multiclamp 700 b amplifier (Danaher Inc)
Danaher Inc is a verified supplier 
Danaher Inc manufactures this product 
99
Structured Review
Danaher Inc
multiclamp 700 b amplifier
Multiclamp 700 B Amplifier, supplied by Danaher Inc, used in various techniques. Bioz Stars score: 99/100, based on 13996 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/patch+clamp+amplifier/MultiClamp+700B+current+%26+patch+clamp+amplifier/pmc12407562-156-19-23
Average 99 stars, based on 13996 article reviews
Multiclamp 700 B Amplifier, supplied by Danaher Inc, used in various techniques. Bioz Stars score: 99/100, based on 13996 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/patch+clamp+amplifier/MultiClamp+700B+current+%26+patch+clamp+amplifier/pmc12407562-156-19-23
Average 99 stars, based on 13996 article reviews
multiclamp 700 b amplifier - by Bioz Stars,
2026-11
99/100 stars
Images
Related Articles
Patch Clamp:Article Title: Bipolar cell networks underlying steady-state intensity encoding in intrinsically photosensitive retinal ganglion cells Article Snippet: .. Whole-cell patch-clamp for current recordings in flat-mount retinas was performed as described, using a Software:Article Title: Bipolar cell networks underlying steady-state intensity encoding in intrinsically photosensitive retinal ganglion cells Article Snippet: .. Whole-cell patch-clamp for current recordings in flat-mount retinas was performed as described, using a Article Title: The Cullin3–Ring E3 ubiquitin ligase complex and USP14 regulate spastin-mediated microtubule severing and promotion of neurite outgrowth Article Snippet: .. Recordings were performed at room temperature in voltage clamp mode, at a holding potential of -70 mV, using a Sampling:Article Title: Bipolar cell networks underlying steady-state intensity encoding in intrinsically photosensitive retinal ganglion cells Article Snippet: .. Whole-cell patch-clamp for current recordings in flat-mount retinas was performed as described, using a other:Article Title: Cingulate thrombospondin 4 protects against neuropathic pain and comorbid anxiodepression via interaction with EAAT2. Article Snippet: CTATGTCGTCGTCGCAGGCATC(R) Sangon N/A Bacterial and virus strains rAAV2/9-hSyn-mThbs4-3×FLAG-P2A-mCherry-WPREhGH polyA Braincase N/A rAAV2/9-hSyn-mThbs4-2A-EGFP-WPREs BrainVTA N/A rAAV2/9-hSyn-EGFP-WPREs Braincase N/A rAAV2/9-hSyn-mCherry-WPREs Braincase N/A rAAV2/9-CaMKIIα-GCaMP6s-WPREs-pA Braincase N/A rAAV-hSyn-iGluSnFR3.v857.GPI Braincase N/A rAAV2/9-CMV-mThbs4-3×FLAG-P2A Braincase N/A rAAV2/9-CMV-3×FLAG-P2A Braincase N/A Experimental models: Organisms/strains Mouse: C57BL/6J Fourth Military Medical University RRID: IMSR_JAX:000664 Experimental models: Cell lines HEK 293FT Invitrogen Cat# R70007; RRID: CVCL_6911 Critical commercial assays BCA protein assay kit Thermo Scientific Cat# 23225 Plasma membrane protein isolation and cell fractionation Invent Cat# SM-05 Glutamic acid colorimetric assay kit Elabscience Cat# E-BC-K903-M Deposited data RNA-Seq data Li et al.20 SRP323752 Software and algorithms SMART v.3.0 Panlab http://smart.embl.de/ Imaris software Bitplane http://www.bitplane.com/imaris/imaris Statistical Program for Social Sciences 21.0 SPSS http://www-01.ibm.com/software/ uk/analytics/spss/ Prism GraphPad https://www.graphpad.com/ Others Elevated mesh-bottom platform Danmic Global N/A Thermal sensitivity device IITC Life science RRID:SCR_012152 Applied Biosystems Real-time PCR system Thermofisher RRID:SCR_025855 FV3000 Confocal microscope Olympus RRID:SCR_017015 Stereotactic frame RWD Life Science Inc N/A 10 μL microsyringe Gaoge N/A Microsyringe pump Kd Scientific N/A 1200s Vibratome Leica RRID:SCR_018453 Dichroic mirror fiber photometry recording Thorlabs N/A Optical commutator for fiber photometry recording Doris Lenses N/A Low-pass filter for fiber photometry recording ThinkerTech N/A S-4800 Scanning electron microscope Hitachi RRID:SCR_020018 Activation Assay:Article Title: Prelimbic cortex to zona incerta pathway mediates recognition memory recovery delay through down-regulating astrocytic GAT-3 Article Snippet: ZI sagittal slices (350 μm thickness) were cut with a vibrating slicer (Leica, VT1200S, Germany) under a continuous supply of oxygen mixture, and the ZI brain slices were incubated at 32°C in ACSF containing (in mM) 126 NaCl, 2.5 KCl, 1.25 NaH 2 PO 4 , 1.3 MgCl 2 , 2 CaCl 2 , 26 NaHCO 3 , and 10 glucose, pH (7.3, 300-305 mOsm / kg) at room temperature and incubated for 1 h. All reagents were purchased from Sigma Aldrich, USA. .. For chemogenetic activation or inhibition of ZI neurons, 10 mM CNO was applied during activity potential recording. membrane potentials were acquired with a Inhibition:Article Title: Prelimbic cortex to zona incerta pathway mediates recognition memory recovery delay through down-regulating astrocytic GAT-3 Article Snippet: ZI sagittal slices (350 μm thickness) were cut with a vibrating slicer (Leica, VT1200S, Germany) under a continuous supply of oxygen mixture, and the ZI brain slices were incubated at 32°C in ACSF containing (in mM) 126 NaCl, 2.5 KCl, 1.25 NaH 2 PO 4 , 1.3 MgCl 2 , 2 CaCl 2 , 26 NaHCO 3 , and 10 glucose, pH (7.3, 300-305 mOsm / kg) at room temperature and incubated for 1 h. All reagents were purchased from Sigma Aldrich, USA. .. For chemogenetic activation or inhibition of ZI neurons, 10 mM CNO was applied during activity potential recording. membrane potentials were acquired with a Activity Assay:Article Title: Prelimbic cortex to zona incerta pathway mediates recognition memory recovery delay through down-regulating astrocytic GAT-3 Article Snippet: ZI sagittal slices (350 μm thickness) were cut with a vibrating slicer (Leica, VT1200S, Germany) under a continuous supply of oxygen mixture, and the ZI brain slices were incubated at 32°C in ACSF containing (in mM) 126 NaCl, 2.5 KCl, 1.25 NaH 2 PO 4 , 1.3 MgCl 2 , 2 CaCl 2 , 26 NaHCO 3 , and 10 glucose, pH (7.3, 300-305 mOsm / kg) at room temperature and incubated for 1 h. All reagents were purchased from Sigma Aldrich, USA. .. For chemogenetic activation or inhibition of ZI neurons, 10 mM CNO was applied during activity potential recording. membrane potentials were acquired with a Membrane:Article Title: Prelimbic cortex to zona incerta pathway mediates recognition memory recovery delay through down-regulating astrocytic GAT-3 Article Snippet: ZI sagittal slices (350 μm thickness) were cut with a vibrating slicer (Leica, VT1200S, Germany) under a continuous supply of oxygen mixture, and the ZI brain slices were incubated at 32°C in ACSF containing (in mM) 126 NaCl, 2.5 KCl, 1.25 NaH 2 PO 4 , 1.3 MgCl 2 , 2 CaCl 2 , 26 NaHCO 3 , and 10 glucose, pH (7.3, 300-305 mOsm / kg) at room temperature and incubated for 1 h. All reagents were purchased from Sigma Aldrich, USA. .. For chemogenetic activation or inhibition of ZI neurons, 10 mM CNO was applied during activity potential recording. membrane potentials were acquired with a |