGTGAGCGGATAACAATTGGCTTCAACGTAATTGTGAGCGGATAACAATTGCTCTTCC SapI Entries 1 and 2 are Purification:Article Title: Allele editing and applications thereof Article Snippet: .. 90 ng of the digested and purified 2 kb PGR amplicons were ligated for 1 h at 22° C. with 50 or 100 ng Plasmid Preparation:Article Title: Allele editing and applications thereof Article Snippet: .. 90 ng of the digested and purified 2 kb PGR amplicons were ligated for 1 h at 22° C. with 50 or 100 ng |