p egfp c3 empty vector plasmid (Addgene inc)
Addgene inc is a verified supplier 
93
Structured Review
Addgene inc
p egfp c3 empty vector plasmid
P Egfp C3 Empty Vector Plasmid, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 24 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pegfp+empty+vector/pEGFP(C3)-Nup153-N+(Plasmid+%2364318)/pmc09998969-158-16-21
Average 93 stars, based on 24 article reviews
P Egfp C3 Empty Vector Plasmid, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 24 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pegfp+empty+vector/pEGFP(C3)-Nup153-N+(Plasmid+%2364318)/pmc09998969-158-16-21
Average 93 stars, based on 24 article reviews
p egfp c3 empty vector plasmid - by Bioz Stars,
2026-10
93/100 stars
Images
Related Articles
Real-time Polymerase Chain Reaction:Article Title: Hormone-induced enhancer assembly requires an optimal level of hormone receptor multivalent interactions. Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER CircLigase ssDNA Ligase Epicentre Cat# CL4111K Ape1 New England BioLabs Cat# M0282S Phusion High-Fidelity DNA Polymerase New England BioLabs Cat# M0530L Gibson Assembly Master Mix New England BioLabs Cat# E2611L Proteinase K, recombinant, PCR Grade Roche Cat# 3115879001 RNase Sigma-Aldrich Cat# R6513 TRIzol LS Reagent Life Technologies Cat# 10296028 T4 PNK New England BioLabs Cat# M0201S DNase I Life Technologies Cat# AM2222 Benzonase Nuclease EMD Millipore Cat# 70746 MyOne Streptavidin T1 Dynabeads Life Technologies Cat# 65602 Nanolink Streptavidin Magnetic beads Solulink Cat# M-1002-010 AcTEV Protease Life Technologies Cat# 12575015 PEG8000 Sigma-Aldrich Cat# 89510 BioRad protein assay BioRAD Cat# 5000001 Critical commercial assays pCR 8/GW/TOPO TA Cloning Kit Life Technologies Cat# K250020 Gateway LR Clonase II Enzyme mix Life Technologies Cat# 11791100 Dual-Glo Luciferase Assay System Promega Cat# E2940 Antifade mountant with DAPI Life Technologies Cat# P36931 RNeasy Mini Kit Qiagen Cat# 74106 iScript Select cDNA Synthesis Kit BioRAD Cat# 1708897 SsoAdvanced Universal SYBR Green Supermix BioRAD Cat# 1725275 QIAquick spin columns Qiagen Cat# 28115 KAPA Hyper Prep kit Kapa Biosystems Cat# KK8504 Nextera DNA Library Prep Kit Illumina Cat# FC-121-1030 Deposited data Raw and processed sequencing data for ChIP-seq This paper GEO: GSE215161 Raw and processed sequencing data for ATAC-seq This paper GEO: GSE215160 Raw and processed sequencing data for GRO-seq This paper GEO: GSE215162 AR ChIP-seq Malinen et al.39 GEO: GSE83860 H3K27ac ChIP-seq Hazelett et al.40 GEO: GSE51621 Experimental models: Cell lines Human: LNCaP ATCC Cat# CRL-1740 Human: U2OS ATCC Cat# HTB-96 Human: SH-SY5Y ATCC Cat# CRL-2266 Human: HEK293T ATCC Cat# CRL-3216 Human: U2OS 2-6-3 Janicki et al.51 N/A Human: LNCaP-pInducer20-AR stable lines for wildtype and mutants This paper N/A Human: LNCaP-TetR stable line This paper N/A Human: LNCaP-TetR-BioID-AR stable lines for wt, DIDR, and pQ69 This paper N/A Human: LNCaP-BirA-TetR stable line This paper N/A (Continued on next page) e2 Molecular Cell 83, 3438–3456.e1–e12, October 5, 2023 .. REAGENT or RESOURCE SOURCE IDENTIFIER Human: LNCaP-BirA-TetR-BLRP-AR stable lines for wt, DIDR, and pQ69 This paper N/A Oligonucleotides Primers or oligos for qPCR and GRO-seq see method details This paper N/A Recombinant DNA shAR Sigma-Aldrich TRCN0000003718 shControl Sigma-Aldrich SHC002 shControl Sigma-Aldrich SHC202 pET-His-GFP-gw This paper N/A pET-His-GFP-ARNTD for wildtype and mutants This paper N/A pEGFP-C3-gw This Recombinant:Article Title: Hormone-induced enhancer assembly requires an optimal level of hormone receptor multivalent interactions. Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER CircLigase ssDNA Ligase Epicentre Cat# CL4111K Ape1 New England BioLabs Cat# M0282S Phusion High-Fidelity DNA Polymerase New England BioLabs Cat# M0530L Gibson Assembly Master Mix New England BioLabs Cat# E2611L Proteinase K, recombinant, PCR Grade Roche Cat# 3115879001 RNase Sigma-Aldrich Cat# R6513 TRIzol LS Reagent Life Technologies Cat# 10296028 T4 PNK New England BioLabs Cat# M0201S DNase I Life Technologies Cat# AM2222 Benzonase Nuclease EMD Millipore Cat# 70746 MyOne Streptavidin T1 Dynabeads Life Technologies Cat# 65602 Nanolink Streptavidin Magnetic beads Solulink Cat# M-1002-010 AcTEV Protease Life Technologies Cat# 12575015 PEG8000 Sigma-Aldrich Cat# 89510 BioRad protein assay BioRAD Cat# 5000001 Critical commercial assays pCR 8/GW/TOPO TA Cloning Kit Life Technologies Cat# K250020 Gateway LR Clonase II Enzyme mix Life Technologies Cat# 11791100 Dual-Glo Luciferase Assay System Promega Cat# E2940 Antifade mountant with DAPI Life Technologies Cat# P36931 RNeasy Mini Kit Qiagen Cat# 74106 iScript Select cDNA Synthesis Kit BioRAD Cat# 1708897 SsoAdvanced Universal SYBR Green Supermix BioRAD Cat# 1725275 QIAquick spin columns Qiagen Cat# 28115 KAPA Hyper Prep kit Kapa Biosystems Cat# KK8504 Nextera DNA Library Prep Kit Illumina Cat# FC-121-1030 Deposited data Raw and processed sequencing data for ChIP-seq This paper GEO: GSE215161 Raw and processed sequencing data for ATAC-seq This paper GEO: GSE215160 Raw and processed sequencing data for GRO-seq This paper GEO: GSE215162 AR ChIP-seq Malinen et al.39 GEO: GSE83860 H3K27ac ChIP-seq Hazelett et al.40 GEO: GSE51621 Experimental models: Cell lines Human: LNCaP ATCC Cat# CRL-1740 Human: U2OS ATCC Cat# HTB-96 Human: SH-SY5Y ATCC Cat# CRL-2266 Human: HEK293T ATCC Cat# CRL-3216 Human: U2OS 2-6-3 Janicki et al.51 N/A Human: LNCaP-pInducer20-AR stable lines for wildtype and mutants This paper N/A Human: LNCaP-TetR stable line This paper N/A Human: LNCaP-TetR-BioID-AR stable lines for wt, DIDR, and pQ69 This paper N/A Human: LNCaP-BirA-TetR stable line This paper N/A (Continued on next page) e2 Molecular Cell 83, 3438–3456.e1–e12, October 5, 2023 .. REAGENT or RESOURCE SOURCE IDENTIFIER Human: LNCaP-BirA-TetR-BLRP-AR stable lines for wt, DIDR, and pQ69 This paper N/A Oligonucleotides Primers or oligos for qPCR and GRO-seq see method details This paper N/A Recombinant DNA shAR Sigma-Aldrich TRCN0000003718 shControl Sigma-Aldrich SHC002 shControl Sigma-Aldrich SHC202 pET-His-GFP-gw This paper N/A pET-His-GFP-ARNTD for wildtype and mutants This paper N/A pEGFP-C3-gw This Plasmid Preparation:Article Title: Hormone-induced enhancer assembly requires an optimal level of hormone receptor multivalent interactions. Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER CircLigase ssDNA Ligase Epicentre Cat# CL4111K Ape1 New England BioLabs Cat# M0282S Phusion High-Fidelity DNA Polymerase New England BioLabs Cat# M0530L Gibson Assembly Master Mix New England BioLabs Cat# E2611L Proteinase K, recombinant, PCR Grade Roche Cat# 3115879001 RNase Sigma-Aldrich Cat# R6513 TRIzol LS Reagent Life Technologies Cat# 10296028 T4 PNK New England BioLabs Cat# M0201S DNase I Life Technologies Cat# AM2222 Benzonase Nuclease EMD Millipore Cat# 70746 MyOne Streptavidin T1 Dynabeads Life Technologies Cat# 65602 Nanolink Streptavidin Magnetic beads Solulink Cat# M-1002-010 AcTEV Protease Life Technologies Cat# 12575015 PEG8000 Sigma-Aldrich Cat# 89510 BioRad protein assay BioRAD Cat# 5000001 Critical commercial assays pCR 8/GW/TOPO TA Cloning Kit Life Technologies Cat# K250020 Gateway LR Clonase II Enzyme mix Life Technologies Cat# 11791100 Dual-Glo Luciferase Assay System Promega Cat# E2940 Antifade mountant with DAPI Life Technologies Cat# P36931 RNeasy Mini Kit Qiagen Cat# 74106 iScript Select cDNA Synthesis Kit BioRAD Cat# 1708897 SsoAdvanced Universal SYBR Green Supermix BioRAD Cat# 1725275 QIAquick spin columns Qiagen Cat# 28115 KAPA Hyper Prep kit Kapa Biosystems Cat# KK8504 Nextera DNA Library Prep Kit Illumina Cat# FC-121-1030 Deposited data Raw and processed sequencing data for ChIP-seq This paper GEO: GSE215161 Raw and processed sequencing data for ATAC-seq This paper GEO: GSE215160 Raw and processed sequencing data for GRO-seq This paper GEO: GSE215162 AR ChIP-seq Malinen et al.39 GEO: GSE83860 H3K27ac ChIP-seq Hazelett et al.40 GEO: GSE51621 Experimental models: Cell lines Human: LNCaP ATCC Cat# CRL-1740 Human: U2OS ATCC Cat# HTB-96 Human: SH-SY5Y ATCC Cat# CRL-2266 Human: HEK293T ATCC Cat# CRL-3216 Human: U2OS 2-6-3 Janicki et al.51 N/A Human: LNCaP-pInducer20-AR stable lines for wildtype and mutants This paper N/A Human: LNCaP-TetR stable line This paper N/A Human: LNCaP-TetR-BioID-AR stable lines for wt, DIDR, and pQ69 This paper N/A Human: LNCaP-BirA-TetR stable line This paper N/A (Continued on next page) e2 Molecular Cell 83, 3438–3456.e1–e12, October 5, 2023 .. REAGENT or RESOURCE SOURCE IDENTIFIER Human: LNCaP-BirA-TetR-BLRP-AR stable lines for wt, DIDR, and pQ69 This paper N/A Oligonucleotides Primers or oligos for qPCR and GRO-seq see method details This paper N/A Recombinant DNA shAR Sigma-Aldrich TRCN0000003718 shControl Sigma-Aldrich SHC002 shControl Sigma-Aldrich SHC202 pET-His-GFP-gw This paper N/A pET-His-GFP-ARNTD for wildtype and mutants This paper N/A pEGFP-C3-gw This Article Title: Sequence-directed concentration of G protein-coupled receptors in COPII vesicles Article Snippet: GPCR plasmids in PRESTO-Tango kits were from Addgene (#1000000068) as described. .. The 3HA-tagged human AT2R and its ExE-AxA mutant in pcDNA3.1 vectors, GFP-tagged Sec24 in Article Title: Regulation of interferon alpha production by the MAGUK-family protein CASK under H5N1 infection Article Snippet: RNA FISH confocal images were analyzed for nucleus/cytoplasmic ratio using MetaMorph software. .. CASK coding sequence were constructed into Article Title: RTP801 mediates transneuronal toxicity in culture via extracellular vesicles Article Snippet: .. HEK293 cells were transfected with Article Title: Development of peptide‐18‐targeted nanoliposome formulations with an alternative stealth coating copolymer for targeting breast cancer <scp>AU565</scp> cell line Article Snippet: Cholesterol and L-α-Phosphatidylcholine were purchased from Sigma. .. PEtOx-DOPE and P18-PEtOx-DOPE were synthesized at Tübitak MAM Laboratories, Turkey. Article Title: PERK recruits E-Syt1 at ER–mitochondria contacts for mitochondrial lipid transport and respiration Article Snippet: Cells were routinely checked for mycoplasma contaminations using the Plasmotest kit (Invivogen) according to the manufacturer’s instructions. .. PERK.K622A.9E10.pCDNA myc tagged (21815; Addgene plasmid), PERK.WT.9E10.pCDNA myc tagged (21814; Addgene plasmid), eGFP-E-Syt1 (66830; Addgene plasmid) Software:Article Title: Hormone-induced enhancer assembly requires an optimal level of hormone receptor multivalent interactions. Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER CircLigase ssDNA Ligase Epicentre Cat# CL4111K Ape1 New England BioLabs Cat# M0282S Phusion High-Fidelity DNA Polymerase New England BioLabs Cat# M0530L Gibson Assembly Master Mix New England BioLabs Cat# E2611L Proteinase K, recombinant, PCR Grade Roche Cat# 3115879001 RNase Sigma-Aldrich Cat# R6513 TRIzol LS Reagent Life Technologies Cat# 10296028 T4 PNK New England BioLabs Cat# M0201S DNase I Life Technologies Cat# AM2222 Benzonase Nuclease EMD Millipore Cat# 70746 MyOne Streptavidin T1 Dynabeads Life Technologies Cat# 65602 Nanolink Streptavidin Magnetic beads Solulink Cat# M-1002-010 AcTEV Protease Life Technologies Cat# 12575015 PEG8000 Sigma-Aldrich Cat# 89510 BioRad protein assay BioRAD Cat# 5000001 Critical commercial assays pCR 8/GW/TOPO TA Cloning Kit Life Technologies Cat# K250020 Gateway LR Clonase II Enzyme mix Life Technologies Cat# 11791100 Dual-Glo Luciferase Assay System Promega Cat# E2940 Antifade mountant with DAPI Life Technologies Cat# P36931 RNeasy Mini Kit Qiagen Cat# 74106 iScript Select cDNA Synthesis Kit BioRAD Cat# 1708897 SsoAdvanced Universal SYBR Green Supermix BioRAD Cat# 1725275 QIAquick spin columns Qiagen Cat# 28115 KAPA Hyper Prep kit Kapa Biosystems Cat# KK8504 Nextera DNA Library Prep Kit Illumina Cat# FC-121-1030 Deposited data Raw and processed sequencing data for ChIP-seq This paper GEO: GSE215161 Raw and processed sequencing data for ATAC-seq This paper GEO: GSE215160 Raw and processed sequencing data for GRO-seq This paper GEO: GSE215162 AR ChIP-seq Malinen et al.39 GEO: GSE83860 H3K27ac ChIP-seq Hazelett et al.40 GEO: GSE51621 Experimental models: Cell lines Human: LNCaP ATCC Cat# CRL-1740 Human: U2OS ATCC Cat# HTB-96 Human: SH-SY5Y ATCC Cat# CRL-2266 Human: HEK293T ATCC Cat# CRL-3216 Human: U2OS 2-6-3 Janicki et al.51 N/A Human: LNCaP-pInducer20-AR stable lines for wildtype and mutants This paper N/A Human: LNCaP-TetR stable line This paper N/A Human: LNCaP-TetR-BioID-AR stable lines for wt, DIDR, and pQ69 This paper N/A Human: LNCaP-BirA-TetR stable line This paper N/A (Continued on next page) e2 Molecular Cell 83, 3438–3456.e1–e12, October 5, 2023 .. REAGENT or RESOURCE SOURCE IDENTIFIER Human: LNCaP-BirA-TetR-BLRP-AR stable lines for wt, DIDR, and pQ69 This paper N/A Oligonucleotides Primers or oligos for qPCR and GRO-seq see method details This paper N/A Recombinant DNA shAR Sigma-Aldrich TRCN0000003718 shControl Sigma-Aldrich SHC002 shControl Sigma-Aldrich SHC202 pET-His-GFP-gw This paper N/A pET-His-GFP-ARNTD for wildtype and mutants This paper N/A pEGFP-C3-gw This Protein Binding:Article Title: Hormone-induced enhancer assembly requires an optimal level of hormone receptor multivalent interactions. Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER CircLigase ssDNA Ligase Epicentre Cat# CL4111K Ape1 New England BioLabs Cat# M0282S Phusion High-Fidelity DNA Polymerase New England BioLabs Cat# M0530L Gibson Assembly Master Mix New England BioLabs Cat# E2611L Proteinase K, recombinant, PCR Grade Roche Cat# 3115879001 RNase Sigma-Aldrich Cat# R6513 TRIzol LS Reagent Life Technologies Cat# 10296028 T4 PNK New England BioLabs Cat# M0201S DNase I Life Technologies Cat# AM2222 Benzonase Nuclease EMD Millipore Cat# 70746 MyOne Streptavidin T1 Dynabeads Life Technologies Cat# 65602 Nanolink Streptavidin Magnetic beads Solulink Cat# M-1002-010 AcTEV Protease Life Technologies Cat# 12575015 PEG8000 Sigma-Aldrich Cat# 89510 BioRad protein assay BioRAD Cat# 5000001 Critical commercial assays pCR 8/GW/TOPO TA Cloning Kit Life Technologies Cat# K250020 Gateway LR Clonase II Enzyme mix Life Technologies Cat# 11791100 Dual-Glo Luciferase Assay System Promega Cat# E2940 Antifade mountant with DAPI Life Technologies Cat# P36931 RNeasy Mini Kit Qiagen Cat# 74106 iScript Select cDNA Synthesis Kit BioRAD Cat# 1708897 SsoAdvanced Universal SYBR Green Supermix BioRAD Cat# 1725275 QIAquick spin columns Qiagen Cat# 28115 KAPA Hyper Prep kit Kapa Biosystems Cat# KK8504 Nextera DNA Library Prep Kit Illumina Cat# FC-121-1030 Deposited data Raw and processed sequencing data for ChIP-seq This paper GEO: GSE215161 Raw and processed sequencing data for ATAC-seq This paper GEO: GSE215160 Raw and processed sequencing data for GRO-seq This paper GEO: GSE215162 AR ChIP-seq Malinen et al.39 GEO: GSE83860 H3K27ac ChIP-seq Hazelett et al.40 GEO: GSE51621 Experimental models: Cell lines Human: LNCaP ATCC Cat# CRL-1740 Human: U2OS ATCC Cat# HTB-96 Human: SH-SY5Y ATCC Cat# CRL-2266 Human: HEK293T ATCC Cat# CRL-3216 Human: U2OS 2-6-3 Janicki et al.51 N/A Human: LNCaP-pInducer20-AR stable lines for wildtype and mutants This paper N/A Human: LNCaP-TetR stable line This paper N/A Human: LNCaP-TetR-BioID-AR stable lines for wt, DIDR, and pQ69 This paper N/A Human: LNCaP-BirA-TetR stable line This paper N/A (Continued on next page) e2 Molecular Cell 83, 3438–3456.e1–e12, October 5, 2023 .. REAGENT or RESOURCE SOURCE IDENTIFIER Human: LNCaP-BirA-TetR-BLRP-AR stable lines for wt, DIDR, and pQ69 This paper N/A Oligonucleotides Primers or oligos for qPCR and GRO-seq see method details This paper N/A Recombinant DNA shAR Sigma-Aldrich TRCN0000003718 shControl Sigma-Aldrich SHC002 shControl Sigma-Aldrich SHC202 pET-His-GFP-gw This paper N/A pET-His-GFP-ARNTD for wildtype and mutants This paper N/A pEGFP-C3-gw This Single-particle Tracking:Article Title: Hormone-induced enhancer assembly requires an optimal level of hormone receptor multivalent interactions. Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER CircLigase ssDNA Ligase Epicentre Cat# CL4111K Ape1 New England BioLabs Cat# M0282S Phusion High-Fidelity DNA Polymerase New England BioLabs Cat# M0530L Gibson Assembly Master Mix New England BioLabs Cat# E2611L Proteinase K, recombinant, PCR Grade Roche Cat# 3115879001 RNase Sigma-Aldrich Cat# R6513 TRIzol LS Reagent Life Technologies Cat# 10296028 T4 PNK New England BioLabs Cat# M0201S DNase I Life Technologies Cat# AM2222 Benzonase Nuclease EMD Millipore Cat# 70746 MyOne Streptavidin T1 Dynabeads Life Technologies Cat# 65602 Nanolink Streptavidin Magnetic beads Solulink Cat# M-1002-010 AcTEV Protease Life Technologies Cat# 12575015 PEG8000 Sigma-Aldrich Cat# 89510 BioRad protein assay BioRAD Cat# 5000001 Critical commercial assays pCR 8/GW/TOPO TA Cloning Kit Life Technologies Cat# K250020 Gateway LR Clonase II Enzyme mix Life Technologies Cat# 11791100 Dual-Glo Luciferase Assay System Promega Cat# E2940 Antifade mountant with DAPI Life Technologies Cat# P36931 RNeasy Mini Kit Qiagen Cat# 74106 iScript Select cDNA Synthesis Kit BioRAD Cat# 1708897 SsoAdvanced Universal SYBR Green Supermix BioRAD Cat# 1725275 QIAquick spin columns Qiagen Cat# 28115 KAPA Hyper Prep kit Kapa Biosystems Cat# KK8504 Nextera DNA Library Prep Kit Illumina Cat# FC-121-1030 Deposited data Raw and processed sequencing data for ChIP-seq This paper GEO: GSE215161 Raw and processed sequencing data for ATAC-seq This paper GEO: GSE215160 Raw and processed sequencing data for GRO-seq This paper GEO: GSE215162 AR ChIP-seq Malinen et al.39 GEO: GSE83860 H3K27ac ChIP-seq Hazelett et al.40 GEO: GSE51621 Experimental models: Cell lines Human: LNCaP ATCC Cat# CRL-1740 Human: U2OS ATCC Cat# HTB-96 Human: SH-SY5Y ATCC Cat# CRL-2266 Human: HEK293T ATCC Cat# CRL-3216 Human: U2OS 2-6-3 Janicki et al.51 N/A Human: LNCaP-pInducer20-AR stable lines for wildtype and mutants This paper N/A Human: LNCaP-TetR stable line This paper N/A Human: LNCaP-TetR-BioID-AR stable lines for wt, DIDR, and pQ69 This paper N/A Human: LNCaP-BirA-TetR stable line This paper N/A (Continued on next page) e2 Molecular Cell 83, 3438–3456.e1–e12, October 5, 2023 .. REAGENT or RESOURCE SOURCE IDENTIFIER Human: LNCaP-BirA-TetR-BLRP-AR stable lines for wt, DIDR, and pQ69 This paper N/A Oligonucleotides Primers or oligos for qPCR and GRO-seq see method details This paper N/A Recombinant DNA shAR Sigma-Aldrich TRCN0000003718 shControl Sigma-Aldrich SHC002 shControl Sigma-Aldrich SHC202 pET-His-GFP-gw This paper N/A pET-His-GFP-ARNTD for wildtype and mutants This paper N/A pEGFP-C3-gw This Mutagenesis:Article Title: Sequence-directed concentration of G protein-coupled receptors in COPII vesicles Article Snippet: GPCR plasmids in PRESTO-Tango kits were from Addgene (#1000000068) as described. .. The 3HA-tagged human AT2R and its ExE-AxA mutant in pcDNA3.1 vectors, GFP-tagged Sec24 in Generated:Article Title: Sequence-directed concentration of G protein-coupled receptors in COPII vesicles Article Snippet: GPCR plasmids in PRESTO-Tango kits were from Addgene (#1000000068) as described. .. The 3HA-tagged human AT2R and its ExE-AxA mutant in pcDNA3.1 vectors, GFP-tagged Sec24 in Amplification:Article Title: Sequence-directed concentration of G protein-coupled receptors in COPII vesicles Article Snippet: GPCR plasmids in PRESTO-Tango kits were from Addgene (#1000000068) as described. .. The 3HA-tagged human AT2R and its ExE-AxA mutant in pcDNA3.1 vectors, GFP-tagged Sec24 in Polymerase Chain Reaction:Article Title: Sequence-directed concentration of G protein-coupled receptors in COPII vesicles Article Snippet: GPCR plasmids in PRESTO-Tango kits were from Addgene (#1000000068) as described. .. The 3HA-tagged human AT2R and its ExE-AxA mutant in pcDNA3.1 vectors, GFP-tagged Sec24 in Sequencing:Article Title: Regulation of interferon alpha production by the MAGUK-family protein CASK under H5N1 infection Article Snippet: RNA FISH confocal images were analyzed for nucleus/cytoplasmic ratio using MetaMorph software. .. CASK coding sequence were constructed into Construct:Article Title: Regulation of interferon alpha production by the MAGUK-family protein CASK under H5N1 infection Article Snippet: RNA FISH confocal images were analyzed for nucleus/cytoplasmic ratio using MetaMorph software. .. CASK coding sequence were constructed into Transfection:Article Title: RTP801 mediates transneuronal toxicity in culture via extracellular vesicles Article Snippet: .. HEK293 cells were transfected with Synthesized:Article Title: Development of peptide‐18‐targeted nanoliposome formulations with an alternative stealth coating copolymer for targeting breast cancer <scp>AU565</scp> cell line Article Snippet: Cholesterol and L-α-Phosphatidylcholine were purchased from Sigma. .. PEtOx-DOPE and P18-PEtOx-DOPE were synthesized at Tübitak MAM Laboratories, Turkey. other:Article Title: Spastin locally amplifies microtubule dynamics to pattern the axon for presynaptic cargo delivery. Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER BDNF PeproTech Cat# 450-02 NT-3 PeproTech Cat# 450-03 GDNF PeproTech Cat# 450-10 Lipofectamine Stem Transfection Reagent Thermo Fisher Cat# STEM00003 Halt Protease and Phosphatase Inhibitor Cocktail Thermo Fisher Cat# 78442 ViralBoost Alstem Cat# VB100 Lentivirus Precipitation Solution Alstem Cat# VC100 Puromycin Takara Cat# 631305 Hibernate A Medium Brain Bits Cat# HA100 SNAP-Cell 647-SiR New England BioLabs Cat# S9102S SynaptoRed C2 Biotium Cat# 70027 D-AP5 Thomas Scientific Cat# 14539–5 ADVASEP-7 Biotium Cat# 70029 CNQX Thomas Scientific Cat# 14618–5 EveryBlot Blocking Buffer BIO-RAD Cat# 12010020 LI-COR Revert 700 Total Protein Stain LI-COR Cat# 926–11021 Critical commercial assays BCA Protein Assay Kit Thermo Fisher Cat# 23225 Plasmid Maxi Kit QIAGEN Cat# 12163 Experimental models: Cell lines Human: NGN2 iPSCs M. Ward (National Institutes of Health)31 N/A Human: HEK293T ATCC Cat# CRL-3216; RRID:CVCL_0063 Experimental models: Organisms/strains Rat: primary rat astrocytes/glia isolated from postnatal day 1 rat brains (Sprague Dawley) Charles River Laboratories RRID: RGD_737891 Oligonucleotides Spastin-specific sgRNA guide: GACCGACGGGAACCAAGCGA Horlbeck et al.39 N/A Non-targeting sgRNA guide: GTGCCAGCTTGTGGTGTCGT Horlbeck et al.39 N/A pCRISPRia-vs2 sequencing forward oligo: ggcttggatttctataacttcg This paper N/A pCRISPRia-vs2 sequencing reverse oligo: ctactgcacttatatacggttc This paper N/A Recombinant DNA Plasmid: |