Review



facs permeabilizing solution2 1x  (Becton Dickinson)

 
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 90
      Buy from Supplier

    Structured Review

    Becton Dickinson facs permeabilizing solution2 1x
    Facs Permeabilizing Solution2 1x, supplied by Becton Dickinson, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/permeabilizing-solution2/facs+permeabilizing+solution/pmc09467550-87-14-20
    Average 90 stars, based on 1 article reviews
    facs permeabilizing solution2 1x - by Bioz Stars, 2026-09
    90/100 stars

    Images

    Related Articles

    FACS:

    Article Title: Innate lymphoid cells are activated in HFRS, and their function can be modulated by hantavirus-induced type I interferons
    Article Snippet: Briefly, cells were incubated with LIVE/DEAD Fixable Green Dead Cell Stain Kit (ThermoFischer Scientific) and fluorochrome-conjugated antibodies directed against surface markers ( ) for 20 min at room temperature in the dark followed by 2 washes with flow cytometry buffer (PBS with 2 mM EDTA). .. Cells were then fixed and permeabilized using FACS Lysing solution and FACS Permeabilizing solution (BD Biosciences), and next incubated with intracellular staining antibodies ( ) for 30 min at 4°C in the dark. ..

    Article Title: Vaccination with nanoparticles displaying gH/gL from Epstein-Barr virus elicits limited cross-protection against rhesus lymphocryptovirus.
    Article Snippet: Cells were then washed with PBS and stained with Live/Dead Fixable Blue Dead Cell Stain Kit (Invitrogen #L23105) according to the manufacturer’s instructions, washed with FACS buffer and incubated with 1:25 dilution anti-CD16 (BioLegend #302036) and 1:50 anti-CD20 (BD #563126) antibodies per sample. .. Cells were then washed twice, and residual red blood cells were lysed and all cells fixed in 100 ml BD lysis buffer (BD #349202), washed, and incubated with 200 ml BD FACS Permeabilizing Solution 2 (BD #340973). .. Intracellular staining was done with 1:1000 dilution of anti-CD8 (BD #612889) and CD4 (BD #566148), 1:2500 anti- CD3 (BD #564117), 1:200 anti- TNFa (ThermoFisher #11-7349-82) and IFN-g (BD #560371), and 1:50 anti- IL-2 (BioLegend #500310) antibodies.

    Article Title: NKp30 and NKG2D contribute to natural killer recognition of HIV-infected cells
    Article Snippet: .. For the samples that require intracellular staining, cells were subsequently fixed with FACS Lyse (BD Biosciences), permeabilized with FACS Permeabilization Buffer 2 (BD Biosciences), and stained for intracellular markers with V450 anti-IFN-D (BD Biosciences, clone B27) or BV785 anti-IFN-D, BV650 anti-TNF-D (Biolegend, clone MAb11) and FITC HIV p24 (Beckman Coulter, clone KC57) as indicated. .. Cells were fixed with 1% or 2% paraformaldehyde (PFA) in PBS and analyzed by flow cytometry using an Aurora spectral cytometer (Cytek Biosciences), and data analysis was performed using FlowJo version 10.1 and 10.9 (Tree Star).

    Article Title: IL-10 indirectly modulates functional activity of CD4 + CD28 null T-lymphocytes through LFA-3 and HLA class II inhibition.
    Article Snippet: Immunology Department, Hospital Universitario Central de Asturias, Oviedo, Spain Instituto de Investigaci on Sanitaria del Principado de Asturias (ISPA), Oviedo, Spain Instituto Universitario de Oncología del Principado de Asturias (IUOPA), Oviedo, Spain Hematology Department, Hospital Universitario Central de Asturias, Oviedo, Spain Section of Hemodynamics and Interventional Cardiology, Department of Cardiology, Hospital Universitario Central de Asturias, Oviedo, Spain

    Article Title: Vaccination with nanoparticles displaying gH/gL from Epstein-Barr virus elicits limited cross-protection against rhesus lymphocryptovirus.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Recombinant AMMO1 Snijder et al.28 N/A Recombinant CL40 with human constant regions Singh et al.30 N/A Recombinant CL59 with human constant regions Singh et al.30 N/A Recombinant 72A1 with human constant regions Singh et al.30 N/A Recombinant E1D1 with human constant regions Malhi et al.38 N/A Recombinant 770F7 Chen et al.27 N/A Recombinant 1D8 Zhu et al.29 N/A Recombinant 769B10 Bu et al.26 N/A AF488 anti-human CD3 clone SP34-2 BD Biosciences Cat#557705; RRID:AB_396814 AF488 anti-human CD4 clone OKT4 Biolegend Cat#317419; RRID:AB_571938 AF488 anti-human CD8 clone RPA-T8 BD Biosciences Cat#557704; RRID:AB_396813 AF488 anti-human CD14 clone M5E2 BD Biosciences Cat#561706; RRID: AB_10924601 BV421 anti-human CD20 clone 2H7 Biolegend Cat#302329; RRID: AB_10933088 anti-human CD28/ anti-CD49d BD Biosciences Cat#347690; RRID:AB_647457 BV570 anti-human CD16 Biolegend Cat#302036; RRID:AB_2632790 BV711 anti-human CD20 BD Biosciences Cat#563126; RRID:AB_2313579 BUV805 anti-human CD8 BD Biosciences Cat#612889; RRID:AB_2833078 BV480 anti-human CD4 BD Biosciences Cat#566148; RRID:AB_2739546 BUV395 anti-human CD3 BD Biosciences Cat#564117; RRID:AB_2738603 BB515 anti-human TNFa ThermoFisher Cat#11-7349-82; RRID: AB_465424 BV421 anti-human IFN-g BD Biosciences Cat#560371; RRID:AB_1645594 Allophycocyanin (APC)-anti-human IL-2 BioLegend Cat#500310; RRID:AB_315097 Goat anti-human IgG-HRP Southern Biotech Cat#2010-05; RRID:AB_2795564 Goat anti-human IgG Southern Biotech Cat#2040-01; RRID:AB_2795640 Bacterial and virus strains EBV B95.8/F Delecluse et al.53 N/A Rhesus Lymphocryptovirus strain LCL 8664 ATCC Cat#CRL-1805; RRID: CVCL_3464 Biological samples Rhesus macaque blood Washington National Primate Research Center N/A Chemicals, peptides, and recombinant proteins Sigma Adjuvant Systems Sigma Aldrich Cat#S6322 SMNP Silva et al.40 N/A NeutrAvidin Thermofisher Cat#31000 SureBlue Reserve TMB Microwell Peroxidase substrate SeraCare Cat#5120-0081 Totalseq APC-streptavidin BioLegend Cat#405283 Phycoerythrin (PE)- streptavidin BioLegend Cat#405203 eFluor 506 viability dye eBioscience Cat#65-0866-14 Rhesus Fc receptor inhibitor eBioscience Cat#14-9161-73 Overlapping 15 amino acid peptide pools spanning EBV gH and gL This study Synthesized by Mimotopes Brefeldin A Sigma-Aldrich Cat#B-7651 Live/Dead Fixable Blue Dead Cell Stain Kit Invitrogen Cat#L23105 BD lysis buffer BD Biosciences Cat#349202 (Continued on next page) e1 Cell Reports Medicine 5, 101587, June 18, 2024 OPEN ACCESS .. REAGENT or RESOURCE SOURCE IDENTIFIER BD FACS Permeabilizing Solution 2 BD Biosciences Cat340973 Anti-human IgG Fc capture (AHC) biosensors Sartorius Cat#18-5063 Streptavidin biosensors Sartorius Cat#18-5020 Protein A Resin GoldBio Cat#P-400-50 Protein A/G resin Thermofisher Cat#53133 Pierce IgG Elution Buffer ThermoFisher Cat#21009 GeneJuice Transfection Reagent EMD Millipore Cat#70967 12-O-Tetradecanoylphorbol 13-acetate Sigma Aldrich Cat#P8139 sodium butyrate Sigma Aldrich Cat#303410 Cyclosporin A Fisher Scientific Cat#AAJ6319103 eBioscience Fixable Viability Dye eFluor 506 ThermoFisher Cat#65-0866-18 0.25% trypsin ThermoFisher Cat#25200056 10% Formalin Millipore Sigma Cat#HT501128 EZ-Link NHS-PEG4-Biotin Kit ThermoFisher Cat#21330 Zeba Spin Desalting Columns 40K MWCO ThermoFisher Cat#87766 AluI restriction-enzyme New England BioLabs Cat#R0137S Critical commercial assays QiaAmp DNA blood mini kit Qiagen Cat#51104 QuantiTect Multiplex PCR Kit Qiagen Cat#204543 ddPCR Supermix for Probes, no-dUTP Bio-Rad Cat#1863024 Droplet Generator DG8 Cartridge Bio-Rad Cat#1864008 SureBlue Reserve TMB Microwell Peroxidase substrate SeraCare Cat#5120-0081 Steady-Glo luciferase reagent Promega Cat#E2510 Cell Line Nucleofector Kit V Lonza Cat#VVCA-1003 eBioscience Foxp3 / Transcription Factor Staining Buffer Set ThermoFisher Cat#00-5523-00 Experimental models: Cell lines Raji ATCC Cat# CCL-86; RRID: CVCL_0511 293-6E cells National Research Council, Canada RRID: CVCL_HF20 293T cells RRID: CVCL_0063 293-2089 Delecluse et al.53 N/A SVKCR2 Li et al.54 RRID: CVCL_YD67 AKATA-GFP Molesworth et al.48 N/A .. 293-T7 Omerovic et al.45 N/A LCL 8664 cells ATCC RRID: CVCL_3464 BL21(DE3) E. coli NEB Cat#C2527H Oligonucleotides Rhesus LCV IR1 forward primer AAATCTAAACTTTTGAGGCGATCTG Sashihara et al.36 N/A Rhesus LCV IR1 reverse primer CCAACCATAGACCCGTTTCCT Sashihara et al.36 N/A FAM-labeled Rhesus LCV IR1 probe TCTCCGCGTGCGCATAATGGC Sashihara et al.36 N/A Rhesus RPP30 forward primer GACTTGGACGTGCGAGCG Singh et al.30 N/A Rhesus RPP30 reverse primer GCCGCTGTCTCCACAAGT Singh et al.30 N/A Hex-labeled Rhesus RPP30 probe TCTGACCTGAAGGCTCTG CGCG Singh et al.30 N/A Recombinant DNA pGEX4.1 Addgene Cat# 27458001 pGEX-rhLCV-VCA This study N/A psPAX2 Addgene Cat#12260 (Continued on next page) Cell Reports Medicine 5, 101587, June 18, 2024 e2 OPEN ACCESS

    Article Title: Dual roles of CD11b + CD33 + HLA-DR -/low CD14 - myeloid-derived suppressor cells with a granulocytic morphology following allogeneic hematopoietic stem cell transplantation: from inflammation promoters to immune suppressors within 90 days.
    Article Snippet: Afterwards, erythrocytes were lysed using FACS lysing Solution (BD Biosciences). .. For intracellular staining, cells were fixed and permeabilized using BD FACS Permeabilizing Solution 2 (BD biosciences), then finally stained with HO-1 FITC (Clone: HO-1-2) (abcam) and IL-10 PECy7 (JES3-9D7) (Biolegend) antibodies for 30 min. ..

    Article Title: Neutralizing Antibody and T-Cell Spike Targeted Responses Following Receipt of a Monovalent Omicron JN.1-Adapted mRNA COVID-19 Vaccine in Immunosuppressed and Healthy Individuals.
    Article Snippet: We evaluated homologous neutralizing antibody (NtAb) and T‐cell responses after receipt of a JN.1‐adapted mRNA vaccine in a mixed population comprising healthy controls (HC) (n= 15), end‐stage chronic kidney disease (CKD) patients (n= 17), and allogeneic hematopoietic stem cell transplant recipients (allo‐HCT) (n= 13).. Most participants (42/45) were SARS‐CoV‐ 2‐experienced at the time of immunological testing.. JN.1‐spike‐binding NtAbs were measured with a vesicular stomatitis virus pseudotype‐based neutralization assay, whereas interferon (IFN)‐γ‐producing spike‐directed CD4 or CD8 T‐cell frequencies were enumerated using flow cytometry for intracellular staining.

    Incubation:

    Article Title: Innate lymphoid cells are activated in HFRS, and their function can be modulated by hantavirus-induced type I interferons
    Article Snippet: Briefly, cells were incubated with LIVE/DEAD Fixable Green Dead Cell Stain Kit (ThermoFischer Scientific) and fluorochrome-conjugated antibodies directed against surface markers ( ) for 20 min at room temperature in the dark followed by 2 washes with flow cytometry buffer (PBS with 2 mM EDTA). .. Cells were then fixed and permeabilized using FACS Lysing solution and FACS Permeabilizing solution (BD Biosciences), and next incubated with intracellular staining antibodies ( ) for 30 min at 4°C in the dark. ..

    Article Title: Vaccination with nanoparticles displaying gH/gL from Epstein-Barr virus elicits limited cross-protection against rhesus lymphocryptovirus.
    Article Snippet: Cells were then washed with PBS and stained with Live/Dead Fixable Blue Dead Cell Stain Kit (Invitrogen #L23105) according to the manufacturer’s instructions, washed with FACS buffer and incubated with 1:25 dilution anti-CD16 (BioLegend #302036) and 1:50 anti-CD20 (BD #563126) antibodies per sample. .. Cells were then washed twice, and residual red blood cells were lysed and all cells fixed in 100 ml BD lysis buffer (BD #349202), washed, and incubated with 200 ml BD FACS Permeabilizing Solution 2 (BD #340973). .. Intracellular staining was done with 1:1000 dilution of anti-CD8 (BD #612889) and CD4 (BD #566148), 1:2500 anti- CD3 (BD #564117), 1:200 anti- TNFa (ThermoFisher #11-7349-82) and IFN-g (BD #560371), and 1:50 anti- IL-2 (BioLegend #500310) antibodies.

    Staining:

    Article Title: Innate lymphoid cells are activated in HFRS, and their function can be modulated by hantavirus-induced type I interferons
    Article Snippet: Briefly, cells were incubated with LIVE/DEAD Fixable Green Dead Cell Stain Kit (ThermoFischer Scientific) and fluorochrome-conjugated antibodies directed against surface markers ( ) for 20 min at room temperature in the dark followed by 2 washes with flow cytometry buffer (PBS with 2 mM EDTA). .. Cells were then fixed and permeabilized using FACS Lysing solution and FACS Permeabilizing solution (BD Biosciences), and next incubated with intracellular staining antibodies ( ) for 30 min at 4°C in the dark. ..

    Article Title: NKp30 and NKG2D contribute to natural killer recognition of HIV-infected cells
    Article Snippet: .. For the samples that require intracellular staining, cells were subsequently fixed with FACS Lyse (BD Biosciences), permeabilized with FACS Permeabilization Buffer 2 (BD Biosciences), and stained for intracellular markers with V450 anti-IFN-D (BD Biosciences, clone B27) or BV785 anti-IFN-D, BV650 anti-TNF-D (Biolegend, clone MAb11) and FITC HIV p24 (Beckman Coulter, clone KC57) as indicated. .. Cells were fixed with 1% or 2% paraformaldehyde (PFA) in PBS and analyzed by flow cytometry using an Aurora spectral cytometer (Cytek Biosciences), and data analysis was performed using FlowJo version 10.1 and 10.9 (Tree Star).

    Article Title: IL-10 indirectly modulates functional activity of CD4 + CD28 null T-lymphocytes through LFA-3 and HLA class II inhibition.
    Article Snippet: Immunology Department, Hospital Universitario Central de Asturias, Oviedo, Spain Instituto de Investigaci on Sanitaria del Principado de Asturias (ISPA), Oviedo, Spain Instituto Universitario de Oncología del Principado de Asturias (IUOPA), Oviedo, Spain Hematology Department, Hospital Universitario Central de Asturias, Oviedo, Spain Section of Hemodynamics and Interventional Cardiology, Department of Cardiology, Hospital Universitario Central de Asturias, Oviedo, Spain

    Article Title: Vaccination with nanoparticles displaying gH/gL from Epstein-Barr virus elicits limited cross-protection against rhesus lymphocryptovirus.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Recombinant AMMO1 Snijder et al.28 N/A Recombinant CL40 with human constant regions Singh et al.30 N/A Recombinant CL59 with human constant regions Singh et al.30 N/A Recombinant 72A1 with human constant regions Singh et al.30 N/A Recombinant E1D1 with human constant regions Malhi et al.38 N/A Recombinant 770F7 Chen et al.27 N/A Recombinant 1D8 Zhu et al.29 N/A Recombinant 769B10 Bu et al.26 N/A AF488 anti-human CD3 clone SP34-2 BD Biosciences Cat#557705; RRID:AB_396814 AF488 anti-human CD4 clone OKT4 Biolegend Cat#317419; RRID:AB_571938 AF488 anti-human CD8 clone RPA-T8 BD Biosciences Cat#557704; RRID:AB_396813 AF488 anti-human CD14 clone M5E2 BD Biosciences Cat#561706; RRID: AB_10924601 BV421 anti-human CD20 clone 2H7 Biolegend Cat#302329; RRID: AB_10933088 anti-human CD28/ anti-CD49d BD Biosciences Cat#347690; RRID:AB_647457 BV570 anti-human CD16 Biolegend Cat#302036; RRID:AB_2632790 BV711 anti-human CD20 BD Biosciences Cat#563126; RRID:AB_2313579 BUV805 anti-human CD8 BD Biosciences Cat#612889; RRID:AB_2833078 BV480 anti-human CD4 BD Biosciences Cat#566148; RRID:AB_2739546 BUV395 anti-human CD3 BD Biosciences Cat#564117; RRID:AB_2738603 BB515 anti-human TNFa ThermoFisher Cat#11-7349-82; RRID: AB_465424 BV421 anti-human IFN-g BD Biosciences Cat#560371; RRID:AB_1645594 Allophycocyanin (APC)-anti-human IL-2 BioLegend Cat#500310; RRID:AB_315097 Goat anti-human IgG-HRP Southern Biotech Cat#2010-05; RRID:AB_2795564 Goat anti-human IgG Southern Biotech Cat#2040-01; RRID:AB_2795640 Bacterial and virus strains EBV B95.8/F Delecluse et al.53 N/A Rhesus Lymphocryptovirus strain LCL 8664 ATCC Cat#CRL-1805; RRID: CVCL_3464 Biological samples Rhesus macaque blood Washington National Primate Research Center N/A Chemicals, peptides, and recombinant proteins Sigma Adjuvant Systems Sigma Aldrich Cat#S6322 SMNP Silva et al.40 N/A NeutrAvidin Thermofisher Cat#31000 SureBlue Reserve TMB Microwell Peroxidase substrate SeraCare Cat#5120-0081 Totalseq APC-streptavidin BioLegend Cat#405283 Phycoerythrin (PE)- streptavidin BioLegend Cat#405203 eFluor 506 viability dye eBioscience Cat#65-0866-14 Rhesus Fc receptor inhibitor eBioscience Cat#14-9161-73 Overlapping 15 amino acid peptide pools spanning EBV gH and gL This study Synthesized by Mimotopes Brefeldin A Sigma-Aldrich Cat#B-7651 Live/Dead Fixable Blue Dead Cell Stain Kit Invitrogen Cat#L23105 BD lysis buffer BD Biosciences Cat#349202 (Continued on next page) e1 Cell Reports Medicine 5, 101587, June 18, 2024 OPEN ACCESS .. REAGENT or RESOURCE SOURCE IDENTIFIER BD FACS Permeabilizing Solution 2 BD Biosciences Cat340973 Anti-human IgG Fc capture (AHC) biosensors Sartorius Cat#18-5063 Streptavidin biosensors Sartorius Cat#18-5020 Protein A Resin GoldBio Cat#P-400-50 Protein A/G resin Thermofisher Cat#53133 Pierce IgG Elution Buffer ThermoFisher Cat#21009 GeneJuice Transfection Reagent EMD Millipore Cat#70967 12-O-Tetradecanoylphorbol 13-acetate Sigma Aldrich Cat#P8139 sodium butyrate Sigma Aldrich Cat#303410 Cyclosporin A Fisher Scientific Cat#AAJ6319103 eBioscience Fixable Viability Dye eFluor 506 ThermoFisher Cat#65-0866-18 0.25% trypsin ThermoFisher Cat#25200056 10% Formalin Millipore Sigma Cat#HT501128 EZ-Link NHS-PEG4-Biotin Kit ThermoFisher Cat#21330 Zeba Spin Desalting Columns 40K MWCO ThermoFisher Cat#87766 AluI restriction-enzyme New England BioLabs Cat#R0137S Critical commercial assays QiaAmp DNA blood mini kit Qiagen Cat#51104 QuantiTect Multiplex PCR Kit Qiagen Cat#204543 ddPCR Supermix for Probes, no-dUTP Bio-Rad Cat#1863024 Droplet Generator DG8 Cartridge Bio-Rad Cat#1864008 SureBlue Reserve TMB Microwell Peroxidase substrate SeraCare Cat#5120-0081 Steady-Glo luciferase reagent Promega Cat#E2510 Cell Line Nucleofector Kit V Lonza Cat#VVCA-1003 eBioscience Foxp3 / Transcription Factor Staining Buffer Set ThermoFisher Cat#00-5523-00 Experimental models: Cell lines Raji ATCC Cat# CCL-86; RRID: CVCL_0511 293-6E cells National Research Council, Canada RRID: CVCL_HF20 293T cells RRID: CVCL_0063 293-2089 Delecluse et al.53 N/A SVKCR2 Li et al.54 RRID: CVCL_YD67 AKATA-GFP Molesworth et al.48 N/A .. 293-T7 Omerovic et al.45 N/A LCL 8664 cells ATCC RRID: CVCL_3464 BL21(DE3) E. coli NEB Cat#C2527H Oligonucleotides Rhesus LCV IR1 forward primer AAATCTAAACTTTTGAGGCGATCTG Sashihara et al.36 N/A Rhesus LCV IR1 reverse primer CCAACCATAGACCCGTTTCCT Sashihara et al.36 N/A FAM-labeled Rhesus LCV IR1 probe TCTCCGCGTGCGCATAATGGC Sashihara et al.36 N/A Rhesus RPP30 forward primer GACTTGGACGTGCGAGCG Singh et al.30 N/A Rhesus RPP30 reverse primer GCCGCTGTCTCCACAAGT Singh et al.30 N/A Hex-labeled Rhesus RPP30 probe TCTGACCTGAAGGCTCTG CGCG Singh et al.30 N/A Recombinant DNA pGEX4.1 Addgene Cat# 27458001 pGEX-rhLCV-VCA This study N/A psPAX2 Addgene Cat#12260 (Continued on next page) Cell Reports Medicine 5, 101587, June 18, 2024 e2 OPEN ACCESS

    Article Title: Dual roles of CD11b + CD33 + HLA-DR -/low CD14 - myeloid-derived suppressor cells with a granulocytic morphology following allogeneic hematopoietic stem cell transplantation: from inflammation promoters to immune suppressors within 90 days.
    Article Snippet: Afterwards, erythrocytes were lysed using FACS lysing Solution (BD Biosciences). .. For intracellular staining, cells were fixed and permeabilized using BD FACS Permeabilizing Solution 2 (BD biosciences), then finally stained with HO-1 FITC (Clone: HO-1-2) (abcam) and IL-10 PECy7 (JES3-9D7) (Biolegend) antibodies for 30 min. ..

    Article Title: Neutralizing Antibody and T-Cell Spike Targeted Responses Following Receipt of a Monovalent Omicron JN.1-Adapted mRNA COVID-19 Vaccine in Immunosuppressed and Healthy Individuals.
    Article Snippet: We evaluated homologous neutralizing antibody (NtAb) and T‐cell responses after receipt of a JN.1‐adapted mRNA vaccine in a mixed population comprising healthy controls (HC) (n= 15), end‐stage chronic kidney disease (CKD) patients (n= 17), and allogeneic hematopoietic stem cell transplant recipients (allo‐HCT) (n= 13).. Most participants (42/45) were SARS‐CoV‐ 2‐experienced at the time of immunological testing.. JN.1‐spike‐binding NtAbs were measured with a vesicular stomatitis virus pseudotype‐based neutralization assay, whereas interferon (IFN)‐γ‐producing spike‐directed CD4 or CD8 T‐cell frequencies were enumerated using flow cytometry for intracellular staining.

    Lysis:

    Article Title: Vaccination with nanoparticles displaying gH/gL from Epstein-Barr virus elicits limited cross-protection against rhesus lymphocryptovirus.
    Article Snippet: Cells were then washed with PBS and stained with Live/Dead Fixable Blue Dead Cell Stain Kit (Invitrogen #L23105) according to the manufacturer’s instructions, washed with FACS buffer and incubated with 1:25 dilution anti-CD16 (BioLegend #302036) and 1:50 anti-CD20 (BD #563126) antibodies per sample. .. Cells were then washed twice, and residual red blood cells were lysed and all cells fixed in 100 ml BD lysis buffer (BD #349202), washed, and incubated with 200 ml BD FACS Permeabilizing Solution 2 (BD #340973). .. Intracellular staining was done with 1:1000 dilution of anti-CD8 (BD #612889) and CD4 (BD #566148), 1:2500 anti- CD3 (BD #564117), 1:200 anti- TNFa (ThermoFisher #11-7349-82) and IFN-g (BD #560371), and 1:50 anti- IL-2 (BioLegend #500310) antibodies.

    Transfection:

    Article Title: Vaccination with nanoparticles displaying gH/gL from Epstein-Barr virus elicits limited cross-protection against rhesus lymphocryptovirus.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Recombinant AMMO1 Snijder et al.28 N/A Recombinant CL40 with human constant regions Singh et al.30 N/A Recombinant CL59 with human constant regions Singh et al.30 N/A Recombinant 72A1 with human constant regions Singh et al.30 N/A Recombinant E1D1 with human constant regions Malhi et al.38 N/A Recombinant 770F7 Chen et al.27 N/A Recombinant 1D8 Zhu et al.29 N/A Recombinant 769B10 Bu et al.26 N/A AF488 anti-human CD3 clone SP34-2 BD Biosciences Cat#557705; RRID:AB_396814 AF488 anti-human CD4 clone OKT4 Biolegend Cat#317419; RRID:AB_571938 AF488 anti-human CD8 clone RPA-T8 BD Biosciences Cat#557704; RRID:AB_396813 AF488 anti-human CD14 clone M5E2 BD Biosciences Cat#561706; RRID: AB_10924601 BV421 anti-human CD20 clone 2H7 Biolegend Cat#302329; RRID: AB_10933088 anti-human CD28/ anti-CD49d BD Biosciences Cat#347690; RRID:AB_647457 BV570 anti-human CD16 Biolegend Cat#302036; RRID:AB_2632790 BV711 anti-human CD20 BD Biosciences Cat#563126; RRID:AB_2313579 BUV805 anti-human CD8 BD Biosciences Cat#612889; RRID:AB_2833078 BV480 anti-human CD4 BD Biosciences Cat#566148; RRID:AB_2739546 BUV395 anti-human CD3 BD Biosciences Cat#564117; RRID:AB_2738603 BB515 anti-human TNFa ThermoFisher Cat#11-7349-82; RRID: AB_465424 BV421 anti-human IFN-g BD Biosciences Cat#560371; RRID:AB_1645594 Allophycocyanin (APC)-anti-human IL-2 BioLegend Cat#500310; RRID:AB_315097 Goat anti-human IgG-HRP Southern Biotech Cat#2010-05; RRID:AB_2795564 Goat anti-human IgG Southern Biotech Cat#2040-01; RRID:AB_2795640 Bacterial and virus strains EBV B95.8/F Delecluse et al.53 N/A Rhesus Lymphocryptovirus strain LCL 8664 ATCC Cat#CRL-1805; RRID: CVCL_3464 Biological samples Rhesus macaque blood Washington National Primate Research Center N/A Chemicals, peptides, and recombinant proteins Sigma Adjuvant Systems Sigma Aldrich Cat#S6322 SMNP Silva et al.40 N/A NeutrAvidin Thermofisher Cat#31000 SureBlue Reserve TMB Microwell Peroxidase substrate SeraCare Cat#5120-0081 Totalseq APC-streptavidin BioLegend Cat#405283 Phycoerythrin (PE)- streptavidin BioLegend Cat#405203 eFluor 506 viability dye eBioscience Cat#65-0866-14 Rhesus Fc receptor inhibitor eBioscience Cat#14-9161-73 Overlapping 15 amino acid peptide pools spanning EBV gH and gL This study Synthesized by Mimotopes Brefeldin A Sigma-Aldrich Cat#B-7651 Live/Dead Fixable Blue Dead Cell Stain Kit Invitrogen Cat#L23105 BD lysis buffer BD Biosciences Cat#349202 (Continued on next page) e1 Cell Reports Medicine 5, 101587, June 18, 2024 OPEN ACCESS .. REAGENT or RESOURCE SOURCE IDENTIFIER BD FACS Permeabilizing Solution 2 BD Biosciences Cat340973 Anti-human IgG Fc capture (AHC) biosensors Sartorius Cat#18-5063 Streptavidin biosensors Sartorius Cat#18-5020 Protein A Resin GoldBio Cat#P-400-50 Protein A/G resin Thermofisher Cat#53133 Pierce IgG Elution Buffer ThermoFisher Cat#21009 GeneJuice Transfection Reagent EMD Millipore Cat#70967 12-O-Tetradecanoylphorbol 13-acetate Sigma Aldrich Cat#P8139 sodium butyrate Sigma Aldrich Cat#303410 Cyclosporin A Fisher Scientific Cat#AAJ6319103 eBioscience Fixable Viability Dye eFluor 506 ThermoFisher Cat#65-0866-18 0.25% trypsin ThermoFisher Cat#25200056 10% Formalin Millipore Sigma Cat#HT501128 EZ-Link NHS-PEG4-Biotin Kit ThermoFisher Cat#21330 Zeba Spin Desalting Columns 40K MWCO ThermoFisher Cat#87766 AluI restriction-enzyme New England BioLabs Cat#R0137S Critical commercial assays QiaAmp DNA blood mini kit Qiagen Cat#51104 QuantiTect Multiplex PCR Kit Qiagen Cat#204543 ddPCR Supermix for Probes, no-dUTP Bio-Rad Cat#1863024 Droplet Generator DG8 Cartridge Bio-Rad Cat#1864008 SureBlue Reserve TMB Microwell Peroxidase substrate SeraCare Cat#5120-0081 Steady-Glo luciferase reagent Promega Cat#E2510 Cell Line Nucleofector Kit V Lonza Cat#VVCA-1003 eBioscience Foxp3 / Transcription Factor Staining Buffer Set ThermoFisher Cat#00-5523-00 Experimental models: Cell lines Raji ATCC Cat# CCL-86; RRID: CVCL_0511 293-6E cells National Research Council, Canada RRID: CVCL_HF20 293T cells RRID: CVCL_0063 293-2089 Delecluse et al.53 N/A SVKCR2 Li et al.54 RRID: CVCL_YD67 AKATA-GFP Molesworth et al.48 N/A .. 293-T7 Omerovic et al.45 N/A LCL 8664 cells ATCC RRID: CVCL_3464 BL21(DE3) E. coli NEB Cat#C2527H Oligonucleotides Rhesus LCV IR1 forward primer AAATCTAAACTTTTGAGGCGATCTG Sashihara et al.36 N/A Rhesus LCV IR1 reverse primer CCAACCATAGACCCGTTTCCT Sashihara et al.36 N/A FAM-labeled Rhesus LCV IR1 probe TCTCCGCGTGCGCATAATGGC Sashihara et al.36 N/A Rhesus RPP30 forward primer GACTTGGACGTGCGAGCG Singh et al.30 N/A Rhesus RPP30 reverse primer GCCGCTGTCTCCACAAGT Singh et al.30 N/A Hex-labeled Rhesus RPP30 probe TCTGACCTGAAGGCTCTG CGCG Singh et al.30 N/A Recombinant DNA pGEX4.1 Addgene Cat# 27458001 pGEX-rhLCV-VCA This study N/A psPAX2 Addgene Cat#12260 (Continued on next page) Cell Reports Medicine 5, 101587, June 18, 2024 e2 OPEN ACCESS

    Multiplex Assay:

    Article Title: Vaccination with nanoparticles displaying gH/gL from Epstein-Barr virus elicits limited cross-protection against rhesus lymphocryptovirus.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Recombinant AMMO1 Snijder et al.28 N/A Recombinant CL40 with human constant regions Singh et al.30 N/A Recombinant CL59 with human constant regions Singh et al.30 N/A Recombinant 72A1 with human constant regions Singh et al.30 N/A Recombinant E1D1 with human constant regions Malhi et al.38 N/A Recombinant 770F7 Chen et al.27 N/A Recombinant 1D8 Zhu et al.29 N/A Recombinant 769B10 Bu et al.26 N/A AF488 anti-human CD3 clone SP34-2 BD Biosciences Cat#557705; RRID:AB_396814 AF488 anti-human CD4 clone OKT4 Biolegend Cat#317419; RRID:AB_571938 AF488 anti-human CD8 clone RPA-T8 BD Biosciences Cat#557704; RRID:AB_396813 AF488 anti-human CD14 clone M5E2 BD Biosciences Cat#561706; RRID: AB_10924601 BV421 anti-human CD20 clone 2H7 Biolegend Cat#302329; RRID: AB_10933088 anti-human CD28/ anti-CD49d BD Biosciences Cat#347690; RRID:AB_647457 BV570 anti-human CD16 Biolegend Cat#302036; RRID:AB_2632790 BV711 anti-human CD20 BD Biosciences Cat#563126; RRID:AB_2313579 BUV805 anti-human CD8 BD Biosciences Cat#612889; RRID:AB_2833078 BV480 anti-human CD4 BD Biosciences Cat#566148; RRID:AB_2739546 BUV395 anti-human CD3 BD Biosciences Cat#564117; RRID:AB_2738603 BB515 anti-human TNFa ThermoFisher Cat#11-7349-82; RRID: AB_465424 BV421 anti-human IFN-g BD Biosciences Cat#560371; RRID:AB_1645594 Allophycocyanin (APC)-anti-human IL-2 BioLegend Cat#500310; RRID:AB_315097 Goat anti-human IgG-HRP Southern Biotech Cat#2010-05; RRID:AB_2795564 Goat anti-human IgG Southern Biotech Cat#2040-01; RRID:AB_2795640 Bacterial and virus strains EBV B95.8/F Delecluse et al.53 N/A Rhesus Lymphocryptovirus strain LCL 8664 ATCC Cat#CRL-1805; RRID: CVCL_3464 Biological samples Rhesus macaque blood Washington National Primate Research Center N/A Chemicals, peptides, and recombinant proteins Sigma Adjuvant Systems Sigma Aldrich Cat#S6322 SMNP Silva et al.40 N/A NeutrAvidin Thermofisher Cat#31000 SureBlue Reserve TMB Microwell Peroxidase substrate SeraCare Cat#5120-0081 Totalseq APC-streptavidin BioLegend Cat#405283 Phycoerythrin (PE)- streptavidin BioLegend Cat#405203 eFluor 506 viability dye eBioscience Cat#65-0866-14 Rhesus Fc receptor inhibitor eBioscience Cat#14-9161-73 Overlapping 15 amino acid peptide pools spanning EBV gH and gL This study Synthesized by Mimotopes Brefeldin A Sigma-Aldrich Cat#B-7651 Live/Dead Fixable Blue Dead Cell Stain Kit Invitrogen Cat#L23105 BD lysis buffer BD Biosciences Cat#349202 (Continued on next page) e1 Cell Reports Medicine 5, 101587, June 18, 2024 OPEN ACCESS .. REAGENT or RESOURCE SOURCE IDENTIFIER BD FACS Permeabilizing Solution 2 BD Biosciences Cat340973 Anti-human IgG Fc capture (AHC) biosensors Sartorius Cat#18-5063 Streptavidin biosensors Sartorius Cat#18-5020 Protein A Resin GoldBio Cat#P-400-50 Protein A/G resin Thermofisher Cat#53133 Pierce IgG Elution Buffer ThermoFisher Cat#21009 GeneJuice Transfection Reagent EMD Millipore Cat#70967 12-O-Tetradecanoylphorbol 13-acetate Sigma Aldrich Cat#P8139 sodium butyrate Sigma Aldrich Cat#303410 Cyclosporin A Fisher Scientific Cat#AAJ6319103 eBioscience Fixable Viability Dye eFluor 506 ThermoFisher Cat#65-0866-18 0.25% trypsin ThermoFisher Cat#25200056 10% Formalin Millipore Sigma Cat#HT501128 EZ-Link NHS-PEG4-Biotin Kit ThermoFisher Cat#21330 Zeba Spin Desalting Columns 40K MWCO ThermoFisher Cat#87766 AluI restriction-enzyme New England BioLabs Cat#R0137S Critical commercial assays QiaAmp DNA blood mini kit Qiagen Cat#51104 QuantiTect Multiplex PCR Kit Qiagen Cat#204543 ddPCR Supermix for Probes, no-dUTP Bio-Rad Cat#1863024 Droplet Generator DG8 Cartridge Bio-Rad Cat#1864008 SureBlue Reserve TMB Microwell Peroxidase substrate SeraCare Cat#5120-0081 Steady-Glo luciferase reagent Promega Cat#E2510 Cell Line Nucleofector Kit V Lonza Cat#VVCA-1003 eBioscience Foxp3 / Transcription Factor Staining Buffer Set ThermoFisher Cat#00-5523-00 Experimental models: Cell lines Raji ATCC Cat# CCL-86; RRID: CVCL_0511 293-6E cells National Research Council, Canada RRID: CVCL_HF20 293T cells RRID: CVCL_0063 293-2089 Delecluse et al.53 N/A SVKCR2 Li et al.54 RRID: CVCL_YD67 AKATA-GFP Molesworth et al.48 N/A .. 293-T7 Omerovic et al.45 N/A LCL 8664 cells ATCC RRID: CVCL_3464 BL21(DE3) E. coli NEB Cat#C2527H Oligonucleotides Rhesus LCV IR1 forward primer AAATCTAAACTTTTGAGGCGATCTG Sashihara et al.36 N/A Rhesus LCV IR1 reverse primer CCAACCATAGACCCGTTTCCT Sashihara et al.36 N/A FAM-labeled Rhesus LCV IR1 probe TCTCCGCGTGCGCATAATGGC Sashihara et al.36 N/A Rhesus RPP30 forward primer GACTTGGACGTGCGAGCG Singh et al.30 N/A Rhesus RPP30 reverse primer GCCGCTGTCTCCACAAGT Singh et al.30 N/A Hex-labeled Rhesus RPP30 probe TCTGACCTGAAGGCTCTG CGCG Singh et al.30 N/A Recombinant DNA pGEX4.1 Addgene Cat# 27458001 pGEX-rhLCV-VCA This study N/A psPAX2 Addgene Cat#12260 (Continued on next page) Cell Reports Medicine 5, 101587, June 18, 2024 e2 OPEN ACCESS

    Polymerase Chain Reaction:

    Article Title: Vaccination with nanoparticles displaying gH/gL from Epstein-Barr virus elicits limited cross-protection against rhesus lymphocryptovirus.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Recombinant AMMO1 Snijder et al.28 N/A Recombinant CL40 with human constant regions Singh et al.30 N/A Recombinant CL59 with human constant regions Singh et al.30 N/A Recombinant 72A1 with human constant regions Singh et al.30 N/A Recombinant E1D1 with human constant regions Malhi et al.38 N/A Recombinant 770F7 Chen et al.27 N/A Recombinant 1D8 Zhu et al.29 N/A Recombinant 769B10 Bu et al.26 N/A AF488 anti-human CD3 clone SP34-2 BD Biosciences Cat#557705; RRID:AB_396814 AF488 anti-human CD4 clone OKT4 Biolegend Cat#317419; RRID:AB_571938 AF488 anti-human CD8 clone RPA-T8 BD Biosciences Cat#557704; RRID:AB_396813 AF488 anti-human CD14 clone M5E2 BD Biosciences Cat#561706; RRID: AB_10924601 BV421 anti-human CD20 clone 2H7 Biolegend Cat#302329; RRID: AB_10933088 anti-human CD28/ anti-CD49d BD Biosciences Cat#347690; RRID:AB_647457 BV570 anti-human CD16 Biolegend Cat#302036; RRID:AB_2632790 BV711 anti-human CD20 BD Biosciences Cat#563126; RRID:AB_2313579 BUV805 anti-human CD8 BD Biosciences Cat#612889; RRID:AB_2833078 BV480 anti-human CD4 BD Biosciences Cat#566148; RRID:AB_2739546 BUV395 anti-human CD3 BD Biosciences Cat#564117; RRID:AB_2738603 BB515 anti-human TNFa ThermoFisher Cat#11-7349-82; RRID: AB_465424 BV421 anti-human IFN-g BD Biosciences Cat#560371; RRID:AB_1645594 Allophycocyanin (APC)-anti-human IL-2 BioLegend Cat#500310; RRID:AB_315097 Goat anti-human IgG-HRP Southern Biotech Cat#2010-05; RRID:AB_2795564 Goat anti-human IgG Southern Biotech Cat#2040-01; RRID:AB_2795640 Bacterial and virus strains EBV B95.8/F Delecluse et al.53 N/A Rhesus Lymphocryptovirus strain LCL 8664 ATCC Cat#CRL-1805; RRID: CVCL_3464 Biological samples Rhesus macaque blood Washington National Primate Research Center N/A Chemicals, peptides, and recombinant proteins Sigma Adjuvant Systems Sigma Aldrich Cat#S6322 SMNP Silva et al.40 N/A NeutrAvidin Thermofisher Cat#31000 SureBlue Reserve TMB Microwell Peroxidase substrate SeraCare Cat#5120-0081 Totalseq APC-streptavidin BioLegend Cat#405283 Phycoerythrin (PE)- streptavidin BioLegend Cat#405203 eFluor 506 viability dye eBioscience Cat#65-0866-14 Rhesus Fc receptor inhibitor eBioscience Cat#14-9161-73 Overlapping 15 amino acid peptide pools spanning EBV gH and gL This study Synthesized by Mimotopes Brefeldin A Sigma-Aldrich Cat#B-7651 Live/Dead Fixable Blue Dead Cell Stain Kit Invitrogen Cat#L23105 BD lysis buffer BD Biosciences Cat#349202 (Continued on next page) e1 Cell Reports Medicine 5, 101587, June 18, 2024 OPEN ACCESS .. REAGENT or RESOURCE SOURCE IDENTIFIER BD FACS Permeabilizing Solution 2 BD Biosciences Cat340973 Anti-human IgG Fc capture (AHC) biosensors Sartorius Cat#18-5063 Streptavidin biosensors Sartorius Cat#18-5020 Protein A Resin GoldBio Cat#P-400-50 Protein A/G resin Thermofisher Cat#53133 Pierce IgG Elution Buffer ThermoFisher Cat#21009 GeneJuice Transfection Reagent EMD Millipore Cat#70967 12-O-Tetradecanoylphorbol 13-acetate Sigma Aldrich Cat#P8139 sodium butyrate Sigma Aldrich Cat#303410 Cyclosporin A Fisher Scientific Cat#AAJ6319103 eBioscience Fixable Viability Dye eFluor 506 ThermoFisher Cat#65-0866-18 0.25% trypsin ThermoFisher Cat#25200056 10% Formalin Millipore Sigma Cat#HT501128 EZ-Link NHS-PEG4-Biotin Kit ThermoFisher Cat#21330 Zeba Spin Desalting Columns 40K MWCO ThermoFisher Cat#87766 AluI restriction-enzyme New England BioLabs Cat#R0137S Critical commercial assays QiaAmp DNA blood mini kit Qiagen Cat#51104 QuantiTect Multiplex PCR Kit Qiagen Cat#204543 ddPCR Supermix for Probes, no-dUTP Bio-Rad Cat#1863024 Droplet Generator DG8 Cartridge Bio-Rad Cat#1864008 SureBlue Reserve TMB Microwell Peroxidase substrate SeraCare Cat#5120-0081 Steady-Glo luciferase reagent Promega Cat#E2510 Cell Line Nucleofector Kit V Lonza Cat#VVCA-1003 eBioscience Foxp3 / Transcription Factor Staining Buffer Set ThermoFisher Cat#00-5523-00 Experimental models: Cell lines Raji ATCC Cat# CCL-86; RRID: CVCL_0511 293-6E cells National Research Council, Canada RRID: CVCL_HF20 293T cells RRID: CVCL_0063 293-2089 Delecluse et al.53 N/A SVKCR2 Li et al.54 RRID: CVCL_YD67 AKATA-GFP Molesworth et al.48 N/A .. 293-T7 Omerovic et al.45 N/A LCL 8664 cells ATCC RRID: CVCL_3464 BL21(DE3) E. coli NEB Cat#C2527H Oligonucleotides Rhesus LCV IR1 forward primer AAATCTAAACTTTTGAGGCGATCTG Sashihara et al.36 N/A Rhesus LCV IR1 reverse primer CCAACCATAGACCCGTTTCCT Sashihara et al.36 N/A FAM-labeled Rhesus LCV IR1 probe TCTCCGCGTGCGCATAATGGC Sashihara et al.36 N/A Rhesus RPP30 forward primer GACTTGGACGTGCGAGCG Singh et al.30 N/A Rhesus RPP30 reverse primer GCCGCTGTCTCCACAAGT Singh et al.30 N/A Hex-labeled Rhesus RPP30 probe TCTGACCTGAAGGCTCTG CGCG Singh et al.30 N/A Recombinant DNA pGEX4.1 Addgene Cat# 27458001 pGEX-rhLCV-VCA This study N/A psPAX2 Addgene Cat#12260 (Continued on next page) Cell Reports Medicine 5, 101587, June 18, 2024 e2 OPEN ACCESS

    Luciferase:

    Article Title: Vaccination with nanoparticles displaying gH/gL from Epstein-Barr virus elicits limited cross-protection against rhesus lymphocryptovirus.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Recombinant AMMO1 Snijder et al.28 N/A Recombinant CL40 with human constant regions Singh et al.30 N/A Recombinant CL59 with human constant regions Singh et al.30 N/A Recombinant 72A1 with human constant regions Singh et al.30 N/A Recombinant E1D1 with human constant regions Malhi et al.38 N/A Recombinant 770F7 Chen et al.27 N/A Recombinant 1D8 Zhu et al.29 N/A Recombinant 769B10 Bu et al.26 N/A AF488 anti-human CD3 clone SP34-2 BD Biosciences Cat#557705; RRID:AB_396814 AF488 anti-human CD4 clone OKT4 Biolegend Cat#317419; RRID:AB_571938 AF488 anti-human CD8 clone RPA-T8 BD Biosciences Cat#557704; RRID:AB_396813 AF488 anti-human CD14 clone M5E2 BD Biosciences Cat#561706; RRID: AB_10924601 BV421 anti-human CD20 clone 2H7 Biolegend Cat#302329; RRID: AB_10933088 anti-human CD28/ anti-CD49d BD Biosciences Cat#347690; RRID:AB_647457 BV570 anti-human CD16 Biolegend Cat#302036; RRID:AB_2632790 BV711 anti-human CD20 BD Biosciences Cat#563126; RRID:AB_2313579 BUV805 anti-human CD8 BD Biosciences Cat#612889; RRID:AB_2833078 BV480 anti-human CD4 BD Biosciences Cat#566148; RRID:AB_2739546 BUV395 anti-human CD3 BD Biosciences Cat#564117; RRID:AB_2738603 BB515 anti-human TNFa ThermoFisher Cat#11-7349-82; RRID: AB_465424 BV421 anti-human IFN-g BD Biosciences Cat#560371; RRID:AB_1645594 Allophycocyanin (APC)-anti-human IL-2 BioLegend Cat#500310; RRID:AB_315097 Goat anti-human IgG-HRP Southern Biotech Cat#2010-05; RRID:AB_2795564 Goat anti-human IgG Southern Biotech Cat#2040-01; RRID:AB_2795640 Bacterial and virus strains EBV B95.8/F Delecluse et al.53 N/A Rhesus Lymphocryptovirus strain LCL 8664 ATCC Cat#CRL-1805; RRID: CVCL_3464 Biological samples Rhesus macaque blood Washington National Primate Research Center N/A Chemicals, peptides, and recombinant proteins Sigma Adjuvant Systems Sigma Aldrich Cat#S6322 SMNP Silva et al.40 N/A NeutrAvidin Thermofisher Cat#31000 SureBlue Reserve TMB Microwell Peroxidase substrate SeraCare Cat#5120-0081 Totalseq APC-streptavidin BioLegend Cat#405283 Phycoerythrin (PE)- streptavidin BioLegend Cat#405203 eFluor 506 viability dye eBioscience Cat#65-0866-14 Rhesus Fc receptor inhibitor eBioscience Cat#14-9161-73 Overlapping 15 amino acid peptide pools spanning EBV gH and gL This study Synthesized by Mimotopes Brefeldin A Sigma-Aldrich Cat#B-7651 Live/Dead Fixable Blue Dead Cell Stain Kit Invitrogen Cat#L23105 BD lysis buffer BD Biosciences Cat#349202 (Continued on next page) e1 Cell Reports Medicine 5, 101587, June 18, 2024 OPEN ACCESS .. REAGENT or RESOURCE SOURCE IDENTIFIER BD FACS Permeabilizing Solution 2 BD Biosciences Cat340973 Anti-human IgG Fc capture (AHC) biosensors Sartorius Cat#18-5063 Streptavidin biosensors Sartorius Cat#18-5020 Protein A Resin GoldBio Cat#P-400-50 Protein A/G resin Thermofisher Cat#53133 Pierce IgG Elution Buffer ThermoFisher Cat#21009 GeneJuice Transfection Reagent EMD Millipore Cat#70967 12-O-Tetradecanoylphorbol 13-acetate Sigma Aldrich Cat#P8139 sodium butyrate Sigma Aldrich Cat#303410 Cyclosporin A Fisher Scientific Cat#AAJ6319103 eBioscience Fixable Viability Dye eFluor 506 ThermoFisher Cat#65-0866-18 0.25% trypsin ThermoFisher Cat#25200056 10% Formalin Millipore Sigma Cat#HT501128 EZ-Link NHS-PEG4-Biotin Kit ThermoFisher Cat#21330 Zeba Spin Desalting Columns 40K MWCO ThermoFisher Cat#87766 AluI restriction-enzyme New England BioLabs Cat#R0137S Critical commercial assays QiaAmp DNA blood mini kit Qiagen Cat#51104 QuantiTect Multiplex PCR Kit Qiagen Cat#204543 ddPCR Supermix for Probes, no-dUTP Bio-Rad Cat#1863024 Droplet Generator DG8 Cartridge Bio-Rad Cat#1864008 SureBlue Reserve TMB Microwell Peroxidase substrate SeraCare Cat#5120-0081 Steady-Glo luciferase reagent Promega Cat#E2510 Cell Line Nucleofector Kit V Lonza Cat#VVCA-1003 eBioscience Foxp3 / Transcription Factor Staining Buffer Set ThermoFisher Cat#00-5523-00 Experimental models: Cell lines Raji ATCC Cat# CCL-86; RRID: CVCL_0511 293-6E cells National Research Council, Canada RRID: CVCL_HF20 293T cells RRID: CVCL_0063 293-2089 Delecluse et al.53 N/A SVKCR2 Li et al.54 RRID: CVCL_YD67 AKATA-GFP Molesworth et al.48 N/A .. 293-T7 Omerovic et al.45 N/A LCL 8664 cells ATCC RRID: CVCL_3464 BL21(DE3) E. coli NEB Cat#C2527H Oligonucleotides Rhesus LCV IR1 forward primer AAATCTAAACTTTTGAGGCGATCTG Sashihara et al.36 N/A Rhesus LCV IR1 reverse primer CCAACCATAGACCCGTTTCCT Sashihara et al.36 N/A FAM-labeled Rhesus LCV IR1 probe TCTCCGCGTGCGCATAATGGC Sashihara et al.36 N/A Rhesus RPP30 forward primer GACTTGGACGTGCGAGCG Singh et al.30 N/A Rhesus RPP30 reverse primer GCCGCTGTCTCCACAAGT Singh et al.30 N/A Hex-labeled Rhesus RPP30 probe TCTGACCTGAAGGCTCTG CGCG Singh et al.30 N/A Recombinant DNA pGEX4.1 Addgene Cat# 27458001 pGEX-rhLCV-VCA This study N/A psPAX2 Addgene Cat#12260 (Continued on next page) Cell Reports Medicine 5, 101587, June 18, 2024 e2 OPEN ACCESS

    Labeling:

    Article Title: Neutralizing Antibody and T-Cell Spike Targeted Responses Following Receipt of a Monovalent Omicron JN.1-Adapted mRNA COVID-19 Vaccine in Immunosuppressed and Healthy Individuals.
    Article Snippet: We evaluated homologous neutralizing antibody (NtAb) and T‐cell responses after receipt of a JN.1‐adapted mRNA vaccine in a mixed population comprising healthy controls (HC) (n= 15), end‐stage chronic kidney disease (CKD) patients (n= 17), and allogeneic hematopoietic stem cell transplant recipients (allo‐HCT) (n= 13).. Most participants (42/45) were SARS‐CoV‐ 2‐experienced at the time of immunological testing.. JN.1‐spike‐binding NtAbs were measured with a vesicular stomatitis virus pseudotype‐based neutralization assay, whereas interferon (IFN)‐γ‐producing spike‐directed CD4 or CD8 T‐cell frequencies were enumerated using flow cytometry for intracellular staining.

    Bioprocessing:

    Article Title: Neutralizing Antibody and T-Cell Spike Targeted Responses Following Receipt of a Monovalent Omicron JN.1-Adapted mRNA COVID-19 Vaccine in Immunosuppressed and Healthy Individuals.
    Article Snippet: We evaluated homologous neutralizing antibody (NtAb) and T‐cell responses after receipt of a JN.1‐adapted mRNA vaccine in a mixed population comprising healthy controls (HC) (n= 15), end‐stage chronic kidney disease (CKD) patients (n= 17), and allogeneic hematopoietic stem cell transplant recipients (allo‐HCT) (n= 13).. Most participants (42/45) were SARS‐CoV‐ 2‐experienced at the time of immunological testing.. JN.1‐spike‐binding NtAbs were measured with a vesicular stomatitis virus pseudotype‐based neutralization assay, whereas interferon (IFN)‐γ‐producing spike‐directed CD4 or CD8 T‐cell frequencies were enumerated using flow cytometry for intracellular staining.



    Similar Products

    permeabilizing-solution2  (Becton Dickinson)
    90
    Becton Dickinson permeabilizing-solution2
    Permeabilizing Solution2, supplied by Becton Dickinson, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/permeabilizing-solution2/facs+permeabilizing+solution/pm36845129-51-7-8
    Average 90 stars, based on 1 article reviews
    permeabilizing-solution2 - by Bioz Stars, 2026-09
    90/100 stars
    		  Buy from Supplier
    facs permeabilizing solution2 1x  (Becton Dickinson)
    90
    Becton Dickinson facs permeabilizing solution2 1x
    Facs Permeabilizing Solution2 1x, supplied by Becton Dickinson, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/permeabilizing-solution2/facs+permeabilizing+solution/pmc09467550-87-14-20
    Average 90 stars, based on 1 article reviews
    facs permeabilizing solution2 1x - by Bioz Stars, 2026-09
    90/100 stars
    		  Buy from Supplier
    facs ™ permeabilizing solution2 (10  (Becton Dickinson)
    90
    Becton Dickinson facs ™ permeabilizing solution2 (10
    Facs ™ Permeabilizing Solution2 (10, supplied by Becton Dickinson, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/permeabilizing-solution2/facs+permeabilizing+solution/10__1556_slash_aphysiol__100__2013__001-47-24-30
    Average 90 stars, based on 1 article reviews
    facs ™ permeabilizing solution2 (10 - by Bioz Stars, 2026-09
    90/100 stars
    		  Buy from Supplier
    facs ™ permeabilizing solution2 (10x  (Becton Dickinson)
    90
    Becton Dickinson facs ™ permeabilizing solution2 (10x
    Facs ™ Permeabilizing Solution2 (10x, supplied by Becton Dickinson, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/permeabilizing-solution2/facs+permeabilizing+solution/pm21691090-48-22-28
    Average 90 stars, based on 1 article reviews
    facs ™ permeabilizing solution2 (10x - by Bioz Stars, 2026-09
    90/100 stars
    		  Buy from Supplier
    facs ™ permeabilizing solution2(10  (Becton Dickinson)
    90
    Becton Dickinson facs ™ permeabilizing solution2(10
    Facs ™ Permeabilizing Solution2(10, supplied by Becton Dickinson, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/permeabilizing-solution2/facs+permeabilizing+solution/pmc03118827-96-25-30
    Average 90 stars, based on 1 article reviews
    facs ™ permeabilizing solution2(10 - by Bioz Stars, 2026-09
    90/100 stars
    		  Buy from Supplier
    facs ™ permeabilizing solution2(10×) (perm2  (Becton Dickinson)
    90
    Becton Dickinson facs ™ permeabilizing solution2(10×) (perm2
    Facs ™ Permeabilizing Solution2(10×) (Perm2, supplied by Becton Dickinson, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/permeabilizing-solution2/facs+permeabilizing+solution/pmc03118827-153-20-25
    Average 90 stars, based on 1 article reviews
    facs ™ permeabilizing solution2(10×) (perm2 - by Bioz Stars, 2026-09
    90/100 stars
    		  Buy from Supplier

    Image Search Results