Review




Structured Review

Ribobio co pfn1 sirna
<t>PFN1</t> is correlated with NSCLC metastasis and could promote NSCLC cell migration in vitro . (A) Representative IHC images of PFN1 expression on the NSCLC tissues. (B) The staining index of PFN1 on the tissue chip. ** p < 0.01. (C) Representative IHC images of PFN1 expression on the tissue chip. (D) The expression of PFN1 in TCGA LUAD data. ** p < 0.01. (E) The Kaplan–Meier survival analysis of PFN1 in NSCLC patients. (Data source: TCGA LUAD dataset) (F,G) Wound healing assays conducted to evaluate the migration ability of PFN1 -overexpressing (F) and PFN1 knockdown (KD) (G) H1299 cells. ** p < 0.01; scale bar, 500 μm. (H,I) Transwell migration assays conducted to evaluate the migration of PFN1 -overexpressing (H) and PFN1 KD (I) H1299 cells. ** p < 0.01; scale bar, 500 μm. EV, empty vector; OE, PFN1 overexpression; NC, negative control; si-1/ 2, PFN1 siRNA1 1/2.
Pfn1 Sirna, supplied by Ribobio co, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/negative+control+sequence/sirnas+for+pfn1+and+cdc42+knockdown+and+negative+control+sequences++si+nc+/pmc09108340-61-0-10
Average 90 stars, based on 1 article reviews
pfn1 sirna - by Bioz Stars, 2026-09
90/100 stars

Images

1) Product Images from "Profilin 1 Induces Tumor Metastasis by Promoting Microvesicle Secretion Through the ROCK 1/p-MLC Pathway in Non-Small Cell Lung Cancer"

Article Title: Profilin 1 Induces Tumor Metastasis by Promoting Microvesicle Secretion Through the ROCK 1/p-MLC Pathway in Non-Small Cell Lung Cancer

Journal: Frontiers in Pharmacology

doi: 10.3389/fphar.2022.890891

PFN1 is correlated with NSCLC metastasis and could promote NSCLC cell migration in vitro . (A) Representative IHC images of PFN1 expression on the NSCLC tissues. (B) The staining index of PFN1 on the tissue chip. ** p < 0.01. (C) Representative IHC images of PFN1 expression on the tissue chip. (D) The expression of PFN1 in TCGA LUAD data. ** p < 0.01. (E) The Kaplan–Meier survival analysis of PFN1 in NSCLC patients. (Data source: TCGA LUAD dataset) (F,G) Wound healing assays conducted to evaluate the migration ability of PFN1 -overexpressing (F) and PFN1 knockdown (KD) (G) H1299 cells. ** p < 0.01; scale bar, 500 μm. (H,I) Transwell migration assays conducted to evaluate the migration of PFN1 -overexpressing (H) and PFN1 KD (I) H1299 cells. ** p < 0.01; scale bar, 500 μm. EV, empty vector; OE, PFN1 overexpression; NC, negative control; si-1/ 2, PFN1 siRNA1 1/2.
Figure Legend Snippet: PFN1 is correlated with NSCLC metastasis and could promote NSCLC cell migration in vitro . (A) Representative IHC images of PFN1 expression on the NSCLC tissues. (B) The staining index of PFN1 on the tissue chip. ** p < 0.01. (C) Representative IHC images of PFN1 expression on the tissue chip. (D) The expression of PFN1 in TCGA LUAD data. ** p < 0.01. (E) The Kaplan–Meier survival analysis of PFN1 in NSCLC patients. (Data source: TCGA LUAD dataset) (F,G) Wound healing assays conducted to evaluate the migration ability of PFN1 -overexpressing (F) and PFN1 knockdown (KD) (G) H1299 cells. ** p < 0.01; scale bar, 500 μm. (H,I) Transwell migration assays conducted to evaluate the migration of PFN1 -overexpressing (H) and PFN1 KD (I) H1299 cells. ** p < 0.01; scale bar, 500 μm. EV, empty vector; OE, PFN1 overexpression; NC, negative control; si-1/ 2, PFN1 siRNA1 1/2.

Techniques Used: Migration, In Vitro, Expressing, Staining, Knockdown, Plasmid Preparation, Over Expression, Negative Control

PFN1 could promote MVs secretion in NSCLC. (A) Heatmap of differentially expressed proteins between EV and PFN1 OE cells. (B) GO enrichment analysis of differentially expressed proteins. (C) COG/KOG analysis of differentially expressed proteins. (D) MVs extracted from EV-expressing and PFN1 -overexpressing cells, using continuous differential centrifugation, identified using transmission electron microscopy. Scale bar, 100 nm. (E,F) Flow cytometry (E) and western blotting (F) were used to quantify MVs in PFN1 -overexpressing and EV-expressing cells. ARF6 and actin were used as MV markers. (G) Expression of PFN1 and annexin A1 in lung tumor tissues detected using immunofluorescence. (H) The staining index of p-MLC on the tissue chip. ** p < 0.01. (I) Representative IHC images of p-MLC expression. (J) Spearman rank correlation analysis was used to assess the relationship between PFN1 and p-MLC expression on the tissue chip; p and r values are shown in the plot.
Figure Legend Snippet: PFN1 could promote MVs secretion in NSCLC. (A) Heatmap of differentially expressed proteins between EV and PFN1 OE cells. (B) GO enrichment analysis of differentially expressed proteins. (C) COG/KOG analysis of differentially expressed proteins. (D) MVs extracted from EV-expressing and PFN1 -overexpressing cells, using continuous differential centrifugation, identified using transmission electron microscopy. Scale bar, 100 nm. (E,F) Flow cytometry (E) and western blotting (F) were used to quantify MVs in PFN1 -overexpressing and EV-expressing cells. ARF6 and actin were used as MV markers. (G) Expression of PFN1 and annexin A1 in lung tumor tissues detected using immunofluorescence. (H) The staining index of p-MLC on the tissue chip. ** p < 0.01. (I) Representative IHC images of p-MLC expression. (J) Spearman rank correlation analysis was used to assess the relationship between PFN1 and p-MLC expression on the tissue chip; p and r values are shown in the plot.

Techniques Used: Expressing, Centrifugation, Transmission Assay, Electron Microscopy, Flow Cytometry, Western Blot, Immunofluorescence, Staining

MVs derived from PFN1 OE cells promote migration in NSCLC cells. (A) MVs collected from sera of patients with NSCLC quantified using flow cytometry. ** p < 0.01. (B) Protein expression of ARF6 and β-actin in MVs collected from sera of patients with NSCLC detected using western blotting. (C) Effect of PFN1 -overexpressing cell supernatants on cell migration evaluated through wound healing assays. ** p < 0.01; scale bar, 500 μm. (D) PKH67-labeled MVs taken up by H1299 cells. DAPI was used to stain the nuclei of H1299 cells. Scale bar, 500 μm. (E,F) Wound healing (E) and Transwell migration (F) assays conducted to evaluate the migration of H1299 cells after treatment with MVs derived from EV-expressing and PFN1 -overexpressing cells; ** p < 0.01; scale bar, 500 μm.
Figure Legend Snippet: MVs derived from PFN1 OE cells promote migration in NSCLC cells. (A) MVs collected from sera of patients with NSCLC quantified using flow cytometry. ** p < 0.01. (B) Protein expression of ARF6 and β-actin in MVs collected from sera of patients with NSCLC detected using western blotting. (C) Effect of PFN1 -overexpressing cell supernatants on cell migration evaluated through wound healing assays. ** p < 0.01; scale bar, 500 μm. (D) PKH67-labeled MVs taken up by H1299 cells. DAPI was used to stain the nuclei of H1299 cells. Scale bar, 500 μm. (E,F) Wound healing (E) and Transwell migration (F) assays conducted to evaluate the migration of H1299 cells after treatment with MVs derived from EV-expressing and PFN1 -overexpressing cells; ** p < 0.01; scale bar, 500 μm.

Techniques Used: Derivative Assay, Migration, Flow Cytometry, Expressing, Western Blot, Labeling, Staining

PFN1 promotes in vivo NSCLC metastasis by elevating MV secretion. (A) Schematic illustration of the mouse model of metastatic tumor established to determine the role of PFN1 in tumor metastasis. (B) Body weight changes in mice after intracardiac injection of PFN1 -overexpressing and EV-expressing cell lines. (C,D) Representative images of lung (C) and liver (D) metastases of the mouse model. The number of metastases is displayed in the right-hand side graph. * p < 0.05, ** p < 0.01. (E) Representative images of HE-stained lung tissues of the mouse model. (F) Representative IHC images of PFN1 and p-MLC expression in lung tissues. The staining index is shown in the right-hand side graph. ** p < 0.01. (G) Representative images of HE-stained liver tissues of the mouse model. (H) Representative IHC images of PFN1 and p-MLC expression in liver tissues. The staining index is shown in the right-hand side graph. ** p < 0.01. (I) Body weight changes in mice after intracardiac injection of H1299 cells and MVs. (J) Representative images of lung metastases of the mouse model. The number of metastases is shown in the bottom graph. * p < 0.05. (K) Representative images of HE-stained lung tissues of the mouse model. (L) Representative IHC images of PFN1 and p-MLC expression in lung tissues. The staining index is shown in the right-hand side graph; * p < 0.05.
Figure Legend Snippet: PFN1 promotes in vivo NSCLC metastasis by elevating MV secretion. (A) Schematic illustration of the mouse model of metastatic tumor established to determine the role of PFN1 in tumor metastasis. (B) Body weight changes in mice after intracardiac injection of PFN1 -overexpressing and EV-expressing cell lines. (C,D) Representative images of lung (C) and liver (D) metastases of the mouse model. The number of metastases is displayed in the right-hand side graph. * p < 0.05, ** p < 0.01. (E) Representative images of HE-stained lung tissues of the mouse model. (F) Representative IHC images of PFN1 and p-MLC expression in lung tissues. The staining index is shown in the right-hand side graph. ** p < 0.01. (G) Representative images of HE-stained liver tissues of the mouse model. (H) Representative IHC images of PFN1 and p-MLC expression in liver tissues. The staining index is shown in the right-hand side graph. ** p < 0.01. (I) Body weight changes in mice after intracardiac injection of H1299 cells and MVs. (J) Representative images of lung metastases of the mouse model. The number of metastases is shown in the bottom graph. * p < 0.05. (K) Representative images of HE-stained lung tissues of the mouse model. (L) Representative IHC images of PFN1 and p-MLC expression in lung tissues. The staining index is shown in the right-hand side graph; * p < 0.05.

Techniques Used: In Vivo, Injection, Expressing, Staining

Mechanisms underlying the promotion of MLC phosphorylation by PFN1. (A,B) Protein expression after PFN1 overexpression (A) and knockdown (B) measured using western blotting. (C) Protein expression in PFN1 mutants measured using western blotting. (D) PFN1 interactions with ROCK1/2 confirmed using co-IP. (E) Protein expression after treatment with Y27632 (10 µM) measured using western blotting. (F) Effect of PFN1 on ROCK1 activity. ** p < 0.01. (G) Effect of PFN1 on ROCK2 activity. (H) Flow cytometry measuring changes in the amount of MVs after treatment with Y27632; * p < 0.05.
Figure Legend Snippet: Mechanisms underlying the promotion of MLC phosphorylation by PFN1. (A,B) Protein expression after PFN1 overexpression (A) and knockdown (B) measured using western blotting. (C) Protein expression in PFN1 mutants measured using western blotting. (D) PFN1 interactions with ROCK1/2 confirmed using co-IP. (E) Protein expression after treatment with Y27632 (10 µM) measured using western blotting. (F) Effect of PFN1 on ROCK1 activity. ** p < 0.01. (G) Effect of PFN1 on ROCK2 activity. (H) Flow cytometry measuring changes in the amount of MVs after treatment with Y27632; * p < 0.05.

Techniques Used: Phospho-proteomics, Expressing, Over Expression, Knockdown, Western Blot, Co-Immunoprecipitation Assay, Activity Assay, Flow Cytometry

ROCK1 inhibitor Y27632 partially reversed the promotion of lung cancer metastasis by PFN1 in vitro and in vivo . (A,B) Wound healing assays conducted to evaluate the effect of Y27632 (A) and Y27632 combined with MVs (B) on cell migration. ** p < 0.01; scale bar, 500 μm. (C) Transwell migration assays conducted to evaluate the effect of Y27632 and Y27632 combined with MVs on cell migration. ** p < 0.01; scale bar, 500 μm. (D) Schematic diagram of the mouse model of metastatic tumor established to determine the effect of Y27632 on PFN1-induced lung cancer metastasis. (E) Body weight changes in mice after intracardiac injection of PFN1 -overexpressing H1299 cells and intraperitoneal injection of Y27632 (10 mg/kg). (F) Representative images of lung and liver metastatic tissue in mice. The number of metastatic nodules is shown in the right-hand side graph. * p < 0.05. (G,H) Representative images of HE-stained lung (G) and liver (H) metastases. (I) Representative IHC images of PFN1 and p-MLC expression in lung tissues. The staining index is shown in the right-hand side graph. ** p < 0.01. (J) Representative IHC images of PFN1 and p-MLC expression in liver tissues. The staining index is shown in the right-hand side graph; ** p < 0.01.
Figure Legend Snippet: ROCK1 inhibitor Y27632 partially reversed the promotion of lung cancer metastasis by PFN1 in vitro and in vivo . (A,B) Wound healing assays conducted to evaluate the effect of Y27632 (A) and Y27632 combined with MVs (B) on cell migration. ** p < 0.01; scale bar, 500 μm. (C) Transwell migration assays conducted to evaluate the effect of Y27632 and Y27632 combined with MVs on cell migration. ** p < 0.01; scale bar, 500 μm. (D) Schematic diagram of the mouse model of metastatic tumor established to determine the effect of Y27632 on PFN1-induced lung cancer metastasis. (E) Body weight changes in mice after intracardiac injection of PFN1 -overexpressing H1299 cells and intraperitoneal injection of Y27632 (10 mg/kg). (F) Representative images of lung and liver metastatic tissue in mice. The number of metastatic nodules is shown in the right-hand side graph. * p < 0.05. (G,H) Representative images of HE-stained lung (G) and liver (H) metastases. (I) Representative IHC images of PFN1 and p-MLC expression in lung tissues. The staining index is shown in the right-hand side graph. ** p < 0.01. (J) Representative IHC images of PFN1 and p-MLC expression in liver tissues. The staining index is shown in the right-hand side graph; ** p < 0.01.

Techniques Used: In Vitro, In Vivo, Migration, Injection, Staining, Expressing

Schematic diagram of the role of PFN1 in NSCLC metastasis. In the initiation stage of NSCLC, cells with upregulated PFN1 secret more MVs through PFN1 interactions with the ROCK/p-MLC pathway. These MVs contain numerous oncogenenic moleculars, which could enhance migration abilities of PFN1 normal expressed NSCLC cells, and untimately promote progression and metastasis of NSCLC.
Figure Legend Snippet: Schematic diagram of the role of PFN1 in NSCLC metastasis. In the initiation stage of NSCLC, cells with upregulated PFN1 secret more MVs through PFN1 interactions with the ROCK/p-MLC pathway. These MVs contain numerous oncogenenic moleculars, which could enhance migration abilities of PFN1 normal expressed NSCLC cells, and untimately promote progression and metastasis of NSCLC.

Techniques Used: Migration

Related Articles

Control:

Article Title: Profilin 1 Induces Tumor Metastasis by Promoting Microvesicle Secretion Through the ROCK 1/p-MLC Pathway in Non-Small Cell Lung Cancer
Article Snippet: ROCK1 pcDNA3.1-HA-C was purchased from You Bao Biology (Changsha, China). .. PFN1 siRNA and control scramble siRNA were synthesized by Guangzhou RiboBio Co. (Guangzhou, China), and the sequences are listed in . .. Plasmids and siRNAs were transfected into cells using LipofectamineTM 3000 Transfection Reagent (Invitrogen, Waltham, MA, United States) according to the manufacturer’s instructions.

Article Title: LncRNA MYLK antisense RNA 1 activates cell division cycle 42/Neutal Wiskott-Aldrich syndrome protein pathway via microRNA-101-5p to accelerate epithelial-to-mesenchymal transition of colon cancer cells.
Article Snippet: .. The virus-containing medium was filtered through a 0.22 μm filter and stored at 80 C. Small interfering RNA targeting CDC42 plasmid and normal control were purchased from RiboBio (Guangzhou, China). .. Transfection was performed using lipofectamine 3000 (Invitrogen) according to the manufacturer's instructions.

Synthesized:

Article Title: Profilin 1 Induces Tumor Metastasis by Promoting Microvesicle Secretion Through the ROCK 1/p-MLC Pathway in Non-Small Cell Lung Cancer
Article Snippet: ROCK1 pcDNA3.1-HA-C was purchased from You Bao Biology (Changsha, China). .. PFN1 siRNA and control scramble siRNA were synthesized by Guangzhou RiboBio Co. (Guangzhou, China), and the sequences are listed in . .. Plasmids and siRNAs were transfected into cells using LipofectamineTM 3000 Transfection Reagent (Invitrogen, Waltham, MA, United States) according to the manufacturer’s instructions.

Article Title: PFN1 Inhibits Myogenesis of Bovine Myoblast Cells via Cdc42-PAK/JNK.
Article Snippet: .. The siRNAs for PFN1 and Cdc42 knockdown and negative control sequences (si-NC) were synthesized by RiboBio (Guangzhou, China); the siRNA sequences are listed in Supplementary Table S2. .. The cells with 60–70% confluence in growth medium were transfected with plasmid or siRNA using Lipofectamine 3000 (Invitrogen, Waltham, MA, USA).

Article Title: PFN1 Inhibits Myogenesis of Bovine Myoblast Cells via Cdc42-PAK/JNK
Article Snippet: .. The siRNAs for PFN1 and Cdc42 knockdown and negative control sequences (si-NC) were synthesized by RiboBio (Guangzhou, China); the siRNA sequences are listed in . .. The cells with 60–70% confluence in growth medium were transfected with plasmid or siRNA using Lipofectamine 3000 (Invitrogen, Waltham, MA, USA).

Knockdown:

Article Title: PFN1 Inhibits Myogenesis of Bovine Myoblast Cells via Cdc42-PAK/JNK.
Article Snippet: .. The siRNAs for PFN1 and Cdc42 knockdown and negative control sequences (si-NC) were synthesized by RiboBio (Guangzhou, China); the siRNA sequences are listed in Supplementary Table S2. .. The cells with 60–70% confluence in growth medium were transfected with plasmid or siRNA using Lipofectamine 3000 (Invitrogen, Waltham, MA, USA).

Article Title: PFN1 Inhibits Myogenesis of Bovine Myoblast Cells via Cdc42-PAK/JNK
Article Snippet: .. The siRNAs for PFN1 and Cdc42 knockdown and negative control sequences (si-NC) were synthesized by RiboBio (Guangzhou, China); the siRNA sequences are listed in . .. The cells with 60–70% confluence in growth medium were transfected with plasmid or siRNA using Lipofectamine 3000 (Invitrogen, Waltham, MA, USA).

Negative Control:

Article Title: PFN1 Inhibits Myogenesis of Bovine Myoblast Cells via Cdc42-PAK/JNK.
Article Snippet: .. The siRNAs for PFN1 and Cdc42 knockdown and negative control sequences (si-NC) were synthesized by RiboBio (Guangzhou, China); the siRNA sequences are listed in Supplementary Table S2. .. The cells with 60–70% confluence in growth medium were transfected with plasmid or siRNA using Lipofectamine 3000 (Invitrogen, Waltham, MA, USA).

Article Title: Rho GTPases in A549 and Caco-2 cells dominating the endocytic pathways of nanocarbons with different morphologies
Article Snippet: .. The siRNA specifically targeting human Cdc42, Rac1, RhoA, and universal negative control siRNA were purchased from RiboBio Co., Ltd. (Guangzhou, China). .. Rabbit monoclonal antibody of CDC42 (ab187643), mouse monoclonal antibody of Rac1 (ab33186), and rabbit monoclonal antibody of RhoA (ab187027) were purchased from Abcam (Cambridge, UK).

Article Title: A novel Cdc42-YAP-fibronectin signaling axis regulates ameloblast differentiation during early enamel formation.
Article Snippet: This is a PDF file of an article that has undergone enhancements after acceptance, such as the addition of a cover page and metadata, and formatting for readability, but it is not yet the definitive version of record.. This version will undergo additional copyediting, typesetting and review before it is published in its final form, but we are providing this version to give early visibility of the article.. Please note that, during the production process, errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.

Article Title: PFN1 Inhibits Myogenesis of Bovine Myoblast Cells via Cdc42-PAK/JNK
Article Snippet: .. The siRNAs for PFN1 and Cdc42 knockdown and negative control sequences (si-NC) were synthesized by RiboBio (Guangzhou, China); the siRNA sequences are listed in . .. The cells with 60–70% confluence in growth medium were transfected with plasmid or siRNA using Lipofectamine 3000 (Invitrogen, Waltham, MA, USA).

Virus:

Article Title: LncRNA MYLK antisense RNA 1 activates cell division cycle 42/Neutal Wiskott-Aldrich syndrome protein pathway via microRNA-101-5p to accelerate epithelial-to-mesenchymal transition of colon cancer cells.
Article Snippet: .. The virus-containing medium was filtered through a 0.22 μm filter and stored at 80 C. Small interfering RNA targeting CDC42 plasmid and normal control were purchased from RiboBio (Guangzhou, China). .. Transfection was performed using lipofectamine 3000 (Invitrogen) according to the manufacturer's instructions.

Small Interfering RNA:

Article Title: LncRNA MYLK antisense RNA 1 activates cell division cycle 42/Neutal Wiskott-Aldrich syndrome protein pathway via microRNA-101-5p to accelerate epithelial-to-mesenchymal transition of colon cancer cells.
Article Snippet: .. The virus-containing medium was filtered through a 0.22 μm filter and stored at 80 C. Small interfering RNA targeting CDC42 plasmid and normal control were purchased from RiboBio (Guangzhou, China). .. Transfection was performed using lipofectamine 3000 (Invitrogen) according to the manufacturer's instructions.

Plasmid Preparation:

Article Title: LncRNA MYLK antisense RNA 1 activates cell division cycle 42/Neutal Wiskott-Aldrich syndrome protein pathway via microRNA-101-5p to accelerate epithelial-to-mesenchymal transition of colon cancer cells.
Article Snippet: .. The virus-containing medium was filtered through a 0.22 μm filter and stored at 80 C. Small interfering RNA targeting CDC42 plasmid and normal control were purchased from RiboBio (Guangzhou, China). .. Transfection was performed using lipofectamine 3000 (Invitrogen) according to the manufacturer's instructions.

other:

Article Title: Mechanisms of Cdc42-mediated rat MSC differentiation on micro/nano-textured topography.
Article Snippet: siRNA to Cdc42 was synthesized by RiboBio Co., Ltd. (Guangzhou, China).

Infection:

Article Title: A novel Cdc42-YAP-fibronectin signaling axis regulates ameloblast differentiation during early enamel formation.
Article Snippet: This is a PDF file of an article that has undergone enhancements after acceptance, such as the addition of a cover page and metadata, and formatting for readability, but it is not yet the definitive version of record.. This version will undergo additional copyediting, typesetting and review before it is published in its final form, but we are providing this version to give early visibility of the article.. Please note that, during the production process, errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.



Similar Products

90
Thermo Fisher negative control sequence without 5’ overhangs
KEY RESOURCES TABLE
Negative Control Sequence Without 5’ Overhangs, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/negative+control+sequence/negative+control+sequence+without+5%E2%80%99+overhangs/pmc12210276-48-0-8
Average 90 stars, based on 1 article reviews
negative control sequence without 5’ overhangs - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

86
Sangon Biotech negative control sequence
KEY RESOURCES TABLE
Negative Control Sequence, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/negative+control+sequence/control+negative+sirna/pmc13196827-126-15-24
Average 86 stars, based on 1 article reviews
negative control sequence - by Bioz Stars, 2026-09
86/100 stars
  Buy from Supplier

86
Gene Tools Inc negative control sequence
KEY RESOURCES TABLE
Negative Control Sequence, supplied by Gene Tools Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/negative+control+sequence/control+negative+sequence/pmc13121753-272-25-40
Average 86 stars, based on 1 article reviews
negative control sequence - by Bioz Stars, 2026-09
86/100 stars
  Buy from Supplier

86
Sangon Biotech negative control sirna sequence
KEY RESOURCES TABLE
Negative Control Sirna Sequence, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/negative+control+sequence/control+negative+sirna/pmc12890841-88-17-26
Average 86 stars, based on 1 article reviews
negative control sirna sequence - by Bioz Stars, 2026-09
86/100 stars
  Buy from Supplier

86
Genechem negative control oligonucleotide sequences lv nc
KEY RESOURCES TABLE
Negative Control Oligonucleotide Sequences Lv Nc, supplied by Genechem, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/negative+control+sequence/control+negative/pmc12932789-107-5-13
Average 86 stars, based on 1 article reviews
negative control oligonucleotide sequences lv nc - by Bioz Stars, 2026-09
86/100 stars
  Buy from Supplier

94
Addgene inc negative control sequence
KEY RESOURCES TABLE
Negative Control Sequence, supplied by Addgene inc, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/negative+control+sequence/pEGFPC2-FmnIso1b+(Plasmid+%2319320)/pm41217685-99-8-14
Average 94 stars, based on 1 article reviews
negative control sequence - by Bioz Stars, 2026-09
94/100 stars
  Buy from Supplier

95
MedChemExpress sirna sequences
KEY RESOURCES TABLE
Sirna Sequences, supplied by MedChemExpress, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/negative+control+sequence/SiRNA+Negative+Control/pm40641109-104-1-45
Average 95 stars, based on 1 article reviews
sirna sequences - by Bioz Stars, 2026-09
95/100 stars
  Buy from Supplier

90
Shanghai GenePharma negative control sirna targeting the sequence ttctccgaacgtgtcacgt
KEY RESOURCES TABLE
Negative Control Sirna Targeting The Sequence Ttctccgaacgtgtcacgt, supplied by Shanghai GenePharma, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/negative+control+sequence/negative+control+sirna/pmc12001209-103-6-11
Average 90 stars, based on 1 article reviews
negative control sirna targeting the sequence ttctccgaacgtgtcacgt - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

Image Search Results


Journal: Neuron

Article Title: Major Depressive Disorder associated dysregulation of ZBTB7A in orbitofrontal cortex promotes astrocyte-mediated stress susceptibility

doi: 10.1016/j.neuron.2025.05.023

Figure Lengend Snippet: KEY RESOURCES TABLE

Article Snippet: Negative control sequence without 5’ overhangs: GAAATGTACTGCGCGTGGAGACGTTTTGGCCACTGACTGACGTCTCCACGCAGTACATTT , ThermoFisher , Cat # K493600.

Techniques: Virus, Generated, Cloning, Expressing, Recombinant, Blocking Assay, Plasmid Preparation, Negative Control, Sequencing, Software