Review




Structured Review

Promega pgl2-basic vector (firefly luciferase
Pgl2 Basic Vector (Firefly Luciferase, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pcat+3+basic+vector/pgl3+basic/us07230091-259-5-10
Average 90 stars, based on 1 article reviews
pgl2-basic vector (firefly luciferase - by Bioz Stars, 2026-09
90/100 stars

Images

Related Articles

Luciferase:

Article Title: Proline hydroxylation of CREB-regulated transcriptional coactivator 2 controls hepatic glucose metabolism
Article Snippet: .. Dual luciferase activity assays—HEK293T cells were co-transfected with 0.5 μg of empty vector or plasmids encoding CRTC2 variants as indicated, along with 0.5 μg luciferase reporter plasmids and 80 ng of Renilla luciferase plasmid pRL-SV40 (Promega) as an internal control in 12 well plates. ..

Activity Assay:

Article Title: Proline hydroxylation of CREB-regulated transcriptional coactivator 2 controls hepatic glucose metabolism
Article Snippet: .. Dual luciferase activity assays—HEK293T cells were co-transfected with 0.5 μg of empty vector or plasmids encoding CRTC2 variants as indicated, along with 0.5 μg luciferase reporter plasmids and 80 ng of Renilla luciferase plasmid pRL-SV40 (Promega) as an internal control in 12 well plates. ..

Plasmid Preparation:

Article Title: Proline hydroxylation of CREB-regulated transcriptional coactivator 2 controls hepatic glucose metabolism
Article Snippet: .. Dual luciferase activity assays—HEK293T cells were co-transfected with 0.5 μg of empty vector or plasmids encoding CRTC2 variants as indicated, along with 0.5 μg luciferase reporter plasmids and 80 ng of Renilla luciferase plasmid pRL-SV40 (Promega) as an internal control in 12 well plates. ..

Control:

Article Title: Proline hydroxylation of CREB-regulated transcriptional coactivator 2 controls hepatic glucose metabolism
Article Snippet: .. Dual luciferase activity assays—HEK293T cells were co-transfected with 0.5 μg of empty vector or plasmids encoding CRTC2 variants as indicated, along with 0.5 μg luciferase reporter plasmids and 80 ng of Renilla luciferase plasmid pRL-SV40 (Promega) as an internal control in 12 well plates. ..

other:

Article Title:
Article Snippet: The plasmids for enhancer activity analysis were generated from pNL1.1 (Promega, N1001) (Supplemental Fig. S9B), and the plasmid served as the internal reference was generated from pGL4.10 (Promega, E6651) by insert a promoter of BmNPV ie-1 before luc2 (Supplemental Fig. S9A), which enables stable expression of the reference luciferase in BmN cells.

Article Title: Egr-1 promotes the proliferation and migration of vascular smooth muscle cells by transcriptionally activating Egr-2 in arteriovenous fistulas
Article Snippet: Rat EGR1 promoter (~1.3 Kb; PCR-amplified from rat VSMCs) cloned into pGL3-basic luciferase rep plasmid (Promega Corporation) to form EGR1 luciferase reporters.

Article Title: Folie 1
Article Snippet: Vendor Bulk anti-TGFB1,2,3 In Vivo 1D11.1 Human, Mouse, Bovine, Chicken Mouse IgG1 10μg/gBW AB_292143 6 Ichorbio Mouse IgG1 Isotype Control HKSP - Mouse IgG1 10μg/gBW AB_292138 2 Ichorbio Anti-mouse CD8 in vivo YTS169 Mouse Rat IgG2b 12,5μg/g BW AB_292144 5 Ichorbio Anti-mouse CD4 in vivo GK1.5 Mouse Rat IgG2b 12,5μg/g BW AB_292144 4 Ichorbio Rat IgG2b Isotype Control in vivo 1-2 - Rat IgG2b 12,5μg/g BW AB_292137 8 Ichorbio Supplementary Table S3: Primers used for RT-qPCR Target gene Direction Sequence (5’3’) GC [%] Length TM hu-TGF-β1 Fwd ATTCCTGGCGATACCTCAGC 55 20 59,4 hu-TGF-β1 Rev CGGTAGTGAACCCGTTGATG 55 20 59,4 hu-GAPDH Fwd GTCAGTGGTGGACCTGACCT 60 20 61,4 hu-GAPDH Rev TGAGCTTGACAAAGTGGTCG 50 20 57,3 Supplementary Table S4: Expression vectors Name Backbone Insert (cDNA) Selection marker RRID/parentage pMIG pMSCV empty IRES-GFP RRID:Addgene_ 9044 pMIG-CALRWT pMSCV Human CALRWT IRES-GFP Provided by Ann Mullally pMIG-CALRins5 pMSCV Human CALRins5 IRES-GFP Provided by Ann Mullally 9 pMIG-CALRdel52 pMSCV Human CALRdel52 IRES-GFP Provided by Ann Mullally pMSCV-MPL pMSCV Human MPL PKG- hygromycin resistance gene Provided by Ann Mullally pMIG-JAK2WT pMSCV Human JAK2WT IRES-GFP Provided by Justus Duyster pMIG-JAK2V617F pMSCV Human JAK2V617F IRES-GFP Provided by Justus Duyster pMSCV-EpoR pMSCV Human EPOR neomycin resistance gene In-house pMIG-STAT3WT pMX Human STAT3WT IRES-GFP In-house pMIGSTAT3V640F pMX Human STAT3V640F IRES-GFP In-house pGL4.73[ hRluc/SV40] pGL4 SV40 early enhancer, rRluc renilla luciferase Promega (E691A) pGL3-TGFb1 pGL3 Human TGFb1 promoter luciferase RRID:Addgene_ 101762 References: 1.

Article Title:
Article Snippet: RIG-I ubiquitination assays Purification of GST-RIG-I 2CARD from mammalian cells was done as previously described (8, 11). pEBGRIG-I 2CARD (4 μg) and pcDNA4 carrying indicated gene or pCAGGS-NS1 (Influenza A virus, 10 μg) (7) and pGL4.45[luc2P/ISRE/Hygro] (Promega) (100 ng) were transfected with Mirus TransIT-LT1 into 5x106 HEK293T cells in a 10 cm2 dish in DMEM high glucose with 5% FBS per manufacturer guidelines.

Article Title:
Article Snippet: The constructed pGL3-ELO11 reporter plasmid was cotransfected 211 with the pac-dsxM or pac-dsxF expression plasmid by FuGENE HD Transfection Reagent 212 (Promega) into Sf9 cells.

Article Title:
Article Snippet: A total of 24 h after gene KD in 6-well culture plates, 2 μg TOPFlash and 0.5 μg pRL (Promega, E2261) plasmids were transfected into SH-SY5Y cells (7.5×105) using FuGENE HD Transfection Reagent (Promega).

Article Title:
Article Snippet: A total of 2 μg of DKK1 promoter and 0.5 μg of pRL (Promega, E2261) plasmids were transfected into SH-SY5Y cells (7.5×105) using FuGENE HD Transfection Reagent (Promega) in a 6-well culture plate.



Similar Products

98
New England Biolabs pcat 3 basic vector
Pcat 3 Basic Vector, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 98/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pcat+3+basic+vector/BglII/pmc03889558-102-18-28
Average 98 stars, based on 1 article reviews
pcat 3 basic vector - by Bioz Stars, 2026-09
98/100 stars
  Buy from Supplier

90
Promega pcat ® 3-basic vector
Pcat ® 3 Basic Vector, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pcat+3+basic+vector/pcat+basic+plasmid/pmc02830064-55-30-34
Average 90 stars, based on 1 article reviews
pcat ® 3-basic vector - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

90
Promega pcat 3-basic vector
Transcriptional activity of DHS-S1. (A) Structure and activity of constructs containing DHS-S1 cloned upstream of the CAT gene. The whole DHS-S1 was excised as an SmaI-SmaI fragment (nt 18 to 353 of AAVS1) from plasmid pRVK and cloned in both orientations (indicated by the direction of the arrows) upstream of the intron and the CAT gene into the SmaI site of pCAT 3-basic vector (Promega). Black boxes represent the SV40 promoter. The promoterless plasmid is the pCAT 3-basic vector (Promega), and the control plasmid containing the SV40 promoter is the pCAT 3-promoter vector (Promega). Regions FR1 (nt 1313 to 1616 of AAVS1) and FR3 (nt 2633 to 2927 of AAVS1) were amplified by PCR with plasmid pRVK as a substrate and oligonucleotides carrying SmaI sites at either end. The resulting fragments were digested with restriction enzyme SmaI and cloned into the SmaI site of the pCAT 3-basic vector. Region FR2 (nt 2077 to 2371 of AAVS1) was excised from plasmid pRVK as a BamHI-flanked fragment, filled in by treatment with Klenow enzyme, and inserted into the SmaI site of pCAT 3-basic vector. Ten micrograms of each plasmid was transfected as described previously by calcium phosphate precipitation into 293 and HeLa cells (1). At 15 h posttransfection, the medium was changed: after an additional 24 h, cells were collected and CAT activity in cell extracts was measured by using the Quan-T-CAT assay system (Amersham, Pharmacia). CAT activities were normalized against the luciferase activity derived from a cotransfected cytomegalovirus-luciferase plasmid (1). Results are expressed as milliunits  of CAT enzyme present in 10 μg of cell extracts and as fold induction with respect to the promoterless pCAT 3-basic vector. The data are means ± standard deviations of two independent experiments in which two separate plasmid preparations were used. (B) Enhancer activity of DHS-S1 in 293 and HeLa cells. DHS-S1 was cloned in both orientations (represented by the direction of the arrows) into the pCAT 3-promoter vector either into the SmaI site upstream of the SV40 promoter or into the BamHI site downstream of the CAT gene. Similarly, FR1, FR2, and FR3 were cloned in one orientation either into the SmaI site or into the BamHI site of pCAT 3-vector. Transfections were performed, and CAT activities were measured and normalized as described in the legend to Fig. ​Fig.4A.4A. Results are expressed as milliunits of CAT enzyme in 10 μg of cell extracts; fold induction was calculated with respect to that of the pCAT 3-promoter vector. The data are means ± standard deviations of three independent experiments in which at least two different plasmid preparations were used.
Pcat 3 Basic Vector, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pcat+3+basic+vector/pcat+basic+plasmid/pmc00112291-92-47-50
Average 90 stars, based on 1 article reviews
pcat 3-basic vector - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

90
Promega pcat-3-basic vector
Transcriptional activity of DHS-S1. (A) Structure and activity of constructs containing DHS-S1 cloned upstream of the CAT gene. The whole DHS-S1 was excised as an SmaI-SmaI fragment (nt 18 to 353 of AAVS1) from plasmid pRVK and cloned in both orientations (indicated by the direction of the arrows) upstream of the intron and the CAT gene into the SmaI site of pCAT 3-basic vector (Promega). Black boxes represent the SV40 promoter. The promoterless plasmid is the pCAT 3-basic vector (Promega), and the control plasmid containing the SV40 promoter is the pCAT 3-promoter vector (Promega). Regions FR1 (nt 1313 to 1616 of AAVS1) and FR3 (nt 2633 to 2927 of AAVS1) were amplified by PCR with plasmid pRVK as a substrate and oligonucleotides carrying SmaI sites at either end. The resulting fragments were digested with restriction enzyme SmaI and cloned into the SmaI site of the pCAT 3-basic vector. Region FR2 (nt 2077 to 2371 of AAVS1) was excised from plasmid pRVK as a BamHI-flanked fragment, filled in by treatment with Klenow enzyme, and inserted into the SmaI site of pCAT 3-basic vector. Ten micrograms of each plasmid was transfected as described previously by calcium phosphate precipitation into 293 and HeLa cells (1). At 15 h posttransfection, the medium was changed: after an additional 24 h, cells were collected and CAT activity in cell extracts was measured by using the Quan-T-CAT assay system (Amersham, Pharmacia). CAT activities were normalized against the luciferase activity derived from a cotransfected cytomegalovirus-luciferase plasmid (1). Results are expressed as milliunits  of CAT enzyme present in 10 μg of cell extracts and as fold induction with respect to the promoterless pCAT 3-basic vector. The data are means ± standard deviations of two independent experiments in which two separate plasmid preparations were used. (B) Enhancer activity of DHS-S1 in 293 and HeLa cells. DHS-S1 was cloned in both orientations (represented by the direction of the arrows) into the pCAT 3-promoter vector either into the SmaI site upstream of the SV40 promoter or into the BamHI site downstream of the CAT gene. Similarly, FR1, FR2, and FR3 were cloned in one orientation either into the SmaI site or into the BamHI site of pCAT 3-vector. Transfections were performed, and CAT activities were measured and normalized as described in the legend to Fig. ​Fig.4A.4A. Results are expressed as milliunits of CAT enzyme in 10 μg of cell extracts; fold induction was calculated with respect to that of the pCAT 3-promoter vector. The data are means ± standard deviations of three independent experiments in which at least two different plasmid preparations were used.
Pcat 3 Basic Vector, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pcat+3+basic+vector/pcat+basic+plasmid/pm10025511-67-17-19
Average 90 stars, based on 1 article reviews
pcat-3-basic vector - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

90
Promega pcat 3–basic vector
Transcriptional activity of DHS-S1. (A) Structure and activity of constructs containing DHS-S1 cloned upstream of the CAT gene. The whole DHS-S1 was excised as an SmaI-SmaI fragment (nt 18 to 353 of AAVS1) from plasmid pRVK and cloned in both orientations (indicated by the direction of the arrows) upstream of the intron and the CAT gene into the SmaI site of pCAT 3-basic vector (Promega). Black boxes represent the SV40 promoter. The promoterless plasmid is the pCAT 3-basic vector (Promega), and the control plasmid containing the SV40 promoter is the pCAT 3-promoter vector (Promega). Regions FR1 (nt 1313 to 1616 of AAVS1) and FR3 (nt 2633 to 2927 of AAVS1) were amplified by PCR with plasmid pRVK as a substrate and oligonucleotides carrying SmaI sites at either end. The resulting fragments were digested with restriction enzyme SmaI and cloned into the SmaI site of the pCAT 3-basic vector. Region FR2 (nt 2077 to 2371 of AAVS1) was excised from plasmid pRVK as a BamHI-flanked fragment, filled in by treatment with Klenow enzyme, and inserted into the SmaI site of pCAT 3-basic vector. Ten micrograms of each plasmid was transfected as described previously by calcium phosphate precipitation into 293 and HeLa cells (1). At 15 h posttransfection, the medium was changed: after an additional 24 h, cells were collected and CAT activity in cell extracts was measured by using the Quan-T-CAT assay system (Amersham, Pharmacia). CAT activities were normalized against the luciferase activity derived from a cotransfected cytomegalovirus-luciferase plasmid (1). Results are expressed as milliunits  of CAT enzyme present in 10 μg of cell extracts and as fold induction with respect to the promoterless pCAT 3-basic vector. The data are means ± standard deviations of two independent experiments in which two separate plasmid preparations were used. (B) Enhancer activity of DHS-S1 in 293 and HeLa cells. DHS-S1 was cloned in both orientations (represented by the direction of the arrows) into the pCAT 3-promoter vector either into the SmaI site upstream of the SV40 promoter or into the BamHI site downstream of the CAT gene. Similarly, FR1, FR2, and FR3 were cloned in one orientation either into the SmaI site or into the BamHI site of pCAT 3-vector. Transfections were performed, and CAT activities were measured and normalized as described in the legend to Fig. ​Fig.4A.4A. Results are expressed as milliunits of CAT enzyme in 10 μg of cell extracts; fold induction was calculated with respect to that of the pCAT 3-promoter vector. The data are means ± standard deviations of three independent experiments in which at least two different plasmid preparations were used.
Pcat 3–Basic Vector, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pcat+3+basic+vector/pcat+basic+plasmid/pm09440701-57-22-25
Average 90 stars, based on 1 article reviews
pcat 3–basic vector - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

Image Search Results


Transcriptional activity of DHS-S1. (A) Structure and activity of constructs containing DHS-S1 cloned upstream of the CAT gene. The whole DHS-S1 was excised as an SmaI-SmaI fragment (nt 18 to 353 of AAVS1) from plasmid pRVK and cloned in both orientations (indicated by the direction of the arrows) upstream of the intron and the CAT gene into the SmaI site of pCAT 3-basic vector (Promega). Black boxes represent the SV40 promoter. The promoterless plasmid is the pCAT 3-basic vector (Promega), and the control plasmid containing the SV40 promoter is the pCAT 3-promoter vector (Promega). Regions FR1 (nt 1313 to 1616 of AAVS1) and FR3 (nt 2633 to 2927 of AAVS1) were amplified by PCR with plasmid pRVK as a substrate and oligonucleotides carrying SmaI sites at either end. The resulting fragments were digested with restriction enzyme SmaI and cloned into the SmaI site of the pCAT 3-basic vector. Region FR2 (nt 2077 to 2371 of AAVS1) was excised from plasmid pRVK as a BamHI-flanked fragment, filled in by treatment with Klenow enzyme, and inserted into the SmaI site of pCAT 3-basic vector. Ten micrograms of each plasmid was transfected as described previously by calcium phosphate precipitation into 293 and HeLa cells (1). At 15 h posttransfection, the medium was changed: after an additional 24 h, cells were collected and CAT activity in cell extracts was measured by using the Quan-T-CAT assay system (Amersham, Pharmacia). CAT activities were normalized against the luciferase activity derived from a cotransfected cytomegalovirus-luciferase plasmid (1). Results are expressed as milliunits  of CAT enzyme present in 10 μg of cell extracts and as fold induction with respect to the promoterless pCAT 3-basic vector. The data are means ± standard deviations of two independent experiments in which two separate plasmid preparations were used. (B) Enhancer activity of DHS-S1 in 293 and HeLa cells. DHS-S1 was cloned in both orientations (represented by the direction of the arrows) into the pCAT 3-promoter vector either into the SmaI site upstream of the SV40 promoter or into the BamHI site downstream of the CAT gene. Similarly, FR1, FR2, and FR3 were cloned in one orientation either into the SmaI site or into the BamHI site of pCAT 3-vector. Transfections were performed, and CAT activities were measured and normalized as described in the legend to Fig. ​Fig.4A.4A. Results are expressed as milliunits of CAT enzyme in 10 μg of cell extracts; fold induction was calculated with respect to that of the pCAT 3-promoter vector. The data are means ± standard deviations of three independent experiments in which at least two different plasmid preparations were used.

Journal:

Article Title: Characteristics of the Adeno-Associated Virus Preintegration Site in Human Chromosome 19: Open Chromatin Conformation and Transcription-Competent Environment

doi:

Figure Lengend Snippet: Transcriptional activity of DHS-S1. (A) Structure and activity of constructs containing DHS-S1 cloned upstream of the CAT gene. The whole DHS-S1 was excised as an SmaI-SmaI fragment (nt 18 to 353 of AAVS1) from plasmid pRVK and cloned in both orientations (indicated by the direction of the arrows) upstream of the intron and the CAT gene into the SmaI site of pCAT 3-basic vector (Promega). Black boxes represent the SV40 promoter. The promoterless plasmid is the pCAT 3-basic vector (Promega), and the control plasmid containing the SV40 promoter is the pCAT 3-promoter vector (Promega). Regions FR1 (nt 1313 to 1616 of AAVS1) and FR3 (nt 2633 to 2927 of AAVS1) were amplified by PCR with plasmid pRVK as a substrate and oligonucleotides carrying SmaI sites at either end. The resulting fragments were digested with restriction enzyme SmaI and cloned into the SmaI site of the pCAT 3-basic vector. Region FR2 (nt 2077 to 2371 of AAVS1) was excised from plasmid pRVK as a BamHI-flanked fragment, filled in by treatment with Klenow enzyme, and inserted into the SmaI site of pCAT 3-basic vector. Ten micrograms of each plasmid was transfected as described previously by calcium phosphate precipitation into 293 and HeLa cells (1). At 15 h posttransfection, the medium was changed: after an additional 24 h, cells were collected and CAT activity in cell extracts was measured by using the Quan-T-CAT assay system (Amersham, Pharmacia). CAT activities were normalized against the luciferase activity derived from a cotransfected cytomegalovirus-luciferase plasmid (1). Results are expressed as milliunits of CAT enzyme present in 10 μg of cell extracts and as fold induction with respect to the promoterless pCAT 3-basic vector. The data are means ± standard deviations of two independent experiments in which two separate plasmid preparations were used. (B) Enhancer activity of DHS-S1 in 293 and HeLa cells. DHS-S1 was cloned in both orientations (represented by the direction of the arrows) into the pCAT 3-promoter vector either into the SmaI site upstream of the SV40 promoter or into the BamHI site downstream of the CAT gene. Similarly, FR1, FR2, and FR3 were cloned in one orientation either into the SmaI site or into the BamHI site of pCAT 3-vector. Transfections were performed, and CAT activities were measured and normalized as described in the legend to Fig. ​Fig.4A.4A. Results are expressed as milliunits of CAT enzyme in 10 μg of cell extracts; fold induction was calculated with respect to that of the pCAT 3-promoter vector. The data are means ± standard deviations of three independent experiments in which at least two different plasmid preparations were used.

Article Snippet: The whole DHS-S1 was excised as an Sma I- Sma I fragment (nt 18 to 353 of AAVS1) from plasmid pRVK and cloned in both orientations (indicated by the direction of the arrows) upstream of the intron and the CAT gene into the Sma I site of pCAT 3-basic vector (Promega).

Techniques: Activity Assay, Construct, Clone Assay, Plasmid Preparation, Amplification, Transfection, Luciferase, Derivative Assay

Enhancer activity of DHS-S1 is mainly located in the 181 to 353 region. (A) Graphic representation of the two DHS-S1 subregions, E1-S1 (nt 18 to 181) and E2-S1 (nt 181 to 353), whose transcriptional activity was tested in transient transfection assays. (B) Enhancer activity of E1-S1 and E2-S1 in 293 and HeLa cells. E1-S1 and E2-S1 were obtained as PCR fragments by using plasmid pRVK (see legend to Fig. ​Fig.1)1) as a template, and cloned in both orientations (indicated by the direction of the arrows) into plasmid pCAT 3-promoter either upstream of the SV40 promoter or downstream of the CAT gene (see the legend to Fig. ​Fig.4).4). Transfections, CAT assays, and normalization of the results were performed as described in the legend to Fig. ​Fig.4.4. Results are expressed as milliunits of CAT per 10 μg of cell extracts and as fold induction with respect to the pCAT 3-promoter vector. The data are means ± standard deviations of four independent experiments in which two different plasmid preparations were used.

Journal:

Article Title: Characteristics of the Adeno-Associated Virus Preintegration Site in Human Chromosome 19: Open Chromatin Conformation and Transcription-Competent Environment

doi:

Figure Lengend Snippet: Enhancer activity of DHS-S1 is mainly located in the 181 to 353 region. (A) Graphic representation of the two DHS-S1 subregions, E1-S1 (nt 18 to 181) and E2-S1 (nt 181 to 353), whose transcriptional activity was tested in transient transfection assays. (B) Enhancer activity of E1-S1 and E2-S1 in 293 and HeLa cells. E1-S1 and E2-S1 were obtained as PCR fragments by using plasmid pRVK (see legend to Fig. ​Fig.1)1) as a template, and cloned in both orientations (indicated by the direction of the arrows) into plasmid pCAT 3-promoter either upstream of the SV40 promoter or downstream of the CAT gene (see the legend to Fig. ​Fig.4).4). Transfections, CAT assays, and normalization of the results were performed as described in the legend to Fig. ​Fig.4.4. Results are expressed as milliunits of CAT per 10 μg of cell extracts and as fold induction with respect to the pCAT 3-promoter vector. The data are means ± standard deviations of four independent experiments in which two different plasmid preparations were used.

Article Snippet: The whole DHS-S1 was excised as an Sma I- Sma I fragment (nt 18 to 353 of AAVS1) from plasmid pRVK and cloned in both orientations (indicated by the direction of the arrows) upstream of the intron and the CAT gene into the Sma I site of pCAT 3-basic vector (Promega).

Techniques: Activity Assay, Transfection, Plasmid Preparation, Clone Assay