Review



pbluescript ks  (Addgene inc)


Bioz Verified Symbol Addgene inc is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 93

    Structured Review

    Addgene inc pbluescript ks
    Pbluescript Ks, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 5 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/pbluescript+ks/pBABE+HSF+Flag+Ac+(Plasmid+%231949)/pmc12759076-1-0-3
    Average 93 stars, based on 5 article reviews
    pbluescript ks - by Bioz Stars, 2026-09
    93/100 stars

    Images

    Related Articles

    Detection Assay:

    Article Title: Impaired Mitochondrial ATP Production Downregulates Wnt Signaling via ER Stress Induction.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Creatine Sigma Aldrich Cat#C3630 Phosphoenolpyruvate Sigma Aldrich Cat#860077 4-phenylbutirric acid (4-PBA) Sigma Aldrich Cat#SML0309 Margatoxin (MgTx) Alomone Lab Cat#STM-325 Charybdotoxin (ChTx) Alomone Lab Cat#STC-325 Stichodactylatoxin (ShK) Alomone Lab Cat#STS-400 PAPTP Leanza et al., 2017 N/A PCARBTP Leanza et al., 2017 N/A DMSO Sigma Aldrich Cat#D2650 TRIzoL Thermo Fisher Scientific Cat#15596026 D-Luciferin Sigma Aldrich Cat#L9504 Chlorophenolred- b -D-galactopyranoside (CPRG) Roche Cat#10884308001 2-deoxy-D-glucose Sigma Aldrich Cat#D8375 TransIT -LT1 transfectionreagent Mirus Cat#MIR2304 Coelenterazine Santa Cruz Biotechnologies Cat#sc-205904 Ionomycin Sigma Aldrich Cat#I3909 Critical Commercial Assays CellTiter 96 AQUEOUS One solution Promega Cat#G3581 Superscript reverse transcriptase kit Thermo Fisher Scientific Cat#12594025 ATP Lite luminescence ATP detection assay system Perkin Elmer Cat#6016947 Power SYBR Green PCR master mix Thermo Fisher Scientific Cat#4367659 Experimental Models: Cell Lines Human: HEK293 ATCC CRL-1573 Human: DLD1 ATCC CCL-221 Human: HCT116 ATCC CCL-247 Human: HeLa ATCC CCL-2 Human immortalized fibroblasts bcs1lwt/wt Fernandez-Vizarra et al., 2007 N/A Human immortalized fibroblasts bcs1lR73C/F368I Fernandez-Vizarra et al., 2007 N/A Experimental Models: Organisms/Strains Zebrafish: Tg(7xTCFX.lasiam:mCherry)ia5 Moro et al., 2012 ZFIN: ZDB-alt-110113-2 Zebrafish: Tg(7xTCFX.lasiam:GFP)ia4 Moro et al., 2012 ZFIN: ZDB-alt-110113-1 Zebrafish: Tg(12xGli.HSV:GFP)ia11 Costa et al., 2017 ZFIN: ZDB-alt-120404-2 Zebrafish: Tg(Olig2:gfp)vu12 Shin et al., 2003 ZFIN: ZDB-alt-041129-8 Zebrafish: Tg(Gata1:dsred)sd2 Traver et al., 2003 ZFIN: ZBD-alt-051223-6 Oligonucleotides hGAPDH (for): CACAATATCACTTTACCAGAGTTAAAAGC This paper N/A hGAPDH (rev): CGAGCCACATCGCTCAGAC This paper N/A hb-catenin (for): CGAATGTCTGAGGACAAGCCACA This paper N/A hb-catenin (rev): CCATATCCACCAGAGTGAAAAGA This paper N/A hCyclin D1 (for): GGGGAGGAGAACAAACAGAT This paper N/A hCyclin D1 (rev): TGAGGCGGTAGTAGGACAGG This paper N/A hDKK1 (for): CAGGCGTGCAAATCTGTCT This paper N/A hDKK1 (rev): CCCATCCAAGGTGCTATGAT This paper N/A hAxin1 (for): ACAGGATCCGTAAGCAGCAC This paper N/A hAxin1 (rev): GCTCCTCCAGCTTCTCCTC This paper N/A Recombinant DNA M50 Super 8x TOPFlash Addgene Cat#12456 RBPJ-lux Gift from Prof. C. Kintner N/A (Continued on next page) e2 Cell Reports 28, 1949–1960.e1–e6, August 20, 2019

    SYBR Green Assay:

    Article Title: Impaired Mitochondrial ATP Production Downregulates Wnt Signaling via ER Stress Induction.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Creatine Sigma Aldrich Cat#C3630 Phosphoenolpyruvate Sigma Aldrich Cat#860077 4-phenylbutirric acid (4-PBA) Sigma Aldrich Cat#SML0309 Margatoxin (MgTx) Alomone Lab Cat#STM-325 Charybdotoxin (ChTx) Alomone Lab Cat#STC-325 Stichodactylatoxin (ShK) Alomone Lab Cat#STS-400 PAPTP Leanza et al., 2017 N/A PCARBTP Leanza et al., 2017 N/A DMSO Sigma Aldrich Cat#D2650 TRIzoL Thermo Fisher Scientific Cat#15596026 D-Luciferin Sigma Aldrich Cat#L9504 Chlorophenolred- b -D-galactopyranoside (CPRG) Roche Cat#10884308001 2-deoxy-D-glucose Sigma Aldrich Cat#D8375 TransIT -LT1 transfectionreagent Mirus Cat#MIR2304 Coelenterazine Santa Cruz Biotechnologies Cat#sc-205904 Ionomycin Sigma Aldrich Cat#I3909 Critical Commercial Assays CellTiter 96 AQUEOUS One solution Promega Cat#G3581 Superscript reverse transcriptase kit Thermo Fisher Scientific Cat#12594025 ATP Lite luminescence ATP detection assay system Perkin Elmer Cat#6016947 Power SYBR Green PCR master mix Thermo Fisher Scientific Cat#4367659 Experimental Models: Cell Lines Human: HEK293 ATCC CRL-1573 Human: DLD1 ATCC CCL-221 Human: HCT116 ATCC CCL-247 Human: HeLa ATCC CCL-2 Human immortalized fibroblasts bcs1lwt/wt Fernandez-Vizarra et al., 2007 N/A Human immortalized fibroblasts bcs1lR73C/F368I Fernandez-Vizarra et al., 2007 N/A Experimental Models: Organisms/Strains Zebrafish: Tg(7xTCFX.lasiam:mCherry)ia5 Moro et al., 2012 ZFIN: ZDB-alt-110113-2 Zebrafish: Tg(7xTCFX.lasiam:GFP)ia4 Moro et al., 2012 ZFIN: ZDB-alt-110113-1 Zebrafish: Tg(12xGli.HSV:GFP)ia11 Costa et al., 2017 ZFIN: ZDB-alt-120404-2 Zebrafish: Tg(Olig2:gfp)vu12 Shin et al., 2003 ZFIN: ZDB-alt-041129-8 Zebrafish: Tg(Gata1:dsred)sd2 Traver et al., 2003 ZFIN: ZBD-alt-051223-6 Oligonucleotides hGAPDH (for): CACAATATCACTTTACCAGAGTTAAAAGC This paper N/A hGAPDH (rev): CGAGCCACATCGCTCAGAC This paper N/A hb-catenin (for): CGAATGTCTGAGGACAAGCCACA This paper N/A hb-catenin (rev): CCATATCCACCAGAGTGAAAAGA This paper N/A hCyclin D1 (for): GGGGAGGAGAACAAACAGAT This paper N/A hCyclin D1 (rev): TGAGGCGGTAGTAGGACAGG This paper N/A hDKK1 (for): CAGGCGTGCAAATCTGTCT This paper N/A hDKK1 (rev): CCCATCCAAGGTGCTATGAT This paper N/A hAxin1 (for): ACAGGATCCGTAAGCAGCAC This paper N/A hAxin1 (rev): GCTCCTCCAGCTTCTCCTC This paper N/A Recombinant DNA M50 Super 8x TOPFlash Addgene Cat#12456 RBPJ-lux Gift from Prof. C. Kintner N/A (Continued on next page) e2 Cell Reports 28, 1949–1960.e1–e6, August 20, 2019

    Polymerase Chain Reaction:

    Article Title: Impaired Mitochondrial ATP Production Downregulates Wnt Signaling via ER Stress Induction.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Creatine Sigma Aldrich Cat#C3630 Phosphoenolpyruvate Sigma Aldrich Cat#860077 4-phenylbutirric acid (4-PBA) Sigma Aldrich Cat#SML0309 Margatoxin (MgTx) Alomone Lab Cat#STM-325 Charybdotoxin (ChTx) Alomone Lab Cat#STC-325 Stichodactylatoxin (ShK) Alomone Lab Cat#STS-400 PAPTP Leanza et al., 2017 N/A PCARBTP Leanza et al., 2017 N/A DMSO Sigma Aldrich Cat#D2650 TRIzoL Thermo Fisher Scientific Cat#15596026 D-Luciferin Sigma Aldrich Cat#L9504 Chlorophenolred- b -D-galactopyranoside (CPRG) Roche Cat#10884308001 2-deoxy-D-glucose Sigma Aldrich Cat#D8375 TransIT -LT1 transfectionreagent Mirus Cat#MIR2304 Coelenterazine Santa Cruz Biotechnologies Cat#sc-205904 Ionomycin Sigma Aldrich Cat#I3909 Critical Commercial Assays CellTiter 96 AQUEOUS One solution Promega Cat#G3581 Superscript reverse transcriptase kit Thermo Fisher Scientific Cat#12594025 ATP Lite luminescence ATP detection assay system Perkin Elmer Cat#6016947 Power SYBR Green PCR master mix Thermo Fisher Scientific Cat#4367659 Experimental Models: Cell Lines Human: HEK293 ATCC CRL-1573 Human: DLD1 ATCC CCL-221 Human: HCT116 ATCC CCL-247 Human: HeLa ATCC CCL-2 Human immortalized fibroblasts bcs1lwt/wt Fernandez-Vizarra et al., 2007 N/A Human immortalized fibroblasts bcs1lR73C/F368I Fernandez-Vizarra et al., 2007 N/A Experimental Models: Organisms/Strains Zebrafish: Tg(7xTCFX.lasiam:mCherry)ia5 Moro et al., 2012 ZFIN: ZDB-alt-110113-2 Zebrafish: Tg(7xTCFX.lasiam:GFP)ia4 Moro et al., 2012 ZFIN: ZDB-alt-110113-1 Zebrafish: Tg(12xGli.HSV:GFP)ia11 Costa et al., 2017 ZFIN: ZDB-alt-120404-2 Zebrafish: Tg(Olig2:gfp)vu12 Shin et al., 2003 ZFIN: ZDB-alt-041129-8 Zebrafish: Tg(Gata1:dsred)sd2 Traver et al., 2003 ZFIN: ZBD-alt-051223-6 Oligonucleotides hGAPDH (for): CACAATATCACTTTACCAGAGTTAAAAGC This paper N/A hGAPDH (rev): CGAGCCACATCGCTCAGAC This paper N/A hb-catenin (for): CGAATGTCTGAGGACAAGCCACA This paper N/A hb-catenin (rev): CCATATCCACCAGAGTGAAAAGA This paper N/A hCyclin D1 (for): GGGGAGGAGAACAAACAGAT This paper N/A hCyclin D1 (rev): TGAGGCGGTAGTAGGACAGG This paper N/A hDKK1 (for): CAGGCGTGCAAATCTGTCT This paper N/A hDKK1 (rev): CCCATCCAAGGTGCTATGAT This paper N/A hAxin1 (for): ACAGGATCCGTAAGCAGCAC This paper N/A hAxin1 (rev): GCTCCTCCAGCTTCTCCTC This paper N/A Recombinant DNA M50 Super 8x TOPFlash Addgene Cat#12456 RBPJ-lux Gift from Prof. C. Kintner N/A (Continued on next page) e2 Cell Reports 28, 1949–1960.e1–e6, August 20, 2019

    Recombinant:

    Article Title: Impaired Mitochondrial ATP Production Downregulates Wnt Signaling via ER Stress Induction.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Creatine Sigma Aldrich Cat#C3630 Phosphoenolpyruvate Sigma Aldrich Cat#860077 4-phenylbutirric acid (4-PBA) Sigma Aldrich Cat#SML0309 Margatoxin (MgTx) Alomone Lab Cat#STM-325 Charybdotoxin (ChTx) Alomone Lab Cat#STC-325 Stichodactylatoxin (ShK) Alomone Lab Cat#STS-400 PAPTP Leanza et al., 2017 N/A PCARBTP Leanza et al., 2017 N/A DMSO Sigma Aldrich Cat#D2650 TRIzoL Thermo Fisher Scientific Cat#15596026 D-Luciferin Sigma Aldrich Cat#L9504 Chlorophenolred- b -D-galactopyranoside (CPRG) Roche Cat#10884308001 2-deoxy-D-glucose Sigma Aldrich Cat#D8375 TransIT -LT1 transfectionreagent Mirus Cat#MIR2304 Coelenterazine Santa Cruz Biotechnologies Cat#sc-205904 Ionomycin Sigma Aldrich Cat#I3909 Critical Commercial Assays CellTiter 96 AQUEOUS One solution Promega Cat#G3581 Superscript reverse transcriptase kit Thermo Fisher Scientific Cat#12594025 ATP Lite luminescence ATP detection assay system Perkin Elmer Cat#6016947 Power SYBR Green PCR master mix Thermo Fisher Scientific Cat#4367659 Experimental Models: Cell Lines Human: HEK293 ATCC CRL-1573 Human: DLD1 ATCC CCL-221 Human: HCT116 ATCC CCL-247 Human: HeLa ATCC CCL-2 Human immortalized fibroblasts bcs1lwt/wt Fernandez-Vizarra et al., 2007 N/A Human immortalized fibroblasts bcs1lR73C/F368I Fernandez-Vizarra et al., 2007 N/A Experimental Models: Organisms/Strains Zebrafish: Tg(7xTCFX.lasiam:mCherry)ia5 Moro et al., 2012 ZFIN: ZDB-alt-110113-2 Zebrafish: Tg(7xTCFX.lasiam:GFP)ia4 Moro et al., 2012 ZFIN: ZDB-alt-110113-1 Zebrafish: Tg(12xGli.HSV:GFP)ia11 Costa et al., 2017 ZFIN: ZDB-alt-120404-2 Zebrafish: Tg(Olig2:gfp)vu12 Shin et al., 2003 ZFIN: ZDB-alt-041129-8 Zebrafish: Tg(Gata1:dsred)sd2 Traver et al., 2003 ZFIN: ZBD-alt-051223-6 Oligonucleotides hGAPDH (for): CACAATATCACTTTACCAGAGTTAAAAGC This paper N/A hGAPDH (rev): CGAGCCACATCGCTCAGAC This paper N/A hb-catenin (for): CGAATGTCTGAGGACAAGCCACA This paper N/A hb-catenin (rev): CCATATCCACCAGAGTGAAAAGA This paper N/A hCyclin D1 (for): GGGGAGGAGAACAAACAGAT This paper N/A hCyclin D1 (rev): TGAGGCGGTAGTAGGACAGG This paper N/A hDKK1 (for): CAGGCGTGCAAATCTGTCT This paper N/A hDKK1 (rev): CCCATCCAAGGTGCTATGAT This paper N/A hAxin1 (for): ACAGGATCCGTAAGCAGCAC This paper N/A hAxin1 (rev): GCTCCTCCAGCTTCTCCTC This paper N/A Recombinant DNA M50 Super 8x TOPFlash Addgene Cat#12456 RBPJ-lux Gift from Prof. C. Kintner N/A (Continued on next page) e2 Cell Reports 28, 1949–1960.e1–e6, August 20, 2019



    Similar Products

    98
    Toyobo pbluescript ii ks
    Pbluescript Ii Ks, supplied by Toyobo, used in various techniques. Bioz Stars score: 98/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/pbluescript+ks/KOD+-Plus-+Neo/us12492415-578-44-51
    Average 98 stars, based on 1 article reviews
    pbluescript ii ks - by Bioz Stars, 2026-09
    98/100 stars
      Buy from Supplier

    99
    New England Biolabs pbluescript ks irf3 construct
    Pbluescript Ks Irf3 Construct, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/pbluescript+ks/EcoRI/pm40947068-51-0-12
    Average 99 stars, based on 1 article reviews
    pbluescript ks irf3 construct - by Bioz Stars, 2026-09
    99/100 stars
      Buy from Supplier

    93
    Addgene inc pbluescript ii ks p21 promoter luc plasmid
    LJ3402 prevents hepatic senescence and mitochondrial dysfunction in aged mice. (A) Representative images of hematoxylin and eosin (H&E) (top), SA‐β‐gal (middle), and Oil Red O (bottom) staining on frozen liver sections from the indicated group. (B) The mRNA levels of marker genes involved in senescence ( p16 , <t>p21</t> , p53 ) and protein levels (γH2AX, p21, p53) in the liver of young and aged mice were determined by RT‐qPCR or immunoblotting ( n = 3; three randomly selected samples per group). (C) Expression of marker genes involved in lipid metabolism ( Srebp1c , Pparα , Cpt1 ) and mitochondrial homeostasis ( Sirt1 , Pgc‐1α , NRF1 , TFAM ) in the liver was determined using RT‐qPCR. (D) Hepatic triglyceride (TG), total cholesterol (TC), and free fatty acid (FFA), and (E) plasma levels of alanine aminotransferase (ALT) and aspartate aminotransferase (AST) ( n = 5; three randomly selected samples per group). (F) Livers separated from mice were incubated in culture medium, and the media were collected after 12 h and 24 h of incubation; the concentrations of TNF‐α and IL‐1β in the media were measured ( n = 5; three randomly selected samples per group). All data are presented as the mean ± SEM. * p < 0.05 and ** p < 0.01. Different lowercase letters above the bars indicate statistically significant differences ( p < 0.05).
    Pbluescript Ii Ks P21 Promoter Luc Plasmid, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/pbluescript+ks/p21+promoter+luciferase+(1002)+(Plasmid+%2349494)/pmc12679060-59-1-9
    Average 93 stars, based on 1 article reviews
    pbluescript ii ks p21 promoter luc plasmid - by Bioz Stars, 2026-09
    93/100 stars
      Buy from Supplier

    93
    Addgene inc pbluescript ks
    LJ3402 prevents hepatic senescence and mitochondrial dysfunction in aged mice. (A) Representative images of hematoxylin and eosin (H&E) (top), SA‐β‐gal (middle), and Oil Red O (bottom) staining on frozen liver sections from the indicated group. (B) The mRNA levels of marker genes involved in senescence ( p16 , <t>p21</t> , p53 ) and protein levels (γH2AX, p21, p53) in the liver of young and aged mice were determined by RT‐qPCR or immunoblotting ( n = 3; three randomly selected samples per group). (C) Expression of marker genes involved in lipid metabolism ( Srebp1c , Pparα , Cpt1 ) and mitochondrial homeostasis ( Sirt1 , Pgc‐1α , NRF1 , TFAM ) in the liver was determined using RT‐qPCR. (D) Hepatic triglyceride (TG), total cholesterol (TC), and free fatty acid (FFA), and (E) plasma levels of alanine aminotransferase (ALT) and aspartate aminotransferase (AST) ( n = 5; three randomly selected samples per group). (F) Livers separated from mice were incubated in culture medium, and the media were collected after 12 h and 24 h of incubation; the concentrations of TNF‐α and IL‐1β in the media were measured ( n = 5; three randomly selected samples per group). All data are presented as the mean ± SEM. * p < 0.05 and ** p < 0.01. Different lowercase letters above the bars indicate statistically significant differences ( p < 0.05).
    Pbluescript Ks, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/pbluescript+ks/pBABE+HSF+Flag+Ac+(Plasmid+%231949)/pmc12759076-1-0-3
    Average 93 stars, based on 1 article reviews
    pbluescript ks - by Bioz Stars, 2026-09
    93/100 stars
      Buy from Supplier

    93
    Addgene inc pbluescript ii ks p21 promoter luc
    Necdin regulates p53 acetylation and activity by releasing p300 from p53. ( A , B ) Reporter gene analysis using <t>p21-promoter–Luc</t> and the indicated expression plasmids in HEK293T cells treated with 100 μM H 2 O 2 , 50 μM sirtinol, and LKU4–CM for 24 h. ( C ) Immunoprecipitation (IP) analyses of p53 and p300 in HEK293T cells transfected with p53, p300, and NDN expression plasmids with or without LKU4–CM treatment for 24 h. ( D ) p53 acetylation in day 8 3T3-L1 adipocytes transfected with the indicated plasmids and treated with LKU4–CM for 24 h. Cells were immunoprecipitated using an anti-p53 antibody. ( E ) Chromatin immunoprecipitation (ChIP) assay using anti-p53 and anti-p300 antibodies in day 6 3T3-L1 adipocytes transfected with p53, p300, and NDN, and treated with LKU4–CM for 24 h. ( F ) mRNA and protein levels of p21 in 3T3-L1 adipocytes transfected with p300 and NDN expression plasmids and treated with LKU4–CM for 24 h. The lowercase letters above the graphs indicate statistical significance at p < 0.05.
    Pbluescript Ii Ks P21 Promoter Luc, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/pbluescript+ks/p21+promoter+luciferase+(1002)+(Plasmid+%2349494)/pmc12517307-248-1-11
    Average 93 stars, based on 1 article reviews
    pbluescript ii ks p21 promoter luc - by Bioz Stars, 2026-09
    93/100 stars
      Buy from Supplier

    98
    Addgene inc pbluescript ks lentiviral ires gfp vector lenticrisprv2 puro
    Necdin regulates p53 acetylation and activity by releasing p300 from p53. ( A , B ) Reporter gene analysis using <t>p21-promoter–Luc</t> and the indicated expression plasmids in HEK293T cells treated with 100 μM H 2 O 2 , 50 μM sirtinol, and LKU4–CM for 24 h. ( C ) Immunoprecipitation (IP) analyses of p53 and p300 in HEK293T cells transfected with p53, p300, and NDN expression plasmids with or without LKU4–CM treatment for 24 h. ( D ) p53 acetylation in day 8 3T3-L1 adipocytes transfected with the indicated plasmids and treated with LKU4–CM for 24 h. Cells were immunoprecipitated using an anti-p53 antibody. ( E ) Chromatin immunoprecipitation (ChIP) assay using anti-p53 and anti-p300 antibodies in day 6 3T3-L1 adipocytes transfected with p53, p300, and NDN, and treated with LKU4–CM for 24 h. ( F ) mRNA and protein levels of p21 in 3T3-L1 adipocytes transfected with p300 and NDN expression plasmids and treated with LKU4–CM for 24 h. The lowercase letters above the graphs indicate statistical significance at p < 0.05.
    Pbluescript Ks Lentiviral Ires Gfp Vector Lenticrisprv2 Puro, supplied by Addgene inc, used in various techniques. Bioz Stars score: 98/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/pbluescript+ks/lentiCRISPRv2+puro+(Plasmid+%2398290)/pmc12549880-5-0-10
    Average 98 stars, based on 1 article reviews
    pbluescript ks lentiviral ires gfp vector lenticrisprv2 puro - by Bioz Stars, 2026-09
    98/100 stars
      Buy from Supplier

    Image Search Results


    LJ3402 prevents hepatic senescence and mitochondrial dysfunction in aged mice. (A) Representative images of hematoxylin and eosin (H&E) (top), SA‐β‐gal (middle), and Oil Red O (bottom) staining on frozen liver sections from the indicated group. (B) The mRNA levels of marker genes involved in senescence ( p16 , p21 , p53 ) and protein levels (γH2AX, p21, p53) in the liver of young and aged mice were determined by RT‐qPCR or immunoblotting ( n = 3; three randomly selected samples per group). (C) Expression of marker genes involved in lipid metabolism ( Srebp1c , Pparα , Cpt1 ) and mitochondrial homeostasis ( Sirt1 , Pgc‐1α , NRF1 , TFAM ) in the liver was determined using RT‐qPCR. (D) Hepatic triglyceride (TG), total cholesterol (TC), and free fatty acid (FFA), and (E) plasma levels of alanine aminotransferase (ALT) and aspartate aminotransferase (AST) ( n = 5; three randomly selected samples per group). (F) Livers separated from mice were incubated in culture medium, and the media were collected after 12 h and 24 h of incubation; the concentrations of TNF‐α and IL‐1β in the media were measured ( n = 5; three randomly selected samples per group). All data are presented as the mean ± SEM. * p < 0.05 and ** p < 0.01. Different lowercase letters above the bars indicate statistically significant differences ( p < 0.05).

    Journal: Biofactors (Oxford, England)

    Article Title: Lactobacillus johnsonii JNU3402 Ameliorates Age‐Related Liver Dysfunction Through Stimulating PGC ‐1α‐Mediated SIRT1 Expression

    doi: 10.1002/biof.70069

    Figure Lengend Snippet: LJ3402 prevents hepatic senescence and mitochondrial dysfunction in aged mice. (A) Representative images of hematoxylin and eosin (H&E) (top), SA‐β‐gal (middle), and Oil Red O (bottom) staining on frozen liver sections from the indicated group. (B) The mRNA levels of marker genes involved in senescence ( p16 , p21 , p53 ) and protein levels (γH2AX, p21, p53) in the liver of young and aged mice were determined by RT‐qPCR or immunoblotting ( n = 3; three randomly selected samples per group). (C) Expression of marker genes involved in lipid metabolism ( Srebp1c , Pparα , Cpt1 ) and mitochondrial homeostasis ( Sirt1 , Pgc‐1α , NRF1 , TFAM ) in the liver was determined using RT‐qPCR. (D) Hepatic triglyceride (TG), total cholesterol (TC), and free fatty acid (FFA), and (E) plasma levels of alanine aminotransferase (ALT) and aspartate aminotransferase (AST) ( n = 5; three randomly selected samples per group). (F) Livers separated from mice were incubated in culture medium, and the media were collected after 12 h and 24 h of incubation; the concentrations of TNF‐α and IL‐1β in the media were measured ( n = 5; three randomly selected samples per group). All data are presented as the mean ± SEM. * p < 0.05 and ** p < 0.01. Different lowercase letters above the bars indicate statistically significant differences ( p < 0.05).

    Article Snippet: The pBluescript II KS(+)‐p21 promoter‐luc plasmid was purchased from Addgene (MA, USA) and designated as p21 promoter‐luc.

    Techniques: Staining, Marker, Quantitative RT-PCR, Western Blot, Expressing, Clinical Proteomics, Incubation

    SIRT1 modulates LJ3402‐mediated suppression of p53 function in senescent AML12 hepatocytes. (A) Acetylation of p53 after 5 days of treatment with LJ3402‐CM (LJ‐CM) and 50 μM sirtinol during H 2 O 2 ‐induced senescence. (A, C–I) Senescence of AML12 hepatocytes was induced by 1 mM or 750 μM H 2 O 2 for 1 h per day for 7 days. LJ‐CM, 50 μM sirtinol, or 20 μM PFTα were added on days 3–7 during H 2 O 2 exposure. (B) Luciferase reporter activity in HEK293T cells transfected with a reporter plasmid ( p21 promoter–luc) and a p53 expression plasmid. Twelve hours after transfection, cells were treated with LJ‐CM and 50 μM sirtinol for 24 h with or without 100 μM H 2 O 2 . (C) The mRNA and protein levels of p21, p53, PGC‐1α, and SIRT1 measured by RT‐qPCR and immunoblotting, respectively. (D) SA‐β‐gal staining. (E) mRNA levels of genes involved in mitochondrial biogenesis ( NRF1 and TFAM ) and oxidant defense ( CAT and SOD ). (F) ROS levels. (G) Oxygen consumption rates (OCRs) measured at baseline and after treatment with 2.5 μM oligomycin, 1 μM FCCP, or 1 μM rotenone/antimycin A. (H) Oil Red O staining. (I) Intracellular TG levels in senescent AML12 hepatocytes treated with LJ‐CM, sirtinol, and PFTα. All data are presented as the mean ± SEM. Different lowercase letters above the bars indicate statistically significant differences ( p < 0.05).

    Journal: Biofactors (Oxford, England)

    Article Title: Lactobacillus johnsonii JNU3402 Ameliorates Age‐Related Liver Dysfunction Through Stimulating PGC ‐1α‐Mediated SIRT1 Expression

    doi: 10.1002/biof.70069

    Figure Lengend Snippet: SIRT1 modulates LJ3402‐mediated suppression of p53 function in senescent AML12 hepatocytes. (A) Acetylation of p53 after 5 days of treatment with LJ3402‐CM (LJ‐CM) and 50 μM sirtinol during H 2 O 2 ‐induced senescence. (A, C–I) Senescence of AML12 hepatocytes was induced by 1 mM or 750 μM H 2 O 2 for 1 h per day for 7 days. LJ‐CM, 50 μM sirtinol, or 20 μM PFTα were added on days 3–7 during H 2 O 2 exposure. (B) Luciferase reporter activity in HEK293T cells transfected with a reporter plasmid ( p21 promoter–luc) and a p53 expression plasmid. Twelve hours after transfection, cells were treated with LJ‐CM and 50 μM sirtinol for 24 h with or without 100 μM H 2 O 2 . (C) The mRNA and protein levels of p21, p53, PGC‐1α, and SIRT1 measured by RT‐qPCR and immunoblotting, respectively. (D) SA‐β‐gal staining. (E) mRNA levels of genes involved in mitochondrial biogenesis ( NRF1 and TFAM ) and oxidant defense ( CAT and SOD ). (F) ROS levels. (G) Oxygen consumption rates (OCRs) measured at baseline and after treatment with 2.5 μM oligomycin, 1 μM FCCP, or 1 μM rotenone/antimycin A. (H) Oil Red O staining. (I) Intracellular TG levels in senescent AML12 hepatocytes treated with LJ‐CM, sirtinol, and PFTα. All data are presented as the mean ± SEM. Different lowercase letters above the bars indicate statistically significant differences ( p < 0.05).

    Article Snippet: The pBluescript II KS(+)‐p21 promoter‐luc plasmid was purchased from Addgene (MA, USA) and designated as p21 promoter‐luc.

    Techniques: Luciferase, Activity Assay, Transfection, Plasmid Preparation, Expressing, Quantitative RT-PCR, Western Blot, Staining

    Necdin regulates p53 acetylation and activity by releasing p300 from p53. ( A , B ) Reporter gene analysis using p21-promoter–Luc and the indicated expression plasmids in HEK293T cells treated with 100 μM H 2 O 2 , 50 μM sirtinol, and LKU4–CM for 24 h. ( C ) Immunoprecipitation (IP) analyses of p53 and p300 in HEK293T cells transfected with p53, p300, and NDN expression plasmids with or without LKU4–CM treatment for 24 h. ( D ) p53 acetylation in day 8 3T3-L1 adipocytes transfected with the indicated plasmids and treated with LKU4–CM for 24 h. Cells were immunoprecipitated using an anti-p53 antibody. ( E ) Chromatin immunoprecipitation (ChIP) assay using anti-p53 and anti-p300 antibodies in day 6 3T3-L1 adipocytes transfected with p53, p300, and NDN, and treated with LKU4–CM for 24 h. ( F ) mRNA and protein levels of p21 in 3T3-L1 adipocytes transfected with p300 and NDN expression plasmids and treated with LKU4–CM for 24 h. The lowercase letters above the graphs indicate statistical significance at p < 0.05.

    Journal: Aging (Albany NY)

    Article Title: Lactobacillus amylovorus KU4 inhibits adipocyte senescence in aged mice through necdin regulation of p53 activity

    doi: 10.18632/aging.206314

    Figure Lengend Snippet: Necdin regulates p53 acetylation and activity by releasing p300 from p53. ( A , B ) Reporter gene analysis using p21-promoter–Luc and the indicated expression plasmids in HEK293T cells treated with 100 μM H 2 O 2 , 50 μM sirtinol, and LKU4–CM for 24 h. ( C ) Immunoprecipitation (IP) analyses of p53 and p300 in HEK293T cells transfected with p53, p300, and NDN expression plasmids with or without LKU4–CM treatment for 24 h. ( D ) p53 acetylation in day 8 3T3-L1 adipocytes transfected with the indicated plasmids and treated with LKU4–CM for 24 h. Cells were immunoprecipitated using an anti-p53 antibody. ( E ) Chromatin immunoprecipitation (ChIP) assay using anti-p53 and anti-p300 antibodies in day 6 3T3-L1 adipocytes transfected with p53, p300, and NDN, and treated with LKU4–CM for 24 h. ( F ) mRNA and protein levels of p21 in 3T3-L1 adipocytes transfected with p300 and NDN expression plasmids and treated with LKU4–CM for 24 h. The lowercase letters above the graphs indicate statistical significance at p < 0.05.

    Article Snippet: Plasmids, pBluescript II KS (+)–p21 promoter Luc (p21-promoter–Luc), were purchased from Addgene (Watertown, MA, USA). pCDNA3–p53 and pCDNA3–p300 were transfected into HEK293T cells, 3T3-L1 adipocytes or primary adipocytes. pCDNA3–NDN was constructed for a previous study.

    Techniques: Activity Assay, Expressing, Immunoprecipitation, Transfection, Chromatin Immunoprecipitation

    LKU4 negatively regulates H 2 O 2 -induced adipocyte senescence through NDN upregulation. ( A ) Reporter gene analysis using p21-promoter–Luc in HEK293T cells. ( B – G ) γH2AX, p53, p21, and NDN protein expression ( B ), SA-β-gal staining (scale bars, 200 μm) ( C ), RT-qPCR analysis of SASP genes ( D ) and mitochondrial function-associated genes ( E ), ROS levels ( F ), mtDNA copy number and CS activity ( G ) in primary adipocytes. Primary adipocytes differentiated from SVF cells were transfected with expression plasmids and NDN siRNA for 12 h, followed by treatment with 100 μM H 2 O 2 , 50 μM sirtinol, and LKU4–CM for another 24 h, as indicated, before analysis. ( H ) Oxygen consumption rate (OCR) analysis using a Seahorse XFe analyzer in 3T3-L1 adipocytes overexpressing the indicated expression plasmids in the absence or presence of LKU4–CM. ( I ) Intracellular TG levels in primary adipocytes. Differentiated primary adipocytes were transfected with expression plasmids and NDN siRNA and then treated with 100 μM H 2 O 2 , 50 μM sirtinol, and LKU4–CM, as indicated.

    Journal: Aging (Albany NY)

    Article Title: Lactobacillus amylovorus KU4 inhibits adipocyte senescence in aged mice through necdin regulation of p53 activity

    doi: 10.18632/aging.206314

    Figure Lengend Snippet: LKU4 negatively regulates H 2 O 2 -induced adipocyte senescence through NDN upregulation. ( A ) Reporter gene analysis using p21-promoter–Luc in HEK293T cells. ( B – G ) γH2AX, p53, p21, and NDN protein expression ( B ), SA-β-gal staining (scale bars, 200 μm) ( C ), RT-qPCR analysis of SASP genes ( D ) and mitochondrial function-associated genes ( E ), ROS levels ( F ), mtDNA copy number and CS activity ( G ) in primary adipocytes. Primary adipocytes differentiated from SVF cells were transfected with expression plasmids and NDN siRNA for 12 h, followed by treatment with 100 μM H 2 O 2 , 50 μM sirtinol, and LKU4–CM for another 24 h, as indicated, before analysis. ( H ) Oxygen consumption rate (OCR) analysis using a Seahorse XFe analyzer in 3T3-L1 adipocytes overexpressing the indicated expression plasmids in the absence or presence of LKU4–CM. ( I ) Intracellular TG levels in primary adipocytes. Differentiated primary adipocytes were transfected with expression plasmids and NDN siRNA and then treated with 100 μM H 2 O 2 , 50 μM sirtinol, and LKU4–CM, as indicated.

    Article Snippet: Plasmids, pBluescript II KS (+)–p21 promoter Luc (p21-promoter–Luc), were purchased from Addgene (Watertown, MA, USA). pCDNA3–p53 and pCDNA3–p300 were transfected into HEK293T cells, 3T3-L1 adipocytes or primary adipocytes. pCDNA3–NDN was constructed for a previous study.

    Techniques: Expressing, Staining, Quantitative RT-PCR, Activity Assay, Transfection