taq dna polymerase (Valiant Co Ltd)
94
Structured Review
Valiant Co Ltd
taq dna polymerase
Taq Dna Polymerase, supplied by Valiant Co Ltd, used in various techniques. Bioz Stars score: 94/100, based on 899 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pcr+buffer/Taq+DNA+polymerase/pmc00549327-118-37-40
Average 94 stars, based on 899 article reviews
Taq Dna Polymerase, supplied by Valiant Co Ltd, used in various techniques. Bioz Stars score: 94/100, based on 899 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pcr+buffer/Taq+DNA+polymerase/pmc00549327-118-37-40
Average 94 stars, based on 899 article reviews
taq dna polymerase - by Bioz Stars,
2026-10
94/100 stars
Images
Related Articles
Modification:Article Title: Genetic diversity and evolution of endogenous pararetroviruses across Solanaceae : How farming systems drive dynamic tomato EPRVS changes under salt stress Article Snippet: 500ng of DNA was treated with sodium bisulfite ( ) using the Methylation Kit (Zymo, USA). .. Modified DNA was amplified by PCR using IGR1/2primers and Amplification:Article Title: Genetic diversity and evolution of endogenous pararetroviruses across Solanaceae : How farming systems drive dynamic tomato EPRVS changes under salt stress Article Snippet: 500ng of DNA was treated with sodium bisulfite ( ) using the Methylation Kit (Zymo, USA). .. Modified DNA was amplified by PCR using IGR1/2primers and Article Title: Biombalance TM : A Specific Oligomeric Procyanidin-Rich Grape Seed Extract as Multifunctional Ingredient Integrating Antibacterial, Antioxidant, and Anti-Inflammatory Activities with Beneficial Gut–Brain Axis Modulation Article Snippet: Approximately 100 mg of stool was homogenised in Tris-EDTA buffer (0.1 mM Tris, pH 8; 1 M EDTA; 1 mL buffer per 200 mg faeces), and lysozyme (300 mg/mL, Sigma, St. Louis, MO, USA) was added at a 1:100 ratio, followed by incubation at 37 °C for 1 h. DNA was then extracted from 300 μL of the mixture using the NucleoSpin ® Soil Kit (Macherey-Nagel, Düren, Germany) according to the manufacturer’s instructions, and quantified with a NanoDrop One spectrophotometer (Thermo Fisher Scientific, Wilmington, DE, USA) [ ]. .. The V3–V4 region of the 16S rRNA gene was amplified using primers 338F and 806R, with PCR performed using the Polymerase Chain Reaction:Article Title: Genetic diversity and evolution of endogenous pararetroviruses across Solanaceae : How farming systems drive dynamic tomato EPRVS changes under salt stress Article Snippet: 500ng of DNA was treated with sodium bisulfite ( ) using the Methylation Kit (Zymo, USA). .. Modified DNA was amplified by PCR using IGR1/2primers and Article Title: Repeated loss of function at HD mating-type genes and of recombination in anther-smut fungi. Article Snippet: .. Boiling PCR was performed in a final volume of 30μL containing 3μL of fungal suspension, 15μL of 2X Buffer (containing a mix of dNTPs 5mM in addition of bovine serum albumin (BSA) 20mg/ml, W1 detergent 1%, home made 10X Buffer (Ammonium Sulfat 1M, Tris HCl 1M, MgCl26H2O 1M and sterile deionized H2O), 1.2μL of each forward and reverse primers (10μM), 0.15μL of Article Title: Biombalance™, an Oligomeric Procyanidins-Enriched Grape Seed Extract, Prevents Inflammation and Microbiota Dysbiosis in a Mice Colitis Model Article Snippet: For Illumina microbiota sequencing, the 16S rRNA gene’s V3–V4 region was amplified using forward primer 338F (5′-ACTCCTACGGGAGGCAGCA-3′) and reverse primer 806R (5′-GGACTACHVGGGTWTCTAAT-3′), to prepare Illumina libraries. .. The PCR mixture, containing 10 ng of DNA, 10 μM of each primer and PCR-grade water in a final volume of 50 μL, was prepared using the Article Title: Genetic diversity and evolution of endogenous pararetroviruses across Solanaceae : How farming systems drive dynamic tomato EPRVS changes under salt stress Article Snippet: .. PCR reaction was performed in a final volume of 25 μl containing 100 ng of each primer, 5 μl of 10X buffer, 1 μl of dNTP (10 mM each), 1.5 μl MgCl 2 (1.5 mM), 1U of Article Title: Structure, dynamics, and ecological functions of rhizosphere fungal communities associated with maize (Zea mays L.) across contrasting rainfed agroecosystems Article Snippet: The internal transcribed spacers (ITS region including the 5.8S), was amplified with illumina Miseq using ITS1F (CTTGGTCATTTAGAGGAAGTAA) and ITS4 (TCCTCCGCTTATTGATATGC) primers under the conditions described by Banerjee et al (2024). .. The reactions were conducted in a final volume of 20 μl, comprising 2 μl of 10× PCR buffer (10 mM Tris–HCl, pH 9.5, 50 mM KCl, 1.5 mM MgCl2, 0.1 % Triton X-100, 0.2 mg/ml bovine serum albumin) (Q-BIOgene, France), 200 mM of dNTPs, 500 nM of each primer, 0.8 U of Article Title: Biombalance TM : A Specific Oligomeric Procyanidin-Rich Grape Seed Extract as Multifunctional Ingredient Integrating Antibacterial, Antioxidant, and Anti-Inflammatory Activities with Beneficial Gut–Brain Axis Modulation Article Snippet: Approximately 100 mg of stool was homogenised in Tris-EDTA buffer (0.1 mM Tris, pH 8; 1 M EDTA; 1 mL buffer per 200 mg faeces), and lysozyme (300 mg/mL, Sigma, St. Louis, MO, USA) was added at a 1:100 ratio, followed by incubation at 37 °C for 1 h. DNA was then extracted from 300 μL of the mixture using the NucleoSpin ® Soil Kit (Macherey-Nagel, Düren, Germany) according to the manufacturer’s instructions, and quantified with a NanoDrop One spectrophotometer (Thermo Fisher Scientific, Wilmington, DE, USA) [ ]. .. The V3–V4 region of the 16S rRNA gene was amplified using primers 338F and 806R, with PCR performed using the Article Title: Repeated loss of function at HD mating-type genes and of recombination in anther-smut fungi Article Snippet: .. Boiling PCR was performed in a final volume of 30 μL containing 3 μL of fungal suspension, 15 μL of 2X Buffer (containing a mix of dNTPs 5 mM in addition of bovine serum albumin (BSA) 20 mg/ml, W1 detergent 1%, home made 10X Buffer (Ammonium Sulfat 1 M, Tris HCl 1 M, MgCl 2 6H 2 O 1 M and sterile deionized H 2 O), 1.2 μL of each forward and reverse primers (10 μM), 0.15 μL of Article Title: Biombalance™, an Oligomeric Procyanidins-Enriched Grape Seed Extract, Prevents Inflammation and Microbiota Dysbiosis in a Mice Colitis Model. Article Snippet: For Illumina microbiota sequencing, the 16S rRNA gene’s V3–V4 region was amplified using forward primer 338F (5′-ACTCCTACGGGAGGCAGCA3′) and reverse primer 806R (5′-GGACTACHVGGGTWTCTAAT-3′), to prepare Illumina libraries. .. The PCR mixture, containing 10 ng of DNA, 10 μM of each primer and PCR-grade water in a final volume of 50 μL, was prepared using the Suspension:Article Title: Repeated loss of function at HD mating-type genes and of recombination in anther-smut fungi. Article Snippet: .. Boiling PCR was performed in a final volume of 30μL containing 3μL of fungal suspension, 15μL of 2X Buffer (containing a mix of dNTPs 5mM in addition of bovine serum albumin (BSA) 20mg/ml, W1 detergent 1%, home made 10X Buffer (Ammonium Sulfat 1M, Tris HCl 1M, MgCl26H2O 1M and sterile deionized H2O), 1.2μL of each forward and reverse primers (10μM), 0.15μL of Article Title: Repeated loss of function at HD mating-type genes and of recombination in anther-smut fungi Article Snippet: .. Boiling PCR was performed in a final volume of 30 μL containing 3 μL of fungal suspension, 15 μL of 2X Buffer (containing a mix of dNTPs 5 mM in addition of bovine serum albumin (BSA) 20 mg/ml, W1 detergent 1%, home made 10X Buffer (Ammonium Sulfat 1 M, Tris HCl 1 M, MgCl 2 6H 2 O 1 M and sterile deionized H 2 O), 1.2 μL of each forward and reverse primers (10 μM), 0.15 μL of Sterility:Article Title: Repeated loss of function at HD mating-type genes and of recombination in anther-smut fungi. Article Snippet: .. Boiling PCR was performed in a final volume of 30μL containing 3μL of fungal suspension, 15μL of 2X Buffer (containing a mix of dNTPs 5mM in addition of bovine serum albumin (BSA) 20mg/ml, W1 detergent 1%, home made 10X Buffer (Ammonium Sulfat 1M, Tris HCl 1M, MgCl26H2O 1M and sterile deionized H2O), 1.2μL of each forward and reverse primers (10μM), 0.15μL of Article Title: Genetic diversity and evolution of endogenous pararetroviruses across Solanaceae : How farming systems drive dynamic tomato EPRVS changes under salt stress Article Snippet: .. PCR reaction was performed in a final volume of 25 μl containing 100 ng of each primer, 5 μl of 10X buffer, 1 μl of dNTP (10 mM each), 1.5 μl MgCl 2 (1.5 mM), 1U of Article Title: Repeated loss of function at HD mating-type genes and of recombination in anther-smut fungi Article Snippet: .. Boiling PCR was performed in a final volume of 30 μL containing 3 μL of fungal suspension, 15 μL of 2X Buffer (containing a mix of dNTPs 5 mM in addition of bovine serum albumin (BSA) 20 mg/ml, W1 detergent 1%, home made 10X Buffer (Ammonium Sulfat 1 M, Tris HCl 1 M, MgCl 2 6H 2 O 1 M and sterile deionized H 2 O), 1.2 μL of each forward and reverse primers (10 μM), 0.15 μL of |