Review



negative control sirna targeting the sequence ttctccgaacgtgtcacgt  (Shanghai GenePharma)

 
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 90

    Structured Review

    Shanghai GenePharma negative control sirna targeting the sequence ttctccgaacgtgtcacgt
    Negative Control Sirna Targeting The Sequence Ttctccgaacgtgtcacgt, supplied by Shanghai GenePharma, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/negative+control+sequence/negative+control+sirna/pmc12001209-103-6-11
    Average 90 stars, based on 1 article reviews
    negative control sirna targeting the sequence ttctccgaacgtgtcacgt - by Bioz Stars, 2026-09
    90/100 stars

    Images

    Related Articles

    other:

    Article Title: Sulfide Quinone Oxidoreductase Alleviates Acute Ulcerative Colitis by Regulating Mitochondrial Dysfunction
    Article Snippet: SiRNA‐ SQOR and negative control (NC) siRNA were purchased from Genepharma (Shanghai, China).

    Article Title: WTAP-mediated m 6 A modification promotes drug sensitivity by regulating NR3C1 in prostate cancer.
    Article Snippet: 1Department of Human Anatomy, School of Basic Medical Sciences, Guangxi Medical University, Nanning 530021, China 2Key Laboratory of Human Development and Disease Research, Education Department of Guangxi Zhuang Autonomous Region, Guangxi Medical University, Nanning 530021, China 3Collaborative Innovation Centre of Regenerative Medicine and Medical Bio Resource Development and Application Co-constructed by the Province and Ministry, Guangxi Medical University, Nanning 530021, China 4Laboratory Animal Center, Guangxi Medical University, Nanning 530021, China 5Department of Immunology, Basic Medical College of Guangxi Medical University, Nanning 530021, China 6Center for Genomic and Personalized Medicine, Guangxi Key Laboratory for Genomic and Personalized Medicine, Guangxi Collaborative Innovation Center for Genomic and Personalized Medicine, Guangxi Medical University, Nanning 530021, China 7Institute of Life Sciences, Guangxi Medical University, Nanning 530021, China 8Department of Biochemistry and Molecular Biology, School of Pre-Clinical Medicine, Guangxi Medical University, Nanning 530021, China

    Article Title: Porcine reproductive and respiratory syndrome virus NSP5 exploited UBE2L6 to promote viral replication via antagonising host RLRs and ISGylation.
    Article Snippet: Small interference RNAs (siRNAs) targeting UBE2L6 and siRNA-negative control (siNC) were designed and synthesised by GenePharma (Suzhou, China).

    Article Title: Starlike Au nanoparticle unleashing siDDIT3 and photothermal power to combat ferroptosis - driven osteoarthritis.
    Article Snippet: Cell treatment for gene regulation The si-DDIT3 and a negative control (si-NC) were sourced from GenePharma, located in Shanghai, China.

    Article Title: Knockdown of PVT1 inhibits cell proliferation in luminal and basal-like breast cancer subtypes by activating LATS2/Hippo signaling pathway
    Article Snippet: The siRNAs and negative control (NC) were obtained from GenePharma (Shanghai, China).

    Transfection:

    Article Title: Adipocytes-induced ANGPTL4/KLF4 axis drives glycolysis and metastasis in triple-negative breast cancer.
    Article Snippet: .. Transfection and generation of stable cells shRNAs targeting human ANGPTL4, along with a negative control shRNA, were obtained from GenePharma. .. To generate stable ANGPTL4-overexpressing cells, a full-length human ANGPTL4 gene lentiviral vector was acquired from GenePharma.

    Negative Control:

    Article Title: Adipocytes-induced ANGPTL4/KLF4 axis drives glycolysis and metastasis in triple-negative breast cancer.
    Article Snippet: .. Transfection and generation of stable cells shRNAs targeting human ANGPTL4, along with a negative control shRNA, were obtained from GenePharma. .. To generate stable ANGPTL4-overexpressing cells, a full-length human ANGPTL4 gene lentiviral vector was acquired from GenePharma.

    Article Title: CX3CL1 promotes M1 macrophage polarization and osteoclast differentiation via NSUN5-mediated m5C modification.
    Article Snippet: Osteoclast differentiation was achieved through 5 day culture with 50 ng/mL RANKL (R&D Systems, Minneapolis, MN, USA) and 25 ng/mL M-CSF (PeproTech, Rocky Hill, NJ, USA). .. Short hairpin (sh) RNA targeting CX3CL1 (shCX3CL1), shRNA negative control (sh-NC), shRNA targeting NSUN2-7, NSUN5 overexpressing plasmids, CX3CL1 overexpressing plasmids, and empty vector were obtained from Shanghai GenePharma company. .. These plasmids were transfected into RAW264.7 cells using Lipofectamine 3000 (Invitrogen, Carlsbad, CA, USA). shCX3CL1: sense: 5′- A G G A G A T A A A C C C A G T T C A T A-3′; anti-sense: 5′- T A T G A A C T G G G T T T A T C T C C T-3′. shCX3CR1: sense: 5′- C C C T T G C T T A T C A T G A G C T T T-3′; anti-sense: 5′- A A A G C T C A T G A T A A G C A A G G G-3′. shNSUN2: sense: 5′- C C T G A A G A T G A T C C T T T A T T T-3′; anti-sense: 5′- A A A T A A A G G A T C A T C T T C A G G-3′. shNSUN3: sense: 5′- C G G C A A T A A C T G A A C T A T A T T-3′; anti-sense: 5′- A A T A T A G T T C A G T T A T T G C C G3′. shNSUN4: sense: 5′- G C T G G T A A T A C C A A A C C T C A T-3′; anti-sense: 5′- A T G A G G T T T G G T A T T A C C A G C-3′. shNSUN5: sense: 5′- C T G C C T G A G C T T C T T G T A T T T-3′; anti-sense: 5′- A A A T A C A A G A A G C T C A G G C A G-3′. shNSUN6: sense: 5′- C G A T G C A A C A A A G G C A C T T A A-3′; anti-sense: 5′- T T A A G T G C C T T T G T T G C A T C G-3′. shNSUN7: sense: 5′- C A C T C T G T G A A G G C T T T G A T A-3′; anti-sense: 5′- T A T C A A A G C C T T C A C A G A G T G-3′. shNC: sense: 5′- C A A C A A G A T G A A G A G C A C C A A-3′; anti-sense: 5′- T T G G T G C T C T T C A T C T T G T T G-3′.

    shRNA:

    Article Title: Adipocytes-induced ANGPTL4/KLF4 axis drives glycolysis and metastasis in triple-negative breast cancer.
    Article Snippet: .. Transfection and generation of stable cells shRNAs targeting human ANGPTL4, along with a negative control shRNA, were obtained from GenePharma. .. To generate stable ANGPTL4-overexpressing cells, a full-length human ANGPTL4 gene lentiviral vector was acquired from GenePharma.

    Article Title: CX3CL1 promotes M1 macrophage polarization and osteoclast differentiation via NSUN5-mediated m5C modification.
    Article Snippet: Osteoclast differentiation was achieved through 5 day culture with 50 ng/mL RANKL (R&D Systems, Minneapolis, MN, USA) and 25 ng/mL M-CSF (PeproTech, Rocky Hill, NJ, USA). .. Short hairpin (sh) RNA targeting CX3CL1 (shCX3CL1), shRNA negative control (sh-NC), shRNA targeting NSUN2-7, NSUN5 overexpressing plasmids, CX3CL1 overexpressing plasmids, and empty vector were obtained from Shanghai GenePharma company. .. These plasmids were transfected into RAW264.7 cells using Lipofectamine 3000 (Invitrogen, Carlsbad, CA, USA). shCX3CL1: sense: 5′- A G G A G A T A A A C C C A G T T C A T A-3′; anti-sense: 5′- T A T G A A C T G G G T T T A T C T C C T-3′. shCX3CR1: sense: 5′- C C C T T G C T T A T C A T G A G C T T T-3′; anti-sense: 5′- A A A G C T C A T G A T A A G C A A G G G-3′. shNSUN2: sense: 5′- C C T G A A G A T G A T C C T T T A T T T-3′; anti-sense: 5′- A A A T A A A G G A T C A T C T T C A G G-3′. shNSUN3: sense: 5′- C G G C A A T A A C T G A A C T A T A T T-3′; anti-sense: 5′- A A T A T A G T T C A G T T A T T G C C G3′. shNSUN4: sense: 5′- G C T G G T A A T A C C A A A C C T C A T-3′; anti-sense: 5′- A T G A G G T T T G G T A T T A C C A G C-3′. shNSUN5: sense: 5′- C T G C C T G A G C T T C T T G T A T T T-3′; anti-sense: 5′- A A A T A C A A G A A G C T C A G G C A G-3′. shNSUN6: sense: 5′- C G A T G C A A C A A A G G C A C T T A A-3′; anti-sense: 5′- T T A A G T G C C T T T G T T G C A T C G-3′. shNSUN7: sense: 5′- C A C T C T G T G A A G G C T T T G A T A-3′; anti-sense: 5′- T A T C A A A G C C T T C A C A G A G T G-3′. shNC: sense: 5′- C A A C A A G A T G A A G A G C A C C A A-3′; anti-sense: 5′- T T G G T G C T C T T C A T C T T G T T G-3′.

    Plasmid Preparation:

    Article Title: CX3CL1 promotes M1 macrophage polarization and osteoclast differentiation via NSUN5-mediated m5C modification.
    Article Snippet: Osteoclast differentiation was achieved through 5 day culture with 50 ng/mL RANKL (R&D Systems, Minneapolis, MN, USA) and 25 ng/mL M-CSF (PeproTech, Rocky Hill, NJ, USA). .. Short hairpin (sh) RNA targeting CX3CL1 (shCX3CL1), shRNA negative control (sh-NC), shRNA targeting NSUN2-7, NSUN5 overexpressing plasmids, CX3CL1 overexpressing plasmids, and empty vector were obtained from Shanghai GenePharma company. .. These plasmids were transfected into RAW264.7 cells using Lipofectamine 3000 (Invitrogen, Carlsbad, CA, USA). shCX3CL1: sense: 5′- A G G A G A T A A A C C C A G T T C A T A-3′; anti-sense: 5′- T A T G A A C T G G G T T T A T C T C C T-3′. shCX3CR1: sense: 5′- C C C T T G C T T A T C A T G A G C T T T-3′; anti-sense: 5′- A A A G C T C A T G A T A A G C A A G G G-3′. shNSUN2: sense: 5′- C C T G A A G A T G A T C C T T T A T T T-3′; anti-sense: 5′- A A A T A A A G G A T C A T C T T C A G G-3′. shNSUN3: sense: 5′- C G G C A A T A A C T G A A C T A T A T T-3′; anti-sense: 5′- A A T A T A G T T C A G T T A T T G C C G3′. shNSUN4: sense: 5′- G C T G G T A A T A C C A A A C C T C A T-3′; anti-sense: 5′- A T G A G G T T T G G T A T T A C C A G C-3′. shNSUN5: sense: 5′- C T G C C T G A G C T T C T T G T A T T T-3′; anti-sense: 5′- A A A T A C A A G A A G C T C A G G C A G-3′. shNSUN6: sense: 5′- C G A T G C A A C A A A G G C A C T T A A-3′; anti-sense: 5′- T T A A G T G C C T T T G T T G C A T C G-3′. shNSUN7: sense: 5′- C A C T C T G T G A A G G C T T T G A T A-3′; anti-sense: 5′- T A T C A A A G C C T T C A C A G A G T G-3′. shNC: sense: 5′- C A A C A A G A T G A A G A G C A C C A A-3′; anti-sense: 5′- T T G G T G C T C T T C A T C T T G T T G-3′.



    Similar Products

    90
    Thermo Fisher negative control sequence without 5’ overhangs
    KEY RESOURCES TABLE
    Negative Control Sequence Without 5’ Overhangs, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/negative+control+sequence/negative+control+sequence+without+5%E2%80%99+overhangs/pmc12210276-48-0-8
    Average 90 stars, based on 1 article reviews
    negative control sequence without 5’ overhangs - by Bioz Stars, 2026-09
    90/100 stars
      Buy from Supplier

    86
    Sangon Biotech negative control sequence
    KEY RESOURCES TABLE
    Negative Control Sequence, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/negative+control+sequence/control+negative+sirna/pmc13196827-126-15-24
    Average 86 stars, based on 1 article reviews
    negative control sequence - by Bioz Stars, 2026-09
    86/100 stars
      Buy from Supplier

    86
    Gene Tools Inc negative control sequence
    KEY RESOURCES TABLE
    Negative Control Sequence, supplied by Gene Tools Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/negative+control+sequence/control+negative+sequence/pmc13121753-272-25-40
    Average 86 stars, based on 1 article reviews
    negative control sequence - by Bioz Stars, 2026-09
    86/100 stars
      Buy from Supplier

    86
    Sangon Biotech negative control sirna sequence
    KEY RESOURCES TABLE
    Negative Control Sirna Sequence, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/negative+control+sequence/control+negative+sirna/pmc12890841-88-17-26
    Average 86 stars, based on 1 article reviews
    negative control sirna sequence - by Bioz Stars, 2026-09
    86/100 stars
      Buy from Supplier

    86
    Genechem negative control oligonucleotide sequences lv nc
    KEY RESOURCES TABLE
    Negative Control Oligonucleotide Sequences Lv Nc, supplied by Genechem, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/negative+control+sequence/control+negative/pmc12932789-107-5-13
    Average 86 stars, based on 1 article reviews
    negative control oligonucleotide sequences lv nc - by Bioz Stars, 2026-09
    86/100 stars
      Buy from Supplier

    94
    Addgene inc negative control sequence
    KEY RESOURCES TABLE
    Negative Control Sequence, supplied by Addgene inc, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/negative+control+sequence/pEGFPC2-FmnIso1b+(Plasmid+%2319320)/pm41217685-99-8-14
    Average 94 stars, based on 1 article reviews
    negative control sequence - by Bioz Stars, 2026-09
    94/100 stars
      Buy from Supplier

    95
    MedChemExpress sirna sequences
    KEY RESOURCES TABLE
    Sirna Sequences, supplied by MedChemExpress, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/negative+control+sequence/SiRNA+Negative+Control/pm40641109-104-1-45
    Average 95 stars, based on 1 article reviews
    sirna sequences - by Bioz Stars, 2026-09
    95/100 stars
      Buy from Supplier

    90
    Shanghai GenePharma negative control sirna targeting the sequence ttctccgaacgtgtcacgt
    KEY RESOURCES TABLE
    Negative Control Sirna Targeting The Sequence Ttctccgaacgtgtcacgt, supplied by Shanghai GenePharma, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/negative+control+sequence/negative+control+sirna/pmc12001209-103-6-11
    Average 90 stars, based on 1 article reviews
    negative control sirna targeting the sequence ttctccgaacgtgtcacgt - by Bioz Stars, 2026-09
    90/100 stars
      Buy from Supplier

    Image Search Results


    Journal: Neuron

    Article Title: Major Depressive Disorder associated dysregulation of ZBTB7A in orbitofrontal cortex promotes astrocyte-mediated stress susceptibility

    doi: 10.1016/j.neuron.2025.05.023

    Figure Lengend Snippet: KEY RESOURCES TABLE

    Article Snippet: Negative control sequence without 5’ overhangs: GAAATGTACTGCGCGTGGAGACGTTTTGGCCACTGACTGACGTCTCCACGCAGTACATTT , ThermoFisher , Cat # K493600.

    Techniques: Virus, Generated, Cloning, Expressing, Recombinant, Blocking Assay, Plasmid Preparation, Negative Control, Sequencing, Software