nextseq 500 550 high output v2 5 kit (Illumina Inc)

Illumina Inc is a verified supplier

About

News

Press Release

Team

Advisors

Partners

Contact

Bioz Stars

Bioz vStars

Buy from Supplier

Structured Review

Illumina Inc nextseq 500 550 high output v2 5 kit
Nextseq 500 550 High Output V2 5 Kit, supplied by Illumina Inc, used in various techniques. Bioz Stars score: 98/100, based on 2243 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/nextseq+system/NextSeq+500%2F550+High+Output+Kit+v2%2E5/pm41933934-331-11-19
Average 98 stars, based on 2243 article reviews

nextseq 500 550 high output v2 5 kit - by Bioz Stars, 2026-09

98/100 stars

Images

other:

Article Title: DNMT1 loss leads to hypermethylation of a subset of late replicating domains by DNMT3A.
Article Snippet: The libraries were sequenced using the Illumina NextSeq 500/550 High-Output v2.5 (75 cycles) Kit on the Illumina NextSeq 550 platform over 2 flow cells to give 75 bp single-end reads.

Sequencing:

Article Title: Single-cell transcriptomics reveals FXR1 as an actionable target for siRNA therapy in ovarian cancer.
Article Snippet: After the scRNA-seq library construction, Agilent 4200 Tape Station system and High Sensitivity D5000 and D1000 Screen Tapes were used to assess the size profiles of the amplified cDNA. .. A NextSeq 500/550 High Output Kit v2.5 (150 cycles; 20024907; Illumina) with 28 cycles for read 1, 10 cycles for i7 index, 10 cycles for i5 index and 90 cycles for read 2 and was used to sequence the samples. .. Raw sequencing data were downloaded from Illumina BaseSpace, then demultiplexed and converted to gene-barcode matrices using the “mkfastq” and “count” functions in Cell Ranger v8.0 (10× Genomics).

Virus:

Article Title: RNA binding as an emerging regulatory dimension in the type I IFN response.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies MATR3 Proteintech CAT#12202-2-AP; RRID:AB_2281752 GFP (clone 3H9) ChromoTek CAT#3H9; RRID:AB_10773374 β-ACTIN (AC-15) Sigma Aldrich CAT#A1978; RRID:AB_476692 SINV C (304/306) Lab of L. Carrasco N/A MAP4 Proteintech CAT#11229-1-AP; RRID:AB_2140681 U2AF2 (U2AF65) Sigma Aldrich CAT#U4758; RRID:AB_262122 MOV10 Cusabio CAT#PA862068LA01HU; RRID:N/A G3BP1 Proteintech CAT#66486-1-Ig; RRID:AB_2721239 IFIT1 Proteintech CAT#23247-1-AP; RRID:AB_2811269 ZIKV E Lab of A. Patel N/A IRDye 800CW Goat anti-Rabbit IgG LI-COR CAT#926–32211; RRID:AB_621843 IRDye 800CW Goat anti-Mouse IgG LI-COR CAT#926–32210; RRID:AB_621842 IRDye 680RD Goat anti-Rabbit IgG LI-COR CAT#926–68071; RRID:AB_10956166 IRDye 680RD Goat anti-Mouse IgG LI-COR CAT#926–68070; RRID:AB_10956588 Bacterial and virus strains pT7-SVwt Laboratory of L. Carrasco85 N/A ZIKV-WT ATCC MR766 VR-84 strain Chemicals, peptides, and recombinant proteins IFNα2a (recombinant human) Novus Biologicals CAT#NBP2-34971 Hygromycin B Invitrogen CAT#10687010 Blasticidin S Hydrochloride Thermo Fisher Scientific CAT#J67216.8EQ Zeocin Gibco CAT#R25001 Critical commercial assays RNeasy Mini Kit Qiagen CAT#74104 Luna Universal One-Step RT-qPCR Kit NEB CAT#E3005L SpeedBeads Magnetic Carboxylate Modified Particles Sigma-Aldrich CAT#GE651521 05050250 Oligo(dT)25 magnetic beads NEB CAT#S1419S MagReSyn Zr-IMAC beads ReSyn Biosciences CAT#MR-ZRM002 GFP-Trap Multiwell Plate Chromotek CAT#GTP Oasis HLB 96- well μElution Plate Waters CAT#186001829 75 cycle High-output kit v2.5 Illumina CAT20024906 oligo(dT)25 stellaris probe (Alexa Fluor 594) Life technologies Ltd N/A Deposited data Proteomic data via PRIDE This paper PRIDE: PXD064360 iCLIP data via GEO This paper GEO: GSE294181 Western blot and silver stain images This paper Mendeley Data: https://doi.org/10.17632/7gkgf85g4j.1 Experimental models: Cell lines HEK293(Flp-In-T-Rex) Thermo Fisher Scientific CAT#R78007; RRID:CVCL_U427 HEK293 ECACC CAT#85120602; RRID:CVCL_0045 .. Oligonucleotides RT-qPCR primers, see Table S6 Sigma Aldrich N/A PCR mutagenesis primers, see Table S6 Sigma Aldrich N/A (Continued on next page) 16 Cell Reports 45, 117174, April 28, 2026

Recombinant:

Quantitative RT-PCR:

Modification:

Magnetic Beads:

Western Blot:

Silver Staining:

Isolation:

Article Title: Graded BMP signals modulate yellow and red color in fishes, impacting adult pigment patterns and conspecific shoaling behavior.
Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Rabbit monoclonal anti- Phospho-Smad1 (Ser463/465)/ Smad5 (Ser463/465)/ Smad9 (Ser465/467) Cell Signaling Technology Cat# 13820; RRID:AB_2493181 Goat anti-rabbit Alexa Fluor Plus 647 Invitrogen Cat# A32732; RRID:AB_2633281 DAPI Invitrogen Cat # D1306; RRID:AB_2629482 Chemicals, peptides, and recombinant proteins LDN-193189 Selleck Chemicals Cat# S7507 DMSO Fisher Scientific Cat# D128-1 MS222 Millipore Sigma Cat# A5040 Epinephrine Hydrochloride Sigma-Aldrich Cat# E4642 Liberase Roche Cat# 5401119001 Alt-RTM S.p. .. Cas9 Nuclease V3 IDT Cat# 1081058 Critical commercial assays RNAqueousTM-Micro Total RNA Isolation Kit Thermo Fisher Cat# AM1931 Chromium Next GEM Single Cell 3’ Kit v3.1 10x Genomics Cat# PN-1000268 SMART-Seq mRNA LP kit Takara Cat# 634768 NSQ 500/550 Hi Output KT v2.5 (150 CYS) Illumina Cat# 20024907 Deposited data RNA sequencing and genomic sequencing data SRA PRJNA1365945 Experimental models: Organisms/strains Danio albolineatus: Tg(aox5:nucEos)vp37albTg Huang et al.15 N/A Danio albolineatus: kita-/- Mills et al.37 Parichy et al.61 N/A Danio albolineatus: rgmbvp67al1 This paper N/A Danio albolineatus: rgmbvp67al2 This paper N/A Danio albolineatus: bdh1avp40ac1 Huang et al.15 N/A Danio albolineatus: runx3vp68a1 This paper N/A Danio albolineatus: runx3vp68a2 This paper N/A Danio aff. albolineatus Quigley et al.20 N/A Zebrafish: rgmbvp67re1 Huang et al.36 N/A Tanichthys albonubes The Wet Spot Tropical Fish https://www.wetspottropicalfish.com/ product/tanichthys-albonubes/ Oligonucleotides AltR gRNA targeting gdf6a: ATGTAGTCGTGAGGCACAAC IDT CD.Cas9.DLGD6978.AC AltR gRNA targeting rgmb: AGAGGAACTGCTCCAAAGAC IDT CD.Cas9.BWRG6584.AB AltR gRNA targeting runx3: ACCCTGGAAACGGGACCACC IDT CD.Cas9.SMRN1496.AA Software and algorithms Kallisto Bray et al.62 https://pachterlab.github.io/kallisto/ DESeq2 Love et al.63 https://github.com/thelovelab/DESeq2 Cell Ranger 10x Genomics https://www.10xgenomics.com/ support/software/cell-ranger/latest Monocle3 Trapnell et al.64 Cao et al.65 https://cole-trapnell-lab.github.io/ monocle3/ JMP Pro 18 SAS Institute https://www.jmp.com/ (Continued on next page) ll OPEN ACCESS Current Biology 36, 1–10.e1–e5, April 20, 2026 e1 Report ..

Single Cell:

RNA Sequencing:

Genomic Sequencing:

Software:

Next-Generation Sequencing:

Article Title: Organ-Specific and Conserved Regulatory Logic Orchestrates Gene Expression in the Embryonic Mesothelium.
Article Snippet: Libraries were assessed for quality using an Agilent TapeStation with a D1000 DNA ScreenTape assay, and quantified with the KAPA Library Quantification Kit. .. Next-generation sequencing (NGS) was conducted on equimolar pooled libraries using the NextSeq 500/550 High Output v2.5 kit (75 cycles) (Illumina), with paired-end reads (40 bp x 2) and 8 bp single index reads. ..

Review