Plasmid Preparation:Article Title: Hepatitis C virus NS5A is not an effective antagonist of the canonical PKR-eIF2α pathway
Article Snippet: The J6/JFH1 plasmid was acquired from Apath LLC. .. The plasmid was linearized by digestion with XbaI and purified with the PCR and DNA cleanup kit (NEB, T1030S). .. Next, viral RNA was obtained by in vitro transcription (NEB, E2040S), and RNA was purified (NEB, T2050S), aliquoted, and stored at -80°C.
Article Title: Detergent-based preparation influences TMEM16F assembly and scramblase activity.
Article Snippet: The amplified fragment was separated by electrophoresis on a 0.8% agarose gel and purified using the FastGene Gel/PCR Extraction Kit (NIPPON Genetics, Tokyo, Japan). .. Both the purified PCR product and the p3xFLAG-CMV-14 vector were digested with EcoRI and XbaI (New England Biolabs, Ipswich, MA) and ligated using Ligation Mix (NIPPON GENE, Tokyo, Japan). .. The scrambling domain mutant (K529C) was constructed using the KOD-Plus-Mutagenesis Kit (TOYOBO) with a forward primer (5′-atgtgtggcaattatgattac-3′) and a reverse primer (5′-tcatatatggtgttcagaatc-3′).
Article Title: The autosomal deubiquitylase Trabid drives sex-divergent neurodegeneration in Drosophila
Article Snippet: Trabid-AnkOTU was cloned using “ctggaagtggatccGACA CCCTGCAAGAGCGTCAAGAG” and “CCGCGGGCCCTCTAGA ttaTTCTTCGTCGGAGTCGCCGTC” primers by Phusion polymerase (NEB, UK). .. pAC5 plasmid backbone was digested NotI-HF and XbaI Communications Biology Article in Press restriction enzymes (NEB, UK). .. The PCR fragments and digested backbones were assembled by NEBuilder HiFi DNA Assembly Cloning Kit (NEB, UK).
Purification:Article Title: Hepatitis C virus NS5A is not an effective antagonist of the canonical PKR-eIF2α pathway
Article Snippet: The J6/JFH1 plasmid was acquired from Apath LLC. .. The plasmid was linearized by digestion with XbaI and purified with the PCR and DNA cleanup kit (NEB, T1030S). .. Next, viral RNA was obtained by in vitro transcription (NEB, E2040S), and RNA was purified (NEB, T2050S), aliquoted, and stored at -80°C.
Article Title: Detergent-based preparation influences TMEM16F assembly and scramblase activity.
Article Snippet: The amplified fragment was separated by electrophoresis on a 0.8% agarose gel and purified using the FastGene Gel/PCR Extraction Kit (NIPPON Genetics, Tokyo, Japan). .. Both the purified PCR product and the p3xFLAG-CMV-14 vector were digested with EcoRI and XbaI (New England Biolabs, Ipswich, MA) and ligated using Ligation Mix (NIPPON GENE, Tokyo, Japan). .. The scrambling domain mutant (K529C) was constructed using the KOD-Plus-Mutagenesis Kit (TOYOBO) with a forward primer (5′-atgtgtggcaattatgattac-3′) and a reverse primer (5′-tcatatatggtgttcagaatc-3′).
Polymerase Chain Reaction:Article Title: Hepatitis C virus NS5A is not an effective antagonist of the canonical PKR-eIF2α pathway
Article Snippet: The J6/JFH1 plasmid was acquired from Apath LLC. .. The plasmid was linearized by digestion with XbaI and purified with the PCR and DNA cleanup kit (NEB, T1030S). .. Next, viral RNA was obtained by in vitro transcription (NEB, E2040S), and RNA was purified (NEB, T2050S), aliquoted, and stored at -80°C.
Article Title: Detergent-based preparation influences TMEM16F assembly and scramblase activity.
Article Snippet: The amplified fragment was separated by electrophoresis on a 0.8% agarose gel and purified using the FastGene Gel/PCR Extraction Kit (NIPPON Genetics, Tokyo, Japan). .. Both the purified PCR product and the p3xFLAG-CMV-14 vector were digested with EcoRI and XbaI (New England Biolabs, Ipswich, MA) and ligated using Ligation Mix (NIPPON GENE, Tokyo, Japan). .. The scrambling domain mutant (K529C) was constructed using the KOD-Plus-Mutagenesis Kit (TOYOBO) with a forward primer (5′-atgtgtggcaattatgattac-3′) and a reverse primer (5′-tcatatatggtgttcagaatc-3′).
Ligation:Article Title: Detergent-based preparation influences TMEM16F assembly and scramblase activity.
Article Snippet: The amplified fragment was separated by electrophoresis on a 0.8% agarose gel and purified using the FastGene Gel/PCR Extraction Kit (NIPPON Genetics, Tokyo, Japan). .. Both the purified PCR product and the p3xFLAG-CMV-14 vector were digested with EcoRI and XbaI (New England Biolabs, Ipswich, MA) and ligated using Ligation Mix (NIPPON GENE, Tokyo, Japan). .. The scrambling domain mutant (K529C) was constructed using the KOD-Plus-Mutagenesis Kit (TOYOBO) with a forward primer (5′-atgtgtggcaattatgattac-3′) and a reverse primer (5′-tcatatatggtgttcagaatc-3′).
Immunohistochemistry:Article Title: A common germline 3' UTR variant controls DDIT4 translation efficiency and stress responses in cancer cells.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies ATF4 SantaCruz sc-390063; RRID: AB_2810998 beta-tubulin SantaCruz sc-5274: RRID: AB_2288090 DDIT4 Proteintech 67059-1-Ig; RRID: AB_2882369 DDIT4 IHC Proteintech 10638-1-AP; RRID: AB_2245711 GAPDH SantaCruz sc-32233; RRID: AB_627679 Lamin-A/C Abcam ab40567; RRID: AB_775967 LC3 Sigma L8918; RRID: AB_1079382 p62 Cell Signaling 5114; RRID: AB_10624872 p-4EBP1 Thr 37/46 Cell Signaling 236B4; RRID: AB_560835 p53 (DO-1) SantaCruz sc-126; RRID: AB_628082 p-RPS6 Ser 240/244 Genetex GTX133942; RRID: AB_2887145 p-S6K Thr 421/Ser 424 Genetex GTX635621; RRID: AB_2888544 Puromycin Millipore MABE343: RRID: AB_2566826 RBMX Cell Signaling D7C2V Cat#14794; RRID: AB_2798614 RPL21 SantaCruz sc-393663 RPS3 SantaCruz sc-376008; RRID: AB_10991105 tot-4EBP1 Cell Signaling 9452; RRID: AB_331692 tot-RPS6 Genetex GTX113542; RRID: AB_2037923 tot-S6K Genetex GTX107562; RRID: AB_1951779 anti-Normal Rabbit IgG antibody Cell Signaling Technology Cat #2729; RRID: AB_1031062 Bacterial and virus strains E. coli strain Laboratory stock DH5alpha E. coli strain Laboratory stock XL1blue Chemicals, peptides, and recombinant proteins TRIzol Thermo Fisher Scientific (Invitrogen) Cat# 15596026 Nutlin Cayman chemicals Cat#10004372 Thapsigargin Prodotti Gianni Cat# ab120286 Actinomycin D Thermo Fisher Scientific (Gibco) Cat# 11805017 Cycloheximide Cayman Chemicals Cat# 14126 Xba I New England Biolabs Cat# R0145S EcoR I New England Biolabs Cat# R0101S T4 DNA ligase New England Biolabs Cat# M0202S AmpliTaq Gold 360 Master Mix Thermo Fisher Scientific Cat# 4398833 Phusion High-Fidelity DNA Polymerase Thermo Fisher Scientific Cat# F530L cOmpleteTM, Mini Protease Inhibitor Cocktail Merck (Roche) Cat# 11836153001 Protein A Magnetic Beads Thermo Fisher Scientific (Dynabeads, Invitrogen) Cat# 88845 full-length recombinant RBMX protein Origene Cat# TP710403 Critical commercial assays Lipofectamine LTX with Plus reagent ThermoFisher Scientific Cat# 15338100 FuGene4K Transfection reagent Promega Cat# E5911 SE Cell Line 4D-NucleofectorTM X Kit S Lonza Cat# V4XC-1032 (Continued on next page) 20 iScience 29, 117707, November 20, 2026 .. REAGENT or RESOURCE SOURCE IDENTIFIER INTERFERin Polyplus Cat# 101000028 NU7441 (KU57788) DBA Italia (MedChemExpress) Cat# HY-11006 Agilent RNA 6000 Nano kit Agilent Cat#5067-1511 RevertAid RT Kit Thermo Fisher Scientific Cat# K1691 Dual Luciferase Reporter assay system Promega Cat# E1910 PierceTM BCA Protein Assay Kits Thermo Fisher Scientific (Pierce) Cat# 23227 Click-iTTM Plus OPP Alexa FluorTM 488 Protein Synthesis Assay Kit Thermo Fisher Scientific (Invitrogen) Cat# C10456 qPCRBIO SyGreen Mix PCR Biosystems (Resnova) Cat# PB20/11-20 Deposited data RNA-seq of HCT116 (total and polysomal RNA) Rizzotto et al.13 GSE95024 Targeted resequencing This study BioProject PRJNA1438951 TCGA SNP 6.0 array calls Genomic Data Commons https://gdc.cancer.gov TCGA clinical information Liu et al., 2018 https://doi.org/10.1016/j.cell.2018.02.052 (Table S1) RBPDB http://rbpdb.ccbr.utoronto.ca/ https://doi.org/10.1093/nar/gkq1069 Uncropped Western Blot Images Mendeley Data https://doi.org/10.17632/9j4wjn3xxb.1 Experimental models: Cell lines HCT116 ICLC, certified by BMR genomics, Padua, Italy N/A A549 ICLC N/A Oligonucleotides DDIT4 Short Cloning_F Eurofins Genomics aattcGACGACTGAACTTTTGGGG TGGAGACTAGAGGCAGGAGCTG AGGGACTGATTCCWGTGGTTGG AAAACTGAGGCAGCCACCTAAG GTGGAGGTGGGGGAATAGTGT TTCca DDIT4 Short Cloning_R Eurofins Genomics tatgGAAACACTATTCCCCCACCT CCACCTTAGGTGGCTGCCTCAG TTTTCCAACCACWGGAATCAGT CCCTCAGCTCCTGCCTCTAGTC TCCACCCCAAAAGTTCAGTCG TCg DDIT4 Long Cloning_F Eurofins Genomics ACTTCAACCTGAGGGGGCCGACA DDIT4 Long Cloning_R Eurofins Genomics AATCTAGAAGGTCAGTAGTGATGCTCCG DDX17 Cloning_F Eurofins Genomics AATCTAGAATTCAGGGATGCCC TACTCTCTCG DDX17 Cloning_R Eurofins Genomics AATCTAGAGAGCACTGATCCCAAGCA PERP Cloning_F Eurofins Genomics AATGAATTCCATGGTCCAAACCTGTTGCC PERP Cloning_R Eurofins Genomics ATAATCTAGATTCTCCTGTG GCATGTTTTATATC RELA Cloning_F Eurofins Genomics AATCTAGAATTCGGGA GCTGGGGAAACTCAAA RELA Cloning_R Eurofins Genomics AATCTAGAAGTCCCAGACCAAACCCC UBE2I Cloning_F Eurofins Genomics AATCTAGAATTCGC AGCGACCTTGTGGCATCGTCAA UBE2I Cloning_R Eurofins Genomics GGGTCTGAGGCTCAAAAGCA 18S_F Eurofins Genomics GTAACCCGTTGAACCCCATT 18S_R Eurofins Genomics CCATCCAATCGGTAGTAGCG (Continued on next page) iScience 29, 117707, November 20, 2026 21
Cell-Signaling:Article Title: A common germline 3' UTR variant controls DDIT4 translation efficiency and stress responses in cancer cells.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies ATF4 SantaCruz sc-390063; RRID: AB_2810998 beta-tubulin SantaCruz sc-5274: RRID: AB_2288090 DDIT4 Proteintech 67059-1-Ig; RRID: AB_2882369 DDIT4 IHC Proteintech 10638-1-AP; RRID: AB_2245711 GAPDH SantaCruz sc-32233; RRID: AB_627679 Lamin-A/C Abcam ab40567; RRID: AB_775967 LC3 Sigma L8918; RRID: AB_1079382 p62 Cell Signaling 5114; RRID: AB_10624872 p-4EBP1 Thr 37/46 Cell Signaling 236B4; RRID: AB_560835 p53 (DO-1) SantaCruz sc-126; RRID: AB_628082 p-RPS6 Ser 240/244 Genetex GTX133942; RRID: AB_2887145 p-S6K Thr 421/Ser 424 Genetex GTX635621; RRID: AB_2888544 Puromycin Millipore MABE343: RRID: AB_2566826 RBMX Cell Signaling D7C2V Cat#14794; RRID: AB_2798614 RPL21 SantaCruz sc-393663 RPS3 SantaCruz sc-376008; RRID: AB_10991105 tot-4EBP1 Cell Signaling 9452; RRID: AB_331692 tot-RPS6 Genetex GTX113542; RRID: AB_2037923 tot-S6K Genetex GTX107562; RRID: AB_1951779 anti-Normal Rabbit IgG antibody Cell Signaling Technology Cat #2729; RRID: AB_1031062 Bacterial and virus strains E. coli strain Laboratory stock DH5alpha E. coli strain Laboratory stock XL1blue Chemicals, peptides, and recombinant proteins TRIzol Thermo Fisher Scientific (Invitrogen) Cat# 15596026 Nutlin Cayman chemicals Cat#10004372 Thapsigargin Prodotti Gianni Cat# ab120286 Actinomycin D Thermo Fisher Scientific (Gibco) Cat# 11805017 Cycloheximide Cayman Chemicals Cat# 14126 Xba I New England Biolabs Cat# R0145S EcoR I New England Biolabs Cat# R0101S T4 DNA ligase New England Biolabs Cat# M0202S AmpliTaq Gold 360 Master Mix Thermo Fisher Scientific Cat# 4398833 Phusion High-Fidelity DNA Polymerase Thermo Fisher Scientific Cat# F530L cOmpleteTM, Mini Protease Inhibitor Cocktail Merck (Roche) Cat# 11836153001 Protein A Magnetic Beads Thermo Fisher Scientific (Dynabeads, Invitrogen) Cat# 88845 full-length recombinant RBMX protein Origene Cat# TP710403 Critical commercial assays Lipofectamine LTX with Plus reagent ThermoFisher Scientific Cat# 15338100 FuGene4K Transfection reagent Promega Cat# E5911 SE Cell Line 4D-NucleofectorTM X Kit S Lonza Cat# V4XC-1032 (Continued on next page) 20 iScience 29, 117707, November 20, 2026 .. REAGENT or RESOURCE SOURCE IDENTIFIER INTERFERin Polyplus Cat# 101000028 NU7441 (KU57788) DBA Italia (MedChemExpress) Cat# HY-11006 Agilent RNA 6000 Nano kit Agilent Cat#5067-1511 RevertAid RT Kit Thermo Fisher Scientific Cat# K1691 Dual Luciferase Reporter assay system Promega Cat# E1910 PierceTM BCA Protein Assay Kits Thermo Fisher Scientific (Pierce) Cat# 23227 Click-iTTM Plus OPP Alexa FluorTM 488 Protein Synthesis Assay Kit Thermo Fisher Scientific (Invitrogen) Cat# C10456 qPCRBIO SyGreen Mix PCR Biosystems (Resnova) Cat# PB20/11-20 Deposited data RNA-seq of HCT116 (total and polysomal RNA) Rizzotto et al.13 GSE95024 Targeted resequencing This study BioProject PRJNA1438951 TCGA SNP 6.0 array calls Genomic Data Commons https://gdc.cancer.gov TCGA clinical information Liu et al., 2018 https://doi.org/10.1016/j.cell.2018.02.052 (Table S1) RBPDB http://rbpdb.ccbr.utoronto.ca/ https://doi.org/10.1093/nar/gkq1069 Uncropped Western Blot Images Mendeley Data https://doi.org/10.17632/9j4wjn3xxb.1 Experimental models: Cell lines HCT116 ICLC, certified by BMR genomics, Padua, Italy N/A A549 ICLC N/A Oligonucleotides DDIT4 Short Cloning_F Eurofins Genomics aattcGACGACTGAACTTTTGGGG TGGAGACTAGAGGCAGGAGCTG AGGGACTGATTCCWGTGGTTGG AAAACTGAGGCAGCCACCTAAG GTGGAGGTGGGGGAATAGTGT TTCca DDIT4 Short Cloning_R Eurofins Genomics tatgGAAACACTATTCCCCCACCT CCACCTTAGGTGGCTGCCTCAG TTTTCCAACCACWGGAATCAGT CCCTCAGCTCCTGCCTCTAGTC TCCACCCCAAAAGTTCAGTCG TCg DDIT4 Long Cloning_F Eurofins Genomics ACTTCAACCTGAGGGGGCCGACA DDIT4 Long Cloning_R Eurofins Genomics AATCTAGAAGGTCAGTAGTGATGCTCCG DDX17 Cloning_F Eurofins Genomics AATCTAGAATTCAGGGATGCCC TACTCTCTCG DDX17 Cloning_R Eurofins Genomics AATCTAGAGAGCACTGATCCCAAGCA PERP Cloning_F Eurofins Genomics AATGAATTCCATGGTCCAAACCTGTTGCC PERP Cloning_R Eurofins Genomics ATAATCTAGATTCTCCTGTG GCATGTTTTATATC RELA Cloning_F Eurofins Genomics AATCTAGAATTCGGGA GCTGGGGAAACTCAAA RELA Cloning_R Eurofins Genomics AATCTAGAAGTCCCAGACCAAACCCC UBE2I Cloning_F Eurofins Genomics AATCTAGAATTCGC AGCGACCTTGTGGCATCGTCAA UBE2I Cloning_R Eurofins Genomics GGGTCTGAGGCTCAAAAGCA 18S_F Eurofins Genomics GTAACCCGTTGAACCCCATT 18S_R Eurofins Genomics CCATCCAATCGGTAGTAGCG (Continued on next page) iScience 29, 117707, November 20, 2026 21
Virus:Article Title: A common germline 3' UTR variant controls DDIT4 translation efficiency and stress responses in cancer cells.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies ATF4 SantaCruz sc-390063; RRID: AB_2810998 beta-tubulin SantaCruz sc-5274: RRID: AB_2288090 DDIT4 Proteintech 67059-1-Ig; RRID: AB_2882369 DDIT4 IHC Proteintech 10638-1-AP; RRID: AB_2245711 GAPDH SantaCruz sc-32233; RRID: AB_627679 Lamin-A/C Abcam ab40567; RRID: AB_775967 LC3 Sigma L8918; RRID: AB_1079382 p62 Cell Signaling 5114; RRID: AB_10624872 p-4EBP1 Thr 37/46 Cell Signaling 236B4; RRID: AB_560835 p53 (DO-1) SantaCruz sc-126; RRID: AB_628082 p-RPS6 Ser 240/244 Genetex GTX133942; RRID: AB_2887145 p-S6K Thr 421/Ser 424 Genetex GTX635621; RRID: AB_2888544 Puromycin Millipore MABE343: RRID: AB_2566826 RBMX Cell Signaling D7C2V Cat#14794; RRID: AB_2798614 RPL21 SantaCruz sc-393663 RPS3 SantaCruz sc-376008; RRID: AB_10991105 tot-4EBP1 Cell Signaling 9452; RRID: AB_331692 tot-RPS6 Genetex GTX113542; RRID: AB_2037923 tot-S6K Genetex GTX107562; RRID: AB_1951779 anti-Normal Rabbit IgG antibody Cell Signaling Technology Cat #2729; RRID: AB_1031062 Bacterial and virus strains E. coli strain Laboratory stock DH5alpha E. coli strain Laboratory stock XL1blue Chemicals, peptides, and recombinant proteins TRIzol Thermo Fisher Scientific (Invitrogen) Cat# 15596026 Nutlin Cayman chemicals Cat#10004372 Thapsigargin Prodotti Gianni Cat# ab120286 Actinomycin D Thermo Fisher Scientific (Gibco) Cat# 11805017 Cycloheximide Cayman Chemicals Cat# 14126 Xba I New England Biolabs Cat# R0145S EcoR I New England Biolabs Cat# R0101S T4 DNA ligase New England Biolabs Cat# M0202S AmpliTaq Gold 360 Master Mix Thermo Fisher Scientific Cat# 4398833 Phusion High-Fidelity DNA Polymerase Thermo Fisher Scientific Cat# F530L cOmpleteTM, Mini Protease Inhibitor Cocktail Merck (Roche) Cat# 11836153001 Protein A Magnetic Beads Thermo Fisher Scientific (Dynabeads, Invitrogen) Cat# 88845 full-length recombinant RBMX protein Origene Cat# TP710403 Critical commercial assays Lipofectamine LTX with Plus reagent ThermoFisher Scientific Cat# 15338100 FuGene4K Transfection reagent Promega Cat# E5911 SE Cell Line 4D-NucleofectorTM X Kit S Lonza Cat# V4XC-1032 (Continued on next page) 20 iScience 29, 117707, November 20, 2026 .. REAGENT or RESOURCE SOURCE IDENTIFIER INTERFERin Polyplus Cat# 101000028 NU7441 (KU57788) DBA Italia (MedChemExpress) Cat# HY-11006 Agilent RNA 6000 Nano kit Agilent Cat#5067-1511 RevertAid RT Kit Thermo Fisher Scientific Cat# K1691 Dual Luciferase Reporter assay system Promega Cat# E1910 PierceTM BCA Protein Assay Kits Thermo Fisher Scientific (Pierce) Cat# 23227 Click-iTTM Plus OPP Alexa FluorTM 488 Protein Synthesis Assay Kit Thermo Fisher Scientific (Invitrogen) Cat# C10456 qPCRBIO SyGreen Mix PCR Biosystems (Resnova) Cat# PB20/11-20 Deposited data RNA-seq of HCT116 (total and polysomal RNA) Rizzotto et al.13 GSE95024 Targeted resequencing This study BioProject PRJNA1438951 TCGA SNP 6.0 array calls Genomic Data Commons https://gdc.cancer.gov TCGA clinical information Liu et al., 2018 https://doi.org/10.1016/j.cell.2018.02.052 (Table S1) RBPDB http://rbpdb.ccbr.utoronto.ca/ https://doi.org/10.1093/nar/gkq1069 Uncropped Western Blot Images Mendeley Data https://doi.org/10.17632/9j4wjn3xxb.1 Experimental models: Cell lines HCT116 ICLC, certified by BMR genomics, Padua, Italy N/A A549 ICLC N/A Oligonucleotides DDIT4 Short Cloning_F Eurofins Genomics aattcGACGACTGAACTTTTGGGG TGGAGACTAGAGGCAGGAGCTG AGGGACTGATTCCWGTGGTTGG AAAACTGAGGCAGCCACCTAAG GTGGAGGTGGGGGAATAGTGT TTCca DDIT4 Short Cloning_R Eurofins Genomics tatgGAAACACTATTCCCCCACCT CCACCTTAGGTGGCTGCCTCAG TTTTCCAACCACWGGAATCAGT CCCTCAGCTCCTGCCTCTAGTC TCCACCCCAAAAGTTCAGTCG TCg DDIT4 Long Cloning_F Eurofins Genomics ACTTCAACCTGAGGGGGCCGACA DDIT4 Long Cloning_R Eurofins Genomics AATCTAGAAGGTCAGTAGTGATGCTCCG DDX17 Cloning_F Eurofins Genomics AATCTAGAATTCAGGGATGCCC TACTCTCTCG DDX17 Cloning_R Eurofins Genomics AATCTAGAGAGCACTGATCCCAAGCA PERP Cloning_F Eurofins Genomics AATGAATTCCATGGTCCAAACCTGTTGCC PERP Cloning_R Eurofins Genomics ATAATCTAGATTCTCCTGTG GCATGTTTTATATC RELA Cloning_F Eurofins Genomics AATCTAGAATTCGGGA GCTGGGGAAACTCAAA RELA Cloning_R Eurofins Genomics AATCTAGAAGTCCCAGACCAAACCCC UBE2I Cloning_F Eurofins Genomics AATCTAGAATTCGC AGCGACCTTGTGGCATCGTCAA UBE2I Cloning_R Eurofins Genomics GGGTCTGAGGCTCAAAAGCA 18S_F Eurofins Genomics GTAACCCGTTGAACCCCATT 18S_R Eurofins Genomics CCATCCAATCGGTAGTAGCG (Continued on next page) iScience 29, 117707, November 20, 2026 21
Recombinant:Article Title: A common germline 3' UTR variant controls DDIT4 translation efficiency and stress responses in cancer cells.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies ATF4 SantaCruz sc-390063; RRID: AB_2810998 beta-tubulin SantaCruz sc-5274: RRID: AB_2288090 DDIT4 Proteintech 67059-1-Ig; RRID: AB_2882369 DDIT4 IHC Proteintech 10638-1-AP; RRID: AB_2245711 GAPDH SantaCruz sc-32233; RRID: AB_627679 Lamin-A/C Abcam ab40567; RRID: AB_775967 LC3 Sigma L8918; RRID: AB_1079382 p62 Cell Signaling 5114; RRID: AB_10624872 p-4EBP1 Thr 37/46 Cell Signaling 236B4; RRID: AB_560835 p53 (DO-1) SantaCruz sc-126; RRID: AB_628082 p-RPS6 Ser 240/244 Genetex GTX133942; RRID: AB_2887145 p-S6K Thr 421/Ser 424 Genetex GTX635621; RRID: AB_2888544 Puromycin Millipore MABE343: RRID: AB_2566826 RBMX Cell Signaling D7C2V Cat#14794; RRID: AB_2798614 RPL21 SantaCruz sc-393663 RPS3 SantaCruz sc-376008; RRID: AB_10991105 tot-4EBP1 Cell Signaling 9452; RRID: AB_331692 tot-RPS6 Genetex GTX113542; RRID: AB_2037923 tot-S6K Genetex GTX107562; RRID: AB_1951779 anti-Normal Rabbit IgG antibody Cell Signaling Technology Cat #2729; RRID: AB_1031062 Bacterial and virus strains E. coli strain Laboratory stock DH5alpha E. coli strain Laboratory stock XL1blue Chemicals, peptides, and recombinant proteins TRIzol Thermo Fisher Scientific (Invitrogen) Cat# 15596026 Nutlin Cayman chemicals Cat#10004372 Thapsigargin Prodotti Gianni Cat# ab120286 Actinomycin D Thermo Fisher Scientific (Gibco) Cat# 11805017 Cycloheximide Cayman Chemicals Cat# 14126 Xba I New England Biolabs Cat# R0145S EcoR I New England Biolabs Cat# R0101S T4 DNA ligase New England Biolabs Cat# M0202S AmpliTaq Gold 360 Master Mix Thermo Fisher Scientific Cat# 4398833 Phusion High-Fidelity DNA Polymerase Thermo Fisher Scientific Cat# F530L cOmpleteTM, Mini Protease Inhibitor Cocktail Merck (Roche) Cat# 11836153001 Protein A Magnetic Beads Thermo Fisher Scientific (Dynabeads, Invitrogen) Cat# 88845 full-length recombinant RBMX protein Origene Cat# TP710403 Critical commercial assays Lipofectamine LTX with Plus reagent ThermoFisher Scientific Cat# 15338100 FuGene4K Transfection reagent Promega Cat# E5911 SE Cell Line 4D-NucleofectorTM X Kit S Lonza Cat# V4XC-1032 (Continued on next page) 20 iScience 29, 117707, November 20, 2026 .. REAGENT or RESOURCE SOURCE IDENTIFIER INTERFERin Polyplus Cat# 101000028 NU7441 (KU57788) DBA Italia (MedChemExpress) Cat# HY-11006 Agilent RNA 6000 Nano kit Agilent Cat#5067-1511 RevertAid RT Kit Thermo Fisher Scientific Cat# K1691 Dual Luciferase Reporter assay system Promega Cat# E1910 PierceTM BCA Protein Assay Kits Thermo Fisher Scientific (Pierce) Cat# 23227 Click-iTTM Plus OPP Alexa FluorTM 488 Protein Synthesis Assay Kit Thermo Fisher Scientific (Invitrogen) Cat# C10456 qPCRBIO SyGreen Mix PCR Biosystems (Resnova) Cat# PB20/11-20 Deposited data RNA-seq of HCT116 (total and polysomal RNA) Rizzotto et al.13 GSE95024 Targeted resequencing This study BioProject PRJNA1438951 TCGA SNP 6.0 array calls Genomic Data Commons https://gdc.cancer.gov TCGA clinical information Liu et al., 2018 https://doi.org/10.1016/j.cell.2018.02.052 (Table S1) RBPDB http://rbpdb.ccbr.utoronto.ca/ https://doi.org/10.1093/nar/gkq1069 Uncropped Western Blot Images Mendeley Data https://doi.org/10.17632/9j4wjn3xxb.1 Experimental models: Cell lines HCT116 ICLC, certified by BMR genomics, Padua, Italy N/A A549 ICLC N/A Oligonucleotides DDIT4 Short Cloning_F Eurofins Genomics aattcGACGACTGAACTTTTGGGG TGGAGACTAGAGGCAGGAGCTG AGGGACTGATTCCWGTGGTTGG AAAACTGAGGCAGCCACCTAAG GTGGAGGTGGGGGAATAGTGT TTCca DDIT4 Short Cloning_R Eurofins Genomics tatgGAAACACTATTCCCCCACCT CCACCTTAGGTGGCTGCCTCAG TTTTCCAACCACWGGAATCAGT CCCTCAGCTCCTGCCTCTAGTC TCCACCCCAAAAGTTCAGTCG TCg DDIT4 Long Cloning_F Eurofins Genomics ACTTCAACCTGAGGGGGCCGACA DDIT4 Long Cloning_R Eurofins Genomics AATCTAGAAGGTCAGTAGTGATGCTCCG DDX17 Cloning_F Eurofins Genomics AATCTAGAATTCAGGGATGCCC TACTCTCTCG DDX17 Cloning_R Eurofins Genomics AATCTAGAGAGCACTGATCCCAAGCA PERP Cloning_F Eurofins Genomics AATGAATTCCATGGTCCAAACCTGTTGCC PERP Cloning_R Eurofins Genomics ATAATCTAGATTCTCCTGTG GCATGTTTTATATC RELA Cloning_F Eurofins Genomics AATCTAGAATTCGGGA GCTGGGGAAACTCAAA RELA Cloning_R Eurofins Genomics AATCTAGAAGTCCCAGACCAAACCCC UBE2I Cloning_F Eurofins Genomics AATCTAGAATTCGC AGCGACCTTGTGGCATCGTCAA UBE2I Cloning_R Eurofins Genomics GGGTCTGAGGCTCAAAAGCA 18S_F Eurofins Genomics GTAACCCGTTGAACCCCATT 18S_R Eurofins Genomics CCATCCAATCGGTAGTAGCG (Continued on next page) iScience 29, 117707, November 20, 2026 21
Protease Inhibitor:Article Title: A common germline 3' UTR variant controls DDIT4 translation efficiency and stress responses in cancer cells.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies ATF4 SantaCruz sc-390063; RRID: AB_2810998 beta-tubulin SantaCruz sc-5274: RRID: AB_2288090 DDIT4 Proteintech 67059-1-Ig; RRID: AB_2882369 DDIT4 IHC Proteintech 10638-1-AP; RRID: AB_2245711 GAPDH SantaCruz sc-32233; RRID: AB_627679 Lamin-A/C Abcam ab40567; RRID: AB_775967 LC3 Sigma L8918; RRID: AB_1079382 p62 Cell Signaling 5114; RRID: AB_10624872 p-4EBP1 Thr 37/46 Cell Signaling 236B4; RRID: AB_560835 p53 (DO-1) SantaCruz sc-126; RRID: AB_628082 p-RPS6 Ser 240/244 Genetex GTX133942; RRID: AB_2887145 p-S6K Thr 421/Ser 424 Genetex GTX635621; RRID: AB_2888544 Puromycin Millipore MABE343: RRID: AB_2566826 RBMX Cell Signaling D7C2V Cat#14794; RRID: AB_2798614 RPL21 SantaCruz sc-393663 RPS3 SantaCruz sc-376008; RRID: AB_10991105 tot-4EBP1 Cell Signaling 9452; RRID: AB_331692 tot-RPS6 Genetex GTX113542; RRID: AB_2037923 tot-S6K Genetex GTX107562; RRID: AB_1951779 anti-Normal Rabbit IgG antibody Cell Signaling Technology Cat #2729; RRID: AB_1031062 Bacterial and virus strains E. coli strain Laboratory stock DH5alpha E. coli strain Laboratory stock XL1blue Chemicals, peptides, and recombinant proteins TRIzol Thermo Fisher Scientific (Invitrogen) Cat# 15596026 Nutlin Cayman chemicals Cat#10004372 Thapsigargin Prodotti Gianni Cat# ab120286 Actinomycin D Thermo Fisher Scientific (Gibco) Cat# 11805017 Cycloheximide Cayman Chemicals Cat# 14126 Xba I New England Biolabs Cat# R0145S EcoR I New England Biolabs Cat# R0101S T4 DNA ligase New England Biolabs Cat# M0202S AmpliTaq Gold 360 Master Mix Thermo Fisher Scientific Cat# 4398833 Phusion High-Fidelity DNA Polymerase Thermo Fisher Scientific Cat# F530L cOmpleteTM, Mini Protease Inhibitor Cocktail Merck (Roche) Cat# 11836153001 Protein A Magnetic Beads Thermo Fisher Scientific (Dynabeads, Invitrogen) Cat# 88845 full-length recombinant RBMX protein Origene Cat# TP710403 Critical commercial assays Lipofectamine LTX with Plus reagent ThermoFisher Scientific Cat# 15338100 FuGene4K Transfection reagent Promega Cat# E5911 SE Cell Line 4D-NucleofectorTM X Kit S Lonza Cat# V4XC-1032 (Continued on next page) 20 iScience 29, 117707, November 20, 2026 .. REAGENT or RESOURCE SOURCE IDENTIFIER INTERFERin Polyplus Cat# 101000028 NU7441 (KU57788) DBA Italia (MedChemExpress) Cat# HY-11006 Agilent RNA 6000 Nano kit Agilent Cat#5067-1511 RevertAid RT Kit Thermo Fisher Scientific Cat# K1691 Dual Luciferase Reporter assay system Promega Cat# E1910 PierceTM BCA Protein Assay Kits Thermo Fisher Scientific (Pierce) Cat# 23227 Click-iTTM Plus OPP Alexa FluorTM 488 Protein Synthesis Assay Kit Thermo Fisher Scientific (Invitrogen) Cat# C10456 qPCRBIO SyGreen Mix PCR Biosystems (Resnova) Cat# PB20/11-20 Deposited data RNA-seq of HCT116 (total and polysomal RNA) Rizzotto et al.13 GSE95024 Targeted resequencing This study BioProject PRJNA1438951 TCGA SNP 6.0 array calls Genomic Data Commons https://gdc.cancer.gov TCGA clinical information Liu et al., 2018 https://doi.org/10.1016/j.cell.2018.02.052 (Table S1) RBPDB http://rbpdb.ccbr.utoronto.ca/ https://doi.org/10.1093/nar/gkq1069 Uncropped Western Blot Images Mendeley Data https://doi.org/10.17632/9j4wjn3xxb.1 Experimental models: Cell lines HCT116 ICLC, certified by BMR genomics, Padua, Italy N/A A549 ICLC N/A Oligonucleotides DDIT4 Short Cloning_F Eurofins Genomics aattcGACGACTGAACTTTTGGGG TGGAGACTAGAGGCAGGAGCTG AGGGACTGATTCCWGTGGTTGG AAAACTGAGGCAGCCACCTAAG GTGGAGGTGGGGGAATAGTGT TTCca DDIT4 Short Cloning_R Eurofins Genomics tatgGAAACACTATTCCCCCACCT CCACCTTAGGTGGCTGCCTCAG TTTTCCAACCACWGGAATCAGT CCCTCAGCTCCTGCCTCTAGTC TCCACCCCAAAAGTTCAGTCG TCg DDIT4 Long Cloning_F Eurofins Genomics ACTTCAACCTGAGGGGGCCGACA DDIT4 Long Cloning_R Eurofins Genomics AATCTAGAAGGTCAGTAGTGATGCTCCG DDX17 Cloning_F Eurofins Genomics AATCTAGAATTCAGGGATGCCC TACTCTCTCG DDX17 Cloning_R Eurofins Genomics AATCTAGAGAGCACTGATCCCAAGCA PERP Cloning_F Eurofins Genomics AATGAATTCCATGGTCCAAACCTGTTGCC PERP Cloning_R Eurofins Genomics ATAATCTAGATTCTCCTGTG GCATGTTTTATATC RELA Cloning_F Eurofins Genomics AATCTAGAATTCGGGA GCTGGGGAAACTCAAA RELA Cloning_R Eurofins Genomics AATCTAGAAGTCCCAGACCAAACCCC UBE2I Cloning_F Eurofins Genomics AATCTAGAATTCGC AGCGACCTTGTGGCATCGTCAA UBE2I Cloning_R Eurofins Genomics GGGTCTGAGGCTCAAAAGCA 18S_F Eurofins Genomics GTAACCCGTTGAACCCCATT 18S_R Eurofins Genomics CCATCCAATCGGTAGTAGCG (Continued on next page) iScience 29, 117707, November 20, 2026 21
Magnetic Beads:Article Title: A common germline 3' UTR variant controls DDIT4 translation efficiency and stress responses in cancer cells.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies ATF4 SantaCruz sc-390063; RRID: AB_2810998 beta-tubulin SantaCruz sc-5274: RRID: AB_2288090 DDIT4 Proteintech 67059-1-Ig; RRID: AB_2882369 DDIT4 IHC Proteintech 10638-1-AP; RRID: AB_2245711 GAPDH SantaCruz sc-32233; RRID: AB_627679 Lamin-A/C Abcam ab40567; RRID: AB_775967 LC3 Sigma L8918; RRID: AB_1079382 p62 Cell Signaling 5114; RRID: AB_10624872 p-4EBP1 Thr 37/46 Cell Signaling 236B4; RRID: AB_560835 p53 (DO-1) SantaCruz sc-126; RRID: AB_628082 p-RPS6 Ser 240/244 Genetex GTX133942; RRID: AB_2887145 p-S6K Thr 421/Ser 424 Genetex GTX635621; RRID: AB_2888544 Puromycin Millipore MABE343: RRID: AB_2566826 RBMX Cell Signaling D7C2V Cat#14794; RRID: AB_2798614 RPL21 SantaCruz sc-393663 RPS3 SantaCruz sc-376008; RRID: AB_10991105 tot-4EBP1 Cell Signaling 9452; RRID: AB_331692 tot-RPS6 Genetex GTX113542; RRID: AB_2037923 tot-S6K Genetex GTX107562; RRID: AB_1951779 anti-Normal Rabbit IgG antibody Cell Signaling Technology Cat #2729; RRID: AB_1031062 Bacterial and virus strains E. coli strain Laboratory stock DH5alpha E. coli strain Laboratory stock XL1blue Chemicals, peptides, and recombinant proteins TRIzol Thermo Fisher Scientific (Invitrogen) Cat# 15596026 Nutlin Cayman chemicals Cat#10004372 Thapsigargin Prodotti Gianni Cat# ab120286 Actinomycin D Thermo Fisher Scientific (Gibco) Cat# 11805017 Cycloheximide Cayman Chemicals Cat# 14126 Xba I New England Biolabs Cat# R0145S EcoR I New England Biolabs Cat# R0101S T4 DNA ligase New England Biolabs Cat# M0202S AmpliTaq Gold 360 Master Mix Thermo Fisher Scientific Cat# 4398833 Phusion High-Fidelity DNA Polymerase Thermo Fisher Scientific Cat# F530L cOmpleteTM, Mini Protease Inhibitor Cocktail Merck (Roche) Cat# 11836153001 Protein A Magnetic Beads Thermo Fisher Scientific (Dynabeads, Invitrogen) Cat# 88845 full-length recombinant RBMX protein Origene Cat# TP710403 Critical commercial assays Lipofectamine LTX with Plus reagent ThermoFisher Scientific Cat# 15338100 FuGene4K Transfection reagent Promega Cat# E5911 SE Cell Line 4D-NucleofectorTM X Kit S Lonza Cat# V4XC-1032 (Continued on next page) 20 iScience 29, 117707, November 20, 2026 .. REAGENT or RESOURCE SOURCE IDENTIFIER INTERFERin Polyplus Cat# 101000028 NU7441 (KU57788) DBA Italia (MedChemExpress) Cat# HY-11006 Agilent RNA 6000 Nano kit Agilent Cat#5067-1511 RevertAid RT Kit Thermo Fisher Scientific Cat# K1691 Dual Luciferase Reporter assay system Promega Cat# E1910 PierceTM BCA Protein Assay Kits Thermo Fisher Scientific (Pierce) Cat# 23227 Click-iTTM Plus OPP Alexa FluorTM 488 Protein Synthesis Assay Kit Thermo Fisher Scientific (Invitrogen) Cat# C10456 qPCRBIO SyGreen Mix PCR Biosystems (Resnova) Cat# PB20/11-20 Deposited data RNA-seq of HCT116 (total and polysomal RNA) Rizzotto et al.13 GSE95024 Targeted resequencing This study BioProject PRJNA1438951 TCGA SNP 6.0 array calls Genomic Data Commons https://gdc.cancer.gov TCGA clinical information Liu et al., 2018 https://doi.org/10.1016/j.cell.2018.02.052 (Table S1) RBPDB http://rbpdb.ccbr.utoronto.ca/ https://doi.org/10.1093/nar/gkq1069 Uncropped Western Blot Images Mendeley Data https://doi.org/10.17632/9j4wjn3xxb.1 Experimental models: Cell lines HCT116 ICLC, certified by BMR genomics, Padua, Italy N/A A549 ICLC N/A Oligonucleotides DDIT4 Short Cloning_F Eurofins Genomics aattcGACGACTGAACTTTTGGGG TGGAGACTAGAGGCAGGAGCTG AGGGACTGATTCCWGTGGTTGG AAAACTGAGGCAGCCACCTAAG GTGGAGGTGGGGGAATAGTGT TTCca DDIT4 Short Cloning_R Eurofins Genomics tatgGAAACACTATTCCCCCACCT CCACCTTAGGTGGCTGCCTCAG TTTTCCAACCACWGGAATCAGT CCCTCAGCTCCTGCCTCTAGTC TCCACCCCAAAAGTTCAGTCG TCg DDIT4 Long Cloning_F Eurofins Genomics ACTTCAACCTGAGGGGGCCGACA DDIT4 Long Cloning_R Eurofins Genomics AATCTAGAAGGTCAGTAGTGATGCTCCG DDX17 Cloning_F Eurofins Genomics AATCTAGAATTCAGGGATGCCC TACTCTCTCG DDX17 Cloning_R Eurofins Genomics AATCTAGAGAGCACTGATCCCAAGCA PERP Cloning_F Eurofins Genomics AATGAATTCCATGGTCCAAACCTGTTGCC PERP Cloning_R Eurofins Genomics ATAATCTAGATTCTCCTGTG GCATGTTTTATATC RELA Cloning_F Eurofins Genomics AATCTAGAATTCGGGA GCTGGGGAAACTCAAA RELA Cloning_R Eurofins Genomics AATCTAGAAGTCCCAGACCAAACCCC UBE2I Cloning_F Eurofins Genomics AATCTAGAATTCGC AGCGACCTTGTGGCATCGTCAA UBE2I Cloning_R Eurofins Genomics GGGTCTGAGGCTCAAAAGCA 18S_F Eurofins Genomics GTAACCCGTTGAACCCCATT 18S_R Eurofins Genomics CCATCCAATCGGTAGTAGCG (Continued on next page) iScience 29, 117707, November 20, 2026 21
Transfection:Article Title: A common germline 3' UTR variant controls DDIT4 translation efficiency and stress responses in cancer cells.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies ATF4 SantaCruz sc-390063; RRID: AB_2810998 beta-tubulin SantaCruz sc-5274: RRID: AB_2288090 DDIT4 Proteintech 67059-1-Ig; RRID: AB_2882369 DDIT4 IHC Proteintech 10638-1-AP; RRID: AB_2245711 GAPDH SantaCruz sc-32233; RRID: AB_627679 Lamin-A/C Abcam ab40567; RRID: AB_775967 LC3 Sigma L8918; RRID: AB_1079382 p62 Cell Signaling 5114; RRID: AB_10624872 p-4EBP1 Thr 37/46 Cell Signaling 236B4; RRID: AB_560835 p53 (DO-1) SantaCruz sc-126; RRID: AB_628082 p-RPS6 Ser 240/244 Genetex GTX133942; RRID: AB_2887145 p-S6K Thr 421/Ser 424 Genetex GTX635621; RRID: AB_2888544 Puromycin Millipore MABE343: RRID: AB_2566826 RBMX Cell Signaling D7C2V Cat#14794; RRID: AB_2798614 RPL21 SantaCruz sc-393663 RPS3 SantaCruz sc-376008; RRID: AB_10991105 tot-4EBP1 Cell Signaling 9452; RRID: AB_331692 tot-RPS6 Genetex GTX113542; RRID: AB_2037923 tot-S6K Genetex GTX107562; RRID: AB_1951779 anti-Normal Rabbit IgG antibody Cell Signaling Technology Cat #2729; RRID: AB_1031062 Bacterial and virus strains E. coli strain Laboratory stock DH5alpha E. coli strain Laboratory stock XL1blue Chemicals, peptides, and recombinant proteins TRIzol Thermo Fisher Scientific (Invitrogen) Cat# 15596026 Nutlin Cayman chemicals Cat#10004372 Thapsigargin Prodotti Gianni Cat# ab120286 Actinomycin D Thermo Fisher Scientific (Gibco) Cat# 11805017 Cycloheximide Cayman Chemicals Cat# 14126 Xba I New England Biolabs Cat# R0145S EcoR I New England Biolabs Cat# R0101S T4 DNA ligase New England Biolabs Cat# M0202S AmpliTaq Gold 360 Master Mix Thermo Fisher Scientific Cat# 4398833 Phusion High-Fidelity DNA Polymerase Thermo Fisher Scientific Cat# F530L cOmpleteTM, Mini Protease Inhibitor Cocktail Merck (Roche) Cat# 11836153001 Protein A Magnetic Beads Thermo Fisher Scientific (Dynabeads, Invitrogen) Cat# 88845 full-length recombinant RBMX protein Origene Cat# TP710403 Critical commercial assays Lipofectamine LTX with Plus reagent ThermoFisher Scientific Cat# 15338100 FuGene4K Transfection reagent Promega Cat# E5911 SE Cell Line 4D-NucleofectorTM X Kit S Lonza Cat# V4XC-1032 (Continued on next page) 20 iScience 29, 117707, November 20, 2026 .. REAGENT or RESOURCE SOURCE IDENTIFIER INTERFERin Polyplus Cat# 101000028 NU7441 (KU57788) DBA Italia (MedChemExpress) Cat# HY-11006 Agilent RNA 6000 Nano kit Agilent Cat#5067-1511 RevertAid RT Kit Thermo Fisher Scientific Cat# K1691 Dual Luciferase Reporter assay system Promega Cat# E1910 PierceTM BCA Protein Assay Kits Thermo Fisher Scientific (Pierce) Cat# 23227 Click-iTTM Plus OPP Alexa FluorTM 488 Protein Synthesis Assay Kit Thermo Fisher Scientific (Invitrogen) Cat# C10456 qPCRBIO SyGreen Mix PCR Biosystems (Resnova) Cat# PB20/11-20 Deposited data RNA-seq of HCT116 (total and polysomal RNA) Rizzotto et al.13 GSE95024 Targeted resequencing This study BioProject PRJNA1438951 TCGA SNP 6.0 array calls Genomic Data Commons https://gdc.cancer.gov TCGA clinical information Liu et al., 2018 https://doi.org/10.1016/j.cell.2018.02.052 (Table S1) RBPDB http://rbpdb.ccbr.utoronto.ca/ https://doi.org/10.1093/nar/gkq1069 Uncropped Western Blot Images Mendeley Data https://doi.org/10.17632/9j4wjn3xxb.1 Experimental models: Cell lines HCT116 ICLC, certified by BMR genomics, Padua, Italy N/A A549 ICLC N/A Oligonucleotides DDIT4 Short Cloning_F Eurofins Genomics aattcGACGACTGAACTTTTGGGG TGGAGACTAGAGGCAGGAGCTG AGGGACTGATTCCWGTGGTTGG AAAACTGAGGCAGCCACCTAAG GTGGAGGTGGGGGAATAGTGT TTCca DDIT4 Short Cloning_R Eurofins Genomics tatgGAAACACTATTCCCCCACCT CCACCTTAGGTGGCTGCCTCAG TTTTCCAACCACWGGAATCAGT CCCTCAGCTCCTGCCTCTAGTC TCCACCCCAAAAGTTCAGTCG TCg DDIT4 Long Cloning_F Eurofins Genomics ACTTCAACCTGAGGGGGCCGACA DDIT4 Long Cloning_R Eurofins Genomics AATCTAGAAGGTCAGTAGTGATGCTCCG DDX17 Cloning_F Eurofins Genomics AATCTAGAATTCAGGGATGCCC TACTCTCTCG DDX17 Cloning_R Eurofins Genomics AATCTAGAGAGCACTGATCCCAAGCA PERP Cloning_F Eurofins Genomics AATGAATTCCATGGTCCAAACCTGTTGCC PERP Cloning_R Eurofins Genomics ATAATCTAGATTCTCCTGTG GCATGTTTTATATC RELA Cloning_F Eurofins Genomics AATCTAGAATTCGGGA GCTGGGGAAACTCAAA RELA Cloning_R Eurofins Genomics AATCTAGAAGTCCCAGACCAAACCCC UBE2I Cloning_F Eurofins Genomics AATCTAGAATTCGC AGCGACCTTGTGGCATCGTCAA UBE2I Cloning_R Eurofins Genomics GGGTCTGAGGCTCAAAAGCA 18S_F Eurofins Genomics GTAACCCGTTGAACCCCATT 18S_R Eurofins Genomics CCATCCAATCGGTAGTAGCG (Continued on next page) iScience 29, 117707, November 20, 2026 21
Derivative Assay:
Electrophoresis:Article Title: Emergence of ESBL-Producing Escherichia coli in Shrimp Aquaculture, Kerala, India.
Article Snippet: The present study evaluated 63 shrimp aquaculture farm sites in the Thrissur and Alappuzha districts of Kerala State, India.. A total of 206 samples were analyzed, and 50 extended-spectrum b-lactamase (ESBL)-producing Escherichia coli strains were identified with antibiotic susceptibility testing (AST) profiles.. All the strains were multidrug-resistant (MDR), with multiple antibiotic resistance (MAR) indices ranging from 0.32 to 0.64.
Agarose Gel Electrophoresis:Article Title: Emergence of ESBL-Producing Escherichia coli in Shrimp Aquaculture, Kerala, India.
Article Snippet: The present study evaluated 63 shrimp aquaculture farm sites in the Thrissur and Alappuzha districts of Kerala State, India.. A total of 206 samples were analyzed, and 50 extended-spectrum b-lactamase (ESBL)-producing Escherichia coli strains were identified with antibiotic susceptibility testing (AST) profiles.. All the strains were multidrug-resistant (MDR), with multiple antibiotic resistance (MAR) indices ranging from 0.32 to 0.64.
|
New England Biolabs is a verified supplier 
New England Biolabs manufactures this product 