Review



offline sorter plexon  (plexon inc)

 
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 90
      Buy from Supplier

    Structured Review

    plexon inc offline sorter plexon
    Offline Sorter Plexon, supplied by plexon inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/offline+sorter+program+plexon+%2Einc/plexon+offline+sorter/pmc04416623-72-5-7
    Average 90 stars, based on 1 article reviews
    offline sorter plexon - by Bioz Stars, 2026-10
    90/100 stars

    Images

    Related Articles

    Software:


    Article Title: Automatic OptoDrive for Extracellular Recordings and Optogenetic Stimulation in Freely Moving Mice
    Article Snippet: .. The spikes were exported via OpenBridge software (Tucker-Davis Technologies) and sorted via a Plexon Offline Sorter. ..

    Article Title: Automatic OptoDrive for Extracellular Recordings and Optogenetic Stimulation in Freely Moving Mice
    Article Snippet: .. 4 of 12 via OpenBridge software (Tucker-Davis Technologies) and sorted via a Plexon Offline Sorter. ..

    other:

    Article Title: Recycling of prefrontal subspaces dynamically multiplexes information
    Article Snippet: For the Object task dataset, data was recorded using the Plexon MAP system, and spikes were manually sorted offline into isolated single neurons using amplitude and waveform features (Plexon Offline Sorter).

    Article Title: Changes in cortical grasp-related activity before and after object contact
    Article Snippet: Offline spike sorting (Offline Sorter, Plexon, Dallas, TX) was used to isolate individual units and identify spikes.

    Article Title: NMDA receptors regulate the firing rate set point of hippocampal circuits without altering single-cell dynamics.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Cdc42-Forward 5’ TTGTTGGTGATGGTGCTGTTGG N/A Cdc42-Reverse 5’GCTCTCCACCAATCATAACTGTGAC N/A Grin1-Forward 5’ GATGCCCGTAGGAAGCAGATG N/A Grin1-Reverse 5’ GGCTCTGCTCTACCACTCTTTCT N/A Recombinant DNA Plasmid: pcDNA3-HA-eEF2K Kruiswijit et al.96 Addgene plasmid #110160 Plasmid: pAAV-FLEX-tdTomato Boyden lab. Addgene plasmid #28306 Plasmid: pAAV-hDlx-GqDREADD-dTomato-Fishell-4 Dimidschstein et al.97 Addgene plasmid #83897 Software and algorithms Plexon offline-sorter V3 Plexon inc. USA RRID: SCR_000012 Matlab MathWorks RRID: SCR_001622 MiniAnalysis Synaptosoft, Decatur, Georgia, USA RRID: SCR_002184 Graphpad Prism 10.2.2 Graphpad RRID: SCR_002798 ImageJ- Fiji RRID: SCR_002285 AccuSleep – sleep scoring software Barger et al.98 GitHub - zekebarger/AccuSleep: Automatically score rodent sleep using EEG and EMG recordings KlustaKwik – spike sorting software Kadirs et al.99 https://klustakwik.sourceforge.net/ Cell Explorer – cell type characterization Petersen et al.100 https://cellexplorer.org/ Chronux – spectral analysis Bokil et al.101 http://chronux.org/ Custom MATLAB code This paper https://doi.org/10.5281/zenodo.13773883 Other 120MEA200/30iR-Ti Multi Channel Systems MCS-890095 MEA2100-System Multi Channel Systems RRID:SCR_014809 MEA2100-mini-system Multi Channel Systems N/A Micro syringe pump World Precision Instruments UMP3 Pump controller World Precision Instruments MICRO2T Microliter syringe Hamilton Cat# 701RN Syringe needle Hamilton Cat# 7803-03 Cannula tube 23 AWG Component supply Cat# HTX-23T-30 Cannula tube 33 AWG Component supply Cat# HTX-23R Filler rode Component supply Cat# HTX-28R-30 Isoflurane anesthesia vaporizer Kent Scientific SomnoSuite Osmotic pump Alzet Cat# 1007D Vinyl catheter tubing Durect Cat# 007760 Acquisition board for in vivo recordings Open Ephys Cat# OEPS-9030 Amplifier chip (Single units) Intan Cat# RHD2132 Amplifier chip (EEG and EMG) Intan #RHD2216 Custom head fixation apparatus Heim et al.102 https://github.com/leoreh/slutsky_fepsp

    Article Title: Timing, movement, and reward contributions to prefrontal and striatal ramping activity
    Article Snippet: Recordings were processed using Plexon Offline Sorter (version 4.6.0, Plexon, Dallas, TX) to remove artifacts and single neurons were identified using PCA and waveform shape.



    Similar Products

    offline sorter program plexon .inc  (plexon inc)
    90
    plexon inc offline sorter program plexon .inc
    Offline Sorter Program Plexon .Inc, supplied by plexon inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/offline+sorter+program+plexon+%2Einc/off+line+sorting+plexon/pmc05747365-546-20-24
    Average 90 stars, based on 1 article reviews
    offline sorter program plexon .inc - by Bioz Stars, 2026-10
    90/100 stars
    		  Buy from Supplier

    Image Search Results