Review




Structured Review

Shanghai GenePharma negative control mir sequences
Upregulation of <t>miR-150</t> suppresses human papillary thyroid carcinoma cell proliferation and metastasis. (A) Relative miR-150 expression in TPC-1 cells following transfection. (B) Proliferation of TPC-1 cells following transfection. (C) Representative micrographs of a wound-healing assay in TPC-1 cells following transfection (Scale bars=50 µm). (D) Representative micrographs of Transwell invasion experiments in TPC-1 cells following transfection (Scale bars=50 µm). (E) Statistical analysis of the wound-healing assay results. (F) Statistical analysis of the Transwell invasion assay results. *P<0.05 vs. mimic-Con, **P<0.01 vs. mimic-Con. miR-150, microRNA-150; mimic-Con, <t>negative</t> <t>control</t> transfection; OD, optical density.
Negative Control Mir Sequences, supplied by Shanghai GenePharma, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/negative+control+sequence/negative+control+mir+sequences/pmc05995047-33-4-12
Average 90 stars, based on 1 article reviews
negative control mir sequences - by Bioz Stars, 2026-09
90/100 stars

Images

1) Product Images from "MicroRNA-150 suppresses the growth and malignant behavior of papillary thyroid carcinoma cells via downregulation of MUC4"

Article Title: MicroRNA-150 suppresses the growth and malignant behavior of papillary thyroid carcinoma cells via downregulation of MUC4

Journal: Experimental and Therapeutic Medicine

doi: 10.3892/etm.2018.6197

Upregulation of miR-150 suppresses human papillary thyroid carcinoma cell proliferation and metastasis. (A) Relative miR-150 expression in TPC-1 cells following transfection. (B) Proliferation of TPC-1 cells following transfection. (C) Representative micrographs of a wound-healing assay in TPC-1 cells following transfection (Scale bars=50 µm). (D) Representative micrographs of Transwell invasion experiments in TPC-1 cells following transfection (Scale bars=50 µm). (E) Statistical analysis of the wound-healing assay results. (F) Statistical analysis of the Transwell invasion assay results. *P<0.05 vs. mimic-Con, **P<0.01 vs. mimic-Con. miR-150, microRNA-150; mimic-Con, negative control transfection; OD, optical density.
Figure Legend Snippet: Upregulation of miR-150 suppresses human papillary thyroid carcinoma cell proliferation and metastasis. (A) Relative miR-150 expression in TPC-1 cells following transfection. (B) Proliferation of TPC-1 cells following transfection. (C) Representative micrographs of a wound-healing assay in TPC-1 cells following transfection (Scale bars=50 µm). (D) Representative micrographs of Transwell invasion experiments in TPC-1 cells following transfection (Scale bars=50 µm). (E) Statistical analysis of the wound-healing assay results. (F) Statistical analysis of the Transwell invasion assay results. *P<0.05 vs. mimic-Con, **P<0.01 vs. mimic-Con. miR-150, microRNA-150; mimic-Con, negative control transfection; OD, optical density.

Techniques Used: Expressing, Transfection, Wound Healing Assay, Transwell Invasion Assay, Negative Control

MUC4 is a direct target of miR-150 in papillary thyroid carcinoma cells. (A) miR-150 and its target site in MUC4 3′-UTR. The mutant bases are indicated by boxes. (B) Luciferase reporter assay in TPC-1 cells transfected with reporter vectors containing WT or MUT MUC4 3′-UTR. (C) MUC4 mRNA expression was evaluated by reverse transcription-quantitative polymerase chain reaction in TPC-1 cells transfected with miR-150 mimics and mimic-Con. (D) MUC4 protein expression was evaluated by western blot analysis in TPC-1 cells transfected with miR-150 mimics and mimic-Con. (E) Densitometric analysis of MUC4 protein level. *P<0.05 vs. control; **P<0.01 vs. mimic-Con. miR-150, microRNA-150; mimic-Con, negative control transfection; MUC4, mucin 4; 3′-UTR, 3′-untranslated region; NC, negative control; WT, wild type; MUT, mutated.
Figure Legend Snippet: MUC4 is a direct target of miR-150 in papillary thyroid carcinoma cells. (A) miR-150 and its target site in MUC4 3′-UTR. The mutant bases are indicated by boxes. (B) Luciferase reporter assay in TPC-1 cells transfected with reporter vectors containing WT or MUT MUC4 3′-UTR. (C) MUC4 mRNA expression was evaluated by reverse transcription-quantitative polymerase chain reaction in TPC-1 cells transfected with miR-150 mimics and mimic-Con. (D) MUC4 protein expression was evaluated by western blot analysis in TPC-1 cells transfected with miR-150 mimics and mimic-Con. (E) Densitometric analysis of MUC4 protein level. *P<0.05 vs. control; **P<0.01 vs. mimic-Con. miR-150, microRNA-150; mimic-Con, negative control transfection; MUC4, mucin 4; 3′-UTR, 3′-untranslated region; NC, negative control; WT, wild type; MUT, mutated.

Techniques Used: Mutagenesis, Luciferase, Reporter Assay, Transfection, Expressing, Reverse Transcription, Real-time Polymerase Chain Reaction, Western Blot, Control, Negative Control

Effect of miR-150 on HER2 and downstream FAK/ERK signaling. (A) Protein levels were evaluated by western blot analysis. (B) Densitometric analysis of each protein level. **P<0.01 vs. mimic-Con. miR-150, microRNA-150; mimic-Con, negative control transfection; HER2, human epidermal growth factor receptor 2; FAK, focal adhesion kinase; ERK, extracellular signal-regulated kinase.
Figure Legend Snippet: Effect of miR-150 on HER2 and downstream FAK/ERK signaling. (A) Protein levels were evaluated by western blot analysis. (B) Densitometric analysis of each protein level. **P<0.01 vs. mimic-Con. miR-150, microRNA-150; mimic-Con, negative control transfection; HER2, human epidermal growth factor receptor 2; FAK, focal adhesion kinase; ERK, extracellular signal-regulated kinase.

Techniques Used: Western Blot, Negative Control, Transfection

Related Articles

other:

Article Title: PEP06 polypeptide 30 exerts antitumour effect in colorectal carcinoma via inhibiting epithelial–mesenchymal transition
Article Snippet: MiR‐146b‐5p‐expressing lentiviruses (miR‐146b‐OE) and its negative control (miR‐Ctl) containing the GFP were packaged by Shanghai GenePharma Co., Ltd. SW620 cells (5 × 10 4 ) were seeded in six‐well plates and cultured to about 90% confluence.

Article Title: microRNA-155 silencing inhibits proliferation and migration and induces apoptosis by upregulating BACH1 in renal cancer cells.
Article Snippet: ACHN cells were transfected with antisense-miR-155 oligonucleotide (As-miR-155), a negative control (miR-CON) (Shanghai GenePharma Co, Ltd. China) or an empty vector (blank) using Lipofectamine 2000TM (Invitrogen) following 24 h of cell seeding.

Negative Control:

Article Title: MicroRNA-150 suppresses the growth and malignant behavior of papillary thyroid carcinoma cells via downregulation of MUC4
Article Snippet: .. miR-150 mimics (5′-UCUCCCAACCCUUGUACCAGUG-3′) and negative control miR sequences (5′-CCGAAACCUCGGUUGAUUGCGG-3′) were purchased from Shanghai GenePharma Co., Ltd. (Shanghai, China). .. Lipofectamine 2000 (Invitrogen; Thermo Fisher Scientific, Inc.) was used to perform TPC-1 cell transfection, according to the manufacturer's protocol.

Article Title: MicroRNA-150 suppresses the growth and malignant behavior of papillary thyroid carcinoma cells via downregulation of MUC4.
Article Snippet: .. Cell transfection. miR-150 mimics (5'-UCU CCC AAC CCU UGU ACC AGUG-3') and negative control miR sequences (5'-CCG AAA CCU CGG UUG AUU GCGG-3') were purchased from Shanghai GenePharma Co., Ltd. (Shanghai, China). .. Lipofectamine 2000 (Invitrogen; Thermo Fisher Scientific, Inc.) was used to perform TPC-1 cell transfection, according to the manufacturer's protocol.

Transfection:

Article Title: MicroRNA-150 suppresses the growth and malignant behavior of papillary thyroid carcinoma cells via downregulation of MUC4.
Article Snippet: .. Cell transfection. miR-150 mimics (5'-UCU CCC AAC CCU UGU ACC AGUG-3') and negative control miR sequences (5'-CCG AAA CCU CGG UUG AUU GCGG-3') were purchased from Shanghai GenePharma Co., Ltd. (Shanghai, China). .. Lipofectamine 2000 (Invitrogen; Thermo Fisher Scientific, Inc.) was used to perform TPC-1 cell transfection, according to the manufacturer's protocol.

Countercurrent Chromatography:

Article Title: MicroRNA-150 suppresses the growth and malignant behavior of papillary thyroid carcinoma cells via downregulation of MUC4.
Article Snippet: .. Cell transfection. miR-150 mimics (5'-UCU CCC AAC CCU UGU ACC AGUG-3') and negative control miR sequences (5'-CCG AAA CCU CGG UUG AUU GCGG-3') were purchased from Shanghai GenePharma Co., Ltd. (Shanghai, China). .. Lipofectamine 2000 (Invitrogen; Thermo Fisher Scientific, Inc.) was used to perform TPC-1 cell transfection, according to the manufacturer's protocol.



Similar Products

90
Thermo Fisher negative control sequence without 5’ overhangs
KEY RESOURCES TABLE
Negative Control Sequence Without 5’ Overhangs, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/negative+control+sequence/negative+control+sequence+without+5%E2%80%99+overhangs/pmc12210276-48-0-8
Average 90 stars, based on 1 article reviews
negative control sequence without 5’ overhangs - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

86
Sangon Biotech negative control sequence
KEY RESOURCES TABLE
Negative Control Sequence, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/negative+control+sequence/control+negative+sirna/pmc13196827-126-15-24
Average 86 stars, based on 1 article reviews
negative control sequence - by Bioz Stars, 2026-09
86/100 stars
  Buy from Supplier

86
Gene Tools Inc negative control sequence
KEY RESOURCES TABLE
Negative Control Sequence, supplied by Gene Tools Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/negative+control+sequence/control+negative+sequence/pmc13121753-272-25-40
Average 86 stars, based on 1 article reviews
negative control sequence - by Bioz Stars, 2026-09
86/100 stars
  Buy from Supplier

86
Sangon Biotech negative control sirna sequence
KEY RESOURCES TABLE
Negative Control Sirna Sequence, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/negative+control+sequence/control+negative+sirna/pmc12890841-88-17-26
Average 86 stars, based on 1 article reviews
negative control sirna sequence - by Bioz Stars, 2026-09
86/100 stars
  Buy from Supplier

86
Genechem negative control oligonucleotide sequences lv nc
KEY RESOURCES TABLE
Negative Control Oligonucleotide Sequences Lv Nc, supplied by Genechem, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/negative+control+sequence/control+negative/pmc12932789-107-5-13
Average 86 stars, based on 1 article reviews
negative control oligonucleotide sequences lv nc - by Bioz Stars, 2026-09
86/100 stars
  Buy from Supplier

94
Addgene inc negative control sequence
KEY RESOURCES TABLE
Negative Control Sequence, supplied by Addgene inc, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/negative+control+sequence/pEGFPC2-FmnIso1b+(Plasmid+%2319320)/pm41217685-99-8-14
Average 94 stars, based on 1 article reviews
negative control sequence - by Bioz Stars, 2026-09
94/100 stars
  Buy from Supplier

95
MedChemExpress sirna sequences
KEY RESOURCES TABLE
Sirna Sequences, supplied by MedChemExpress, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/negative+control+sequence/SiRNA+Negative+Control/pm40641109-104-1-45
Average 95 stars, based on 1 article reviews
sirna sequences - by Bioz Stars, 2026-09
95/100 stars
  Buy from Supplier

90
Shanghai GenePharma negative control sirna targeting the sequence ttctccgaacgtgtcacgt
KEY RESOURCES TABLE
Negative Control Sirna Targeting The Sequence Ttctccgaacgtgtcacgt, supplied by Shanghai GenePharma, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/negative+control+sequence/negative+control+sirna/pmc12001209-103-6-11
Average 90 stars, based on 1 article reviews
negative control sirna targeting the sequence ttctccgaacgtgtcacgt - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

Image Search Results


Journal: Neuron

Article Title: Major Depressive Disorder associated dysregulation of ZBTB7A in orbitofrontal cortex promotes astrocyte-mediated stress susceptibility

doi: 10.1016/j.neuron.2025.05.023

Figure Lengend Snippet: KEY RESOURCES TABLE

Article Snippet: Negative control sequence without 5’ overhangs: GAAATGTACTGCGCGTGGAGACGTTTTGGCCACTGACTGACGTCTCCACGCAGTACATTT , ThermoFisher , Cat # K493600.

Techniques: Virus, Generated, Cloning, Expressing, Recombinant, Blocking Assay, Plasmid Preparation, Negative Control, Sequencing, Software