negative control (shctrl) (Genechem)
90
Structured Review
Genechem
negative control (shctrl)
Negative Control (Shctrl), supplied by Genechem, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/negative+control+(shctrl)/negative+control++nc+/pm40016746-52-14-17
Average 90 stars, based on 1 article reviews
Negative Control (Shctrl), supplied by Genechem, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/negative+control+(shctrl)/negative+control++nc+/pm40016746-52-14-17
Average 90 stars, based on 1 article reviews
negative control (shctrl) - by Bioz Stars,
2026-10
90/100 stars
Images
Related Articles
Over Expression:Article Title: Exosomal AFAP1-AS1 Promotes the Growth, Metastasis, and Glycolysis of Pituitary Adenoma by Inhibiting HuR Degradation Article Snippet: Short hairpin RNA (shRNA) targeting AFAP1-AS1 (sh-AFAP1-AS1-1: CCGGGAGTACATCACCTCAAATTATCTCGAGATAATTTGAGGTGATGTACTC-TTTTTT; sh-AFAP1-AS1-2: CCGGAGGCAGAACTGGAGAAGAAATCTCGAGATTTCTTCTCCAGTTCTGCCTTTTTTT), and Article Title: Akt2 inhibition alleviates temporomandibular joint osteoarthritis by preventing subchondral bone loss. Article Snippet: For specific knockdown of Akt2 in rats, an Article Title: Clinical, pathological and gene expression profiling of estrogen receptor discordance in breast cancer. Article Snippet: Background Breast cancer (BC) is the world’s largest tumor species in which hormone receptor-positive patients have relatively good prognosis.. However, majority of patients will develop late resistance, one of the important factors is due to the loss of the original estrogen receptor (ER) expression.. Methods We conducted this study in 115 patients with BC who experienced second biopsy at Jiangsu Province Hospital (JSPH) and divided patients into two subgroups ER + to – and ER + to + . Article Title: TMAO Induces Vascular Endothelial Cells Pyroptosis Through TET2-CYTB-ROS Pathway Article Snippet: Article Title: miR-144-3p Targets GABRB2 to Suppress Thyroid Cancer Progression In Vitro. Article Snippet: Thyroid cancer, as one of the most common cancers in many countries, has attracted increasing attention, but its pathogenesis is still unclear.. This research explored the effects of miR-144-3p and GABRB2 on thyroid cancer cells and the underlying mechanism.. Gene expression data was obtained from the GEO database to analyze differential expression of mRNAs and miRNAs in patients with thyroid cancer. Article Title: tRF3-IleAAT reduced extracellular matrix synthesis in diabetic kidney disease mice by targeting ZNF281 and inhibiting ferroptosis. Article Snippet: It is well established that the synthesis of extracellular matrix (ECM) in mesangial cells is a major determinant of diabetic kidney disease (DKD).. Elucidating the major players in ECM synthesis may be helpful to provide promising candidates for protecting against DKD progression. tRF3-IleAAT is a tRNA-derived fragment (tRF) produced by nucleases at tRNA-specific sites, which is differentially expressed in the sera of patients with diabetes mellitus and DKD.. In this study we investigated the potential roles of tRFs in DKD. Article Title: Immune alterations and overexpression of CTCF in endometrial carcinoma: insights from molecular subtyping. Article Snippet: To down-regulate CTCF expression, 3 CTCF short hairpin RNA (sh-CTCF) and Article Title: The roles of lncRNA AP001469.3 in clinical implications, immune landscape and carcinogenesis of colorectal cancer Article Snippet: The small interfering RNA (siRNA)- ENST00000430259 and shRNA:Article Title: Exosomal AFAP1-AS1 Promotes the Growth, Metastasis, and Glycolysis of Pituitary Adenoma by Inhibiting HuR Degradation Article Snippet: Short hairpin RNA (shRNA) targeting AFAP1-AS1 (sh-AFAP1-AS1-1: CCGGGAGTACATCACCTCAAATTATCTCGAGATAATTTGAGGTGATGTACTC-TTTTTT; sh-AFAP1-AS1-2: CCGGAGGCAGAACTGGAGAAGAAATCTCGAGATTTCTTCTCCAGTTCTGCCTTTTTTT), and Article Title: Akt2 inhibition alleviates temporomandibular joint osteoarthritis by preventing subchondral bone loss. Article Snippet: For specific knockdown of Akt2 in rats, an Article Title: Clinical, pathological and gene expression profiling of estrogen receptor discordance in breast cancer. Article Snippet: Background Breast cancer (BC) is the world’s largest tumor species in which hormone receptor-positive patients have relatively good prognosis.. However, majority of patients will develop late resistance, one of the important factors is due to the loss of the original estrogen receptor (ER) expression.. Methods We conducted this study in 115 patients with BC who experienced second biopsy at Jiangsu Province Hospital (JSPH) and divided patients into two subgroups ER + to – and ER + to + . Article Title: TMAO Induces Vascular Endothelial Cells Pyroptosis Through TET2-CYTB-ROS Pathway Article Snippet: Article Title: miR-144-3p Targets GABRB2 to Suppress Thyroid Cancer Progression In Vitro. Article Snippet: Thyroid cancer, as one of the most common cancers in many countries, has attracted increasing attention, but its pathogenesis is still unclear.. This research explored the effects of miR-144-3p and GABRB2 on thyroid cancer cells and the underlying mechanism.. Gene expression data was obtained from the GEO database to analyze differential expression of mRNAs and miRNAs in patients with thyroid cancer. Article Title: tRF3-IleAAT reduced extracellular matrix synthesis in diabetic kidney disease mice by targeting ZNF281 and inhibiting ferroptosis. Article Snippet: It is well established that the synthesis of extracellular matrix (ECM) in mesangial cells is a major determinant of diabetic kidney disease (DKD).. Elucidating the major players in ECM synthesis may be helpful to provide promising candidates for protecting against DKD progression. tRF3-IleAAT is a tRNA-derived fragment (tRF) produced by nucleases at tRNA-specific sites, which is differentially expressed in the sera of patients with diabetes mellitus and DKD.. In this study we investigated the potential roles of tRFs in DKD. Article Title: Immune alterations and overexpression of CTCF in endometrial carcinoma: insights from molecular subtyping. Article Snippet: To down-regulate CTCF expression, 3 CTCF short hairpin RNA (sh-CTCF) and Article Title: The roles of lncRNA AP001469.3 in clinical implications, immune landscape and carcinogenesis of colorectal cancer Article Snippet: The small interfering RNA (siRNA)- ENST00000430259 and Negative Control:Article Title: Exosomal AFAP1-AS1 Promotes the Growth, Metastasis, and Glycolysis of Pituitary Adenoma by Inhibiting HuR Degradation Article Snippet: Short hairpin RNA (shRNA) targeting AFAP1-AS1 (sh-AFAP1-AS1-1: CCGGGAGTACATCACCTCAAATTATCTCGAGATAATTTGAGGTGATGTACTC-TTTTTT; sh-AFAP1-AS1-2: CCGGAGGCAGAACTGGAGAAGAAATCTCGAGATTTCTTCTCCAGTTCTGCCTTTTTTT), and Article Title: Akt2 inhibition alleviates temporomandibular joint osteoarthritis by preventing subchondral bone loss. Article Snippet: For specific knockdown of Akt2 in rats, an Article Title: Clinical, pathological and gene expression profiling of estrogen receptor discordance in breast cancer. Article Snippet: Background Breast cancer (BC) is the world’s largest tumor species in which hormone receptor-positive patients have relatively good prognosis.. However, majority of patients will develop late resistance, one of the important factors is due to the loss of the original estrogen receptor (ER) expression.. Methods We conducted this study in 115 patients with BC who experienced second biopsy at Jiangsu Province Hospital (JSPH) and divided patients into two subgroups ER + to – and ER + to + . Article Title: TMAO Induces Vascular Endothelial Cells Pyroptosis Through TET2-CYTB-ROS Pathway Article Snippet: Article Title: miR-144-3p Targets GABRB2 to Suppress Thyroid Cancer Progression In Vitro. Article Snippet: Thyroid cancer, as one of the most common cancers in many countries, has attracted increasing attention, but its pathogenesis is still unclear.. This research explored the effects of miR-144-3p and GABRB2 on thyroid cancer cells and the underlying mechanism.. Gene expression data was obtained from the GEO database to analyze differential expression of mRNAs and miRNAs in patients with thyroid cancer. Article Title: tRF3-IleAAT reduced extracellular matrix synthesis in diabetic kidney disease mice by targeting ZNF281 and inhibiting ferroptosis. Article Snippet: It is well established that the synthesis of extracellular matrix (ECM) in mesangial cells is a major determinant of diabetic kidney disease (DKD).. Elucidating the major players in ECM synthesis may be helpful to provide promising candidates for protecting against DKD progression. tRF3-IleAAT is a tRNA-derived fragment (tRF) produced by nucleases at tRNA-specific sites, which is differentially expressed in the sera of patients with diabetes mellitus and DKD.. In this study we investigated the potential roles of tRFs in DKD. Article Title: Immune alterations and overexpression of CTCF in endometrial carcinoma: insights from molecular subtyping. Article Snippet: To down-regulate CTCF expression, 3 CTCF short hairpin RNA (sh-CTCF) and Article Title: The roles of lncRNA AP001469.3 in clinical implications, immune landscape and carcinogenesis of colorectal cancer Article Snippet: The small interfering RNA (siRNA)- ENST00000430259 and Synthesized:Article Title: Exosomal AFAP1-AS1 Promotes the Growth, Metastasis, and Glycolysis of Pituitary Adenoma by Inhibiting HuR Degradation Article Snippet: Short hairpin RNA (shRNA) targeting AFAP1-AS1 (sh-AFAP1-AS1-1: CCGGGAGTACATCACCTCAAATTATCTCGAGATAATTTGAGGTGATGTACTC-TTTTTT; sh-AFAP1-AS1-2: CCGGAGGCAGAACTGGAGAAGAAATCTCGAGATTTCTTCTCCAGTTCTGCCTTTTTTT), and Article Title: Akt2 inhibition alleviates temporomandibular joint osteoarthritis by preventing subchondral bone loss. Article Snippet: For specific knockdown of Akt2 in rats, an Article Title: Clinical, pathological and gene expression profiling of estrogen receptor discordance in breast cancer. Article Snippet: Background Breast cancer (BC) is the world’s largest tumor species in which hormone receptor-positive patients have relatively good prognosis.. However, majority of patients will develop late resistance, one of the important factors is due to the loss of the original estrogen receptor (ER) expression.. Methods We conducted this study in 115 patients with BC who experienced second biopsy at Jiangsu Province Hospital (JSPH) and divided patients into two subgroups ER + to – and ER + to + . Article Title: TMAO Induces Vascular Endothelial Cells Pyroptosis Through TET2-CYTB-ROS Pathway Article Snippet: Article Title: miR-144-3p Targets GABRB2 to Suppress Thyroid Cancer Progression In Vitro. Article Snippet: Thyroid cancer, as one of the most common cancers in many countries, has attracted increasing attention, but its pathogenesis is still unclear.. This research explored the effects of miR-144-3p and GABRB2 on thyroid cancer cells and the underlying mechanism.. Gene expression data was obtained from the GEO database to analyze differential expression of mRNAs and miRNAs in patients with thyroid cancer. Article Title: tRF3-IleAAT reduced extracellular matrix synthesis in diabetic kidney disease mice by targeting ZNF281 and inhibiting ferroptosis. Article Snippet: It is well established that the synthesis of extracellular matrix (ECM) in mesangial cells is a major determinant of diabetic kidney disease (DKD).. Elucidating the major players in ECM synthesis may be helpful to provide promising candidates for protecting against DKD progression. tRF3-IleAAT is a tRNA-derived fragment (tRF) produced by nucleases at tRNA-specific sites, which is differentially expressed in the sera of patients with diabetes mellitus and DKD.. In this study we investigated the potential roles of tRFs in DKD. Article Title: Immune alterations and overexpression of CTCF in endometrial carcinoma: insights from molecular subtyping. Article Snippet: To down-regulate CTCF expression, 3 CTCF short hairpin RNA (sh-CTCF) and Article Title: The roles of lncRNA AP001469.3 in clinical implications, immune landscape and carcinogenesis of colorectal cancer Article Snippet: The small interfering RNA (siRNA)- ENST00000430259 and Knockdown:Article Title: Exosomal AFAP1-AS1 Promotes the Growth, Metastasis, and Glycolysis of Pituitary Adenoma by Inhibiting HuR Degradation Article Snippet: Short hairpin RNA (shRNA) targeting AFAP1-AS1 (sh-AFAP1-AS1-1: CCGGGAGTACATCACCTCAAATTATCTCGAGATAATTTGAGGTGATGTACTC-TTTTTT; sh-AFAP1-AS1-2: CCGGAGGCAGAACTGGAGAAGAAATCTCGAGATTTCTTCTCCAGTTCTGCCTTTTTTT), and Article Title: Akt2 inhibition alleviates temporomandibular joint osteoarthritis by preventing subchondral bone loss. Article Snippet: For specific knockdown of Akt2 in rats, an Article Title: Clinical, pathological and gene expression profiling of estrogen receptor discordance in breast cancer. Article Snippet: Background Breast cancer (BC) is the world’s largest tumor species in which hormone receptor-positive patients have relatively good prognosis.. However, majority of patients will develop late resistance, one of the important factors is due to the loss of the original estrogen receptor (ER) expression.. Methods We conducted this study in 115 patients with BC who experienced second biopsy at Jiangsu Province Hospital (JSPH) and divided patients into two subgroups ER + to – and ER + to + . Article Title: TMAO Induces Vascular Endothelial Cells Pyroptosis Through TET2-CYTB-ROS Pathway Article Snippet: Article Title: miR-144-3p Targets GABRB2 to Suppress Thyroid Cancer Progression In Vitro. Article Snippet: Thyroid cancer, as one of the most common cancers in many countries, has attracted increasing attention, but its pathogenesis is still unclear.. This research explored the effects of miR-144-3p and GABRB2 on thyroid cancer cells and the underlying mechanism.. Gene expression data was obtained from the GEO database to analyze differential expression of mRNAs and miRNAs in patients with thyroid cancer. Article Title: tRF3-IleAAT reduced extracellular matrix synthesis in diabetic kidney disease mice by targeting ZNF281 and inhibiting ferroptosis. Article Snippet: It is well established that the synthesis of extracellular matrix (ECM) in mesangial cells is a major determinant of diabetic kidney disease (DKD).. Elucidating the major players in ECM synthesis may be helpful to provide promising candidates for protecting against DKD progression. tRF3-IleAAT is a tRNA-derived fragment (tRF) produced by nucleases at tRNA-specific sites, which is differentially expressed in the sera of patients with diabetes mellitus and DKD.. In this study we investigated the potential roles of tRFs in DKD. Article Title: Immune alterations and overexpression of CTCF in endometrial carcinoma: insights from molecular subtyping. Article Snippet: To down-regulate CTCF expression, 3 CTCF short hairpin RNA (sh-CTCF) and Article Title: The roles of lncRNA AP001469.3 in clinical implications, immune landscape and carcinogenesis of colorectal cancer Article Snippet: The small interfering RNA (siRNA)- ENST00000430259 and Bioprocessing:Article Title: Exosomal AFAP1-AS1 Promotes the Growth, Metastasis, and Glycolysis of Pituitary Adenoma by Inhibiting HuR Degradation Article Snippet: Short hairpin RNA (shRNA) targeting AFAP1-AS1 (sh-AFAP1-AS1-1: CCGGGAGTACATCACCTCAAATTATCTCGAGATAATTTGAGGTGATGTACTC-TTTTTT; sh-AFAP1-AS1-2: CCGGAGGCAGAACTGGAGAAGAAATCTCGAGATTTCTTCTCCAGTTCTGCCTTTTTTT), and Article Title: Akt2 inhibition alleviates temporomandibular joint osteoarthritis by preventing subchondral bone loss. Article Snippet: For specific knockdown of Akt2 in rats, an Article Title: Clinical, pathological and gene expression profiling of estrogen receptor discordance in breast cancer. Article Snippet: Background Breast cancer (BC) is the world’s largest tumor species in which hormone receptor-positive patients have relatively good prognosis.. However, majority of patients will develop late resistance, one of the important factors is due to the loss of the original estrogen receptor (ER) expression.. Methods We conducted this study in 115 patients with BC who experienced second biopsy at Jiangsu Province Hospital (JSPH) and divided patients into two subgroups ER + to – and ER + to + . Article Title: TMAO Induces Vascular Endothelial Cells Pyroptosis Through TET2-CYTB-ROS Pathway Article Snippet: Article Title: miR-144-3p Targets GABRB2 to Suppress Thyroid Cancer Progression In Vitro. Article Snippet: Thyroid cancer, as one of the most common cancers in many countries, has attracted increasing attention, but its pathogenesis is still unclear.. This research explored the effects of miR-144-3p and GABRB2 on thyroid cancer cells and the underlying mechanism.. Gene expression data was obtained from the GEO database to analyze differential expression of mRNAs and miRNAs in patients with thyroid cancer. Article Title: tRF3-IleAAT reduced extracellular matrix synthesis in diabetic kidney disease mice by targeting ZNF281 and inhibiting ferroptosis. Article Snippet: It is well established that the synthesis of extracellular matrix (ECM) in mesangial cells is a major determinant of diabetic kidney disease (DKD).. Elucidating the major players in ECM synthesis may be helpful to provide promising candidates for protecting against DKD progression. tRF3-IleAAT is a tRNA-derived fragment (tRF) produced by nucleases at tRNA-specific sites, which is differentially expressed in the sera of patients with diabetes mellitus and DKD.. In this study we investigated the potential roles of tRFs in DKD. Article Title: Immune alterations and overexpression of CTCF in endometrial carcinoma: insights from molecular subtyping. Article Snippet: To down-regulate CTCF expression, 3 CTCF short hairpin RNA (sh-CTCF) and Article Title: The roles of lncRNA AP001469.3 in clinical implications, immune landscape and carcinogenesis of colorectal cancer Article Snippet: The small interfering RNA (siRNA)- ENST00000430259 and Injection:Article Title: Exosomal AFAP1-AS1 Promotes the Growth, Metastasis, and Glycolysis of Pituitary Adenoma by Inhibiting HuR Degradation Article Snippet: Short hairpin RNA (shRNA) targeting AFAP1-AS1 (sh-AFAP1-AS1-1: CCGGGAGTACATCACCTCAAATTATCTCGAGATAATTTGAGGTGATGTACTC-TTTTTT; sh-AFAP1-AS1-2: CCGGAGGCAGAACTGGAGAAGAAATCTCGAGATTTCTTCTCCAGTTCTGCCTTTTTTT), and Article Title: Akt2 inhibition alleviates temporomandibular joint osteoarthritis by preventing subchondral bone loss. Article Snippet: For specific knockdown of Akt2 in rats, an Article Title: Clinical, pathological and gene expression profiling of estrogen receptor discordance in breast cancer. Article Snippet: Background Breast cancer (BC) is the world’s largest tumor species in which hormone receptor-positive patients have relatively good prognosis.. However, majority of patients will develop late resistance, one of the important factors is due to the loss of the original estrogen receptor (ER) expression.. Methods We conducted this study in 115 patients with BC who experienced second biopsy at Jiangsu Province Hospital (JSPH) and divided patients into two subgroups ER + to – and ER + to + . Article Title: TMAO Induces Vascular Endothelial Cells Pyroptosis Through TET2-CYTB-ROS Pathway Article Snippet: Article Title: miR-144-3p Targets GABRB2 to Suppress Thyroid Cancer Progression In Vitro. Article Snippet: Thyroid cancer, as one of the most common cancers in many countries, has attracted increasing attention, but its pathogenesis is still unclear.. This research explored the effects of miR-144-3p and GABRB2 on thyroid cancer cells and the underlying mechanism.. Gene expression data was obtained from the GEO database to analyze differential expression of mRNAs and miRNAs in patients with thyroid cancer. Article Title: tRF3-IleAAT reduced extracellular matrix synthesis in diabetic kidney disease mice by targeting ZNF281 and inhibiting ferroptosis. Article Snippet: It is well established that the synthesis of extracellular matrix (ECM) in mesangial cells is a major determinant of diabetic kidney disease (DKD).. Elucidating the major players in ECM synthesis may be helpful to provide promising candidates for protecting against DKD progression. tRF3-IleAAT is a tRNA-derived fragment (tRF) produced by nucleases at tRNA-specific sites, which is differentially expressed in the sera of patients with diabetes mellitus and DKD.. In this study we investigated the potential roles of tRFs in DKD. Article Title: Immune alterations and overexpression of CTCF in endometrial carcinoma: insights from molecular subtyping. Article Snippet: To down-regulate CTCF expression, 3 CTCF short hairpin RNA (sh-CTCF) and Article Title: The roles of lncRNA AP001469.3 in clinical implications, immune landscape and carcinogenesis of colorectal cancer Article Snippet: The small interfering RNA (siRNA)- ENST00000430259 and Expressing:Article Title: Exosomal AFAP1-AS1 Promotes the Growth, Metastasis, and Glycolysis of Pituitary Adenoma by Inhibiting HuR Degradation Article Snippet: Short hairpin RNA (shRNA) targeting AFAP1-AS1 (sh-AFAP1-AS1-1: CCGGGAGTACATCACCTCAAATTATCTCGAGATAATTTGAGGTGATGTACTC-TTTTTT; sh-AFAP1-AS1-2: CCGGAGGCAGAACTGGAGAAGAAATCTCGAGATTTCTTCTCCAGTTCTGCCTTTTTTT), and Article Title: Akt2 inhibition alleviates temporomandibular joint osteoarthritis by preventing subchondral bone loss. Article Snippet: For specific knockdown of Akt2 in rats, an Article Title: Clinical, pathological and gene expression profiling of estrogen receptor discordance in breast cancer. Article Snippet: Background Breast cancer (BC) is the world’s largest tumor species in which hormone receptor-positive patients have relatively good prognosis.. However, majority of patients will develop late resistance, one of the important factors is due to the loss of the original estrogen receptor (ER) expression.. Methods We conducted this study in 115 patients with BC who experienced second biopsy at Jiangsu Province Hospital (JSPH) and divided patients into two subgroups ER + to – and ER + to + . Article Title: TMAO Induces Vascular Endothelial Cells Pyroptosis Through TET2-CYTB-ROS Pathway Article Snippet: Article Title: miR-144-3p Targets GABRB2 to Suppress Thyroid Cancer Progression In Vitro. Article Snippet: Thyroid cancer, as one of the most common cancers in many countries, has attracted increasing attention, but its pathogenesis is still unclear.. This research explored the effects of miR-144-3p and GABRB2 on thyroid cancer cells and the underlying mechanism.. Gene expression data was obtained from the GEO database to analyze differential expression of mRNAs and miRNAs in patients with thyroid cancer. Article Title: tRF3-IleAAT reduced extracellular matrix synthesis in diabetic kidney disease mice by targeting ZNF281 and inhibiting ferroptosis. Article Snippet: It is well established that the synthesis of extracellular matrix (ECM) in mesangial cells is a major determinant of diabetic kidney disease (DKD).. Elucidating the major players in ECM synthesis may be helpful to provide promising candidates for protecting against DKD progression. tRF3-IleAAT is a tRNA-derived fragment (tRF) produced by nucleases at tRNA-specific sites, which is differentially expressed in the sera of patients with diabetes mellitus and DKD.. In this study we investigated the potential roles of tRFs in DKD. Article Title: Immune alterations and overexpression of CTCF in endometrial carcinoma: insights from molecular subtyping. Article Snippet: To down-regulate CTCF expression, 3 CTCF short hairpin RNA (sh-CTCF) and Article Title: The roles of lncRNA AP001469.3 in clinical implications, immune landscape and carcinogenesis of colorectal cancer Article Snippet: The small interfering RNA (siRNA)- ENST00000430259 and Construct:Article Title: Exosomal AFAP1-AS1 Promotes the Growth, Metastasis, and Glycolysis of Pituitary Adenoma by Inhibiting HuR Degradation Article Snippet: Short hairpin RNA (shRNA) targeting AFAP1-AS1 (sh-AFAP1-AS1-1: CCGGGAGTACATCACCTCAAATTATCTCGAGATAATTTGAGGTGATGTACTC-TTTTTT; sh-AFAP1-AS1-2: CCGGAGGCAGAACTGGAGAAGAAATCTCGAGATTTCTTCTCCAGTTCTGCCTTTTTTT), and Article Title: Akt2 inhibition alleviates temporomandibular joint osteoarthritis by preventing subchondral bone loss. Article Snippet: For specific knockdown of Akt2 in rats, an Article Title: Clinical, pathological and gene expression profiling of estrogen receptor discordance in breast cancer. Article Snippet: Background Breast cancer (BC) is the world’s largest tumor species in which hormone receptor-positive patients have relatively good prognosis.. However, majority of patients will develop late resistance, one of the important factors is due to the loss of the original estrogen receptor (ER) expression.. Methods We conducted this study in 115 patients with BC who experienced second biopsy at Jiangsu Province Hospital (JSPH) and divided patients into two subgroups ER + to – and ER + to + . Article Title: TMAO Induces Vascular Endothelial Cells Pyroptosis Through TET2-CYTB-ROS Pathway Article Snippet: Article Title: miR-144-3p Targets GABRB2 to Suppress Thyroid Cancer Progression In Vitro. Article Snippet: Thyroid cancer, as one of the most common cancers in many countries, has attracted increasing attention, but its pathogenesis is still unclear.. This research explored the effects of miR-144-3p and GABRB2 on thyroid cancer cells and the underlying mechanism.. Gene expression data was obtained from the GEO database to analyze differential expression of mRNAs and miRNAs in patients with thyroid cancer. Article Title: tRF3-IleAAT reduced extracellular matrix synthesis in diabetic kidney disease mice by targeting ZNF281 and inhibiting ferroptosis. Article Snippet: It is well established that the synthesis of extracellular matrix (ECM) in mesangial cells is a major determinant of diabetic kidney disease (DKD).. Elucidating the major players in ECM synthesis may be helpful to provide promising candidates for protecting against DKD progression. tRF3-IleAAT is a tRNA-derived fragment (tRF) produced by nucleases at tRNA-specific sites, which is differentially expressed in the sera of patients with diabetes mellitus and DKD.. In this study we investigated the potential roles of tRFs in DKD. Article Title: Immune alterations and overexpression of CTCF in endometrial carcinoma: insights from molecular subtyping. Article Snippet: To down-regulate CTCF expression, 3 CTCF short hairpin RNA (sh-CTCF) and Article Title: The roles of lncRNA AP001469.3 in clinical implications, immune landscape and carcinogenesis of colorectal cancer Article Snippet: The small interfering RNA (siRNA)- ENST00000430259 and Concentration Assay:Article Title: Exosomal AFAP1-AS1 Promotes the Growth, Metastasis, and Glycolysis of Pituitary Adenoma by Inhibiting HuR Degradation Article Snippet: Short hairpin RNA (shRNA) targeting AFAP1-AS1 (sh-AFAP1-AS1-1: CCGGGAGTACATCACCTCAAATTATCTCGAGATAATTTGAGGTGATGTACTC-TTTTTT; sh-AFAP1-AS1-2: CCGGAGGCAGAACTGGAGAAGAAATCTCGAGATTTCTTCTCCAGTTCTGCCTTTTTTT), and Article Title: Akt2 inhibition alleviates temporomandibular joint osteoarthritis by preventing subchondral bone loss. Article Snippet: For specific knockdown of Akt2 in rats, an Article Title: Clinical, pathological and gene expression profiling of estrogen receptor discordance in breast cancer. Article Snippet: Background Breast cancer (BC) is the world’s largest tumor species in which hormone receptor-positive patients have relatively good prognosis.. However, majority of patients will develop late resistance, one of the important factors is due to the loss of the original estrogen receptor (ER) expression.. Methods We conducted this study in 115 patients with BC who experienced second biopsy at Jiangsu Province Hospital (JSPH) and divided patients into two subgroups ER + to – and ER + to + . Article Title: TMAO Induces Vascular Endothelial Cells Pyroptosis Through TET2-CYTB-ROS Pathway Article Snippet: Article Title: miR-144-3p Targets GABRB2 to Suppress Thyroid Cancer Progression In Vitro. Article Snippet: Thyroid cancer, as one of the most common cancers in many countries, has attracted increasing attention, but its pathogenesis is still unclear.. This research explored the effects of miR-144-3p and GABRB2 on thyroid cancer cells and the underlying mechanism.. Gene expression data was obtained from the GEO database to analyze differential expression of mRNAs and miRNAs in patients with thyroid cancer. Article Title: tRF3-IleAAT reduced extracellular matrix synthesis in diabetic kidney disease mice by targeting ZNF281 and inhibiting ferroptosis. Article Snippet: It is well established that the synthesis of extracellular matrix (ECM) in mesangial cells is a major determinant of diabetic kidney disease (DKD).. Elucidating the major players in ECM synthesis may be helpful to provide promising candidates for protecting against DKD progression. tRF3-IleAAT is a tRNA-derived fragment (tRF) produced by nucleases at tRNA-specific sites, which is differentially expressed in the sera of patients with diabetes mellitus and DKD.. In this study we investigated the potential roles of tRFs in DKD. Article Title: Immune alterations and overexpression of CTCF in endometrial carcinoma: insights from molecular subtyping. Article Snippet: To down-regulate CTCF expression, 3 CTCF short hairpin RNA (sh-CTCF) and Article Title: The roles of lncRNA AP001469.3 in clinical implications, immune landscape and carcinogenesis of colorectal cancer Article Snippet: The small interfering RNA (siRNA)- ENST00000430259 and Small Interfering RNA:Article Title: Exosomal AFAP1-AS1 Promotes the Growth, Metastasis, and Glycolysis of Pituitary Adenoma by Inhibiting HuR Degradation Article Snippet: Short hairpin RNA (shRNA) targeting AFAP1-AS1 (sh-AFAP1-AS1-1: CCGGGAGTACATCACCTCAAATTATCTCGAGATAATTTGAGGTGATGTACTC-TTTTTT; sh-AFAP1-AS1-2: CCGGAGGCAGAACTGGAGAAGAAATCTCGAGATTTCTTCTCCAGTTCTGCCTTTTTTT), and Article Title: Akt2 inhibition alleviates temporomandibular joint osteoarthritis by preventing subchondral bone loss. Article Snippet: For specific knockdown of Akt2 in rats, an Article Title: Clinical, pathological and gene expression profiling of estrogen receptor discordance in breast cancer. Article Snippet: Background Breast cancer (BC) is the world’s largest tumor species in which hormone receptor-positive patients have relatively good prognosis.. However, majority of patients will develop late resistance, one of the important factors is due to the loss of the original estrogen receptor (ER) expression.. Methods We conducted this study in 115 patients with BC who experienced second biopsy at Jiangsu Province Hospital (JSPH) and divided patients into two subgroups ER + to – and ER + to + . Article Title: TMAO Induces Vascular Endothelial Cells Pyroptosis Through TET2-CYTB-ROS Pathway Article Snippet: Article Title: miR-144-3p Targets GABRB2 to Suppress Thyroid Cancer Progression In Vitro. Article Snippet: Thyroid cancer, as one of the most common cancers in many countries, has attracted increasing attention, but its pathogenesis is still unclear.. This research explored the effects of miR-144-3p and GABRB2 on thyroid cancer cells and the underlying mechanism.. Gene expression data was obtained from the GEO database to analyze differential expression of mRNAs and miRNAs in patients with thyroid cancer. Article Title: tRF3-IleAAT reduced extracellular matrix synthesis in diabetic kidney disease mice by targeting ZNF281 and inhibiting ferroptosis. Article Snippet: It is well established that the synthesis of extracellular matrix (ECM) in mesangial cells is a major determinant of diabetic kidney disease (DKD).. Elucidating the major players in ECM synthesis may be helpful to provide promising candidates for protecting against DKD progression. tRF3-IleAAT is a tRNA-derived fragment (tRF) produced by nucleases at tRNA-specific sites, which is differentially expressed in the sera of patients with diabetes mellitus and DKD.. In this study we investigated the potential roles of tRFs in DKD. Article Title: Immune alterations and overexpression of CTCF in endometrial carcinoma: insights from molecular subtyping. Article Snippet: To down-regulate CTCF expression, 3 CTCF short hairpin RNA (sh-CTCF) and Article Title: The roles of lncRNA AP001469.3 in clinical implications, immune landscape and carcinogenesis of colorectal cancer Article Snippet: The small interfering RNA (siRNA)- ENST00000430259 and Transfection:Article Title: Exosomal AFAP1-AS1 Promotes the Growth, Metastasis, and Glycolysis of Pituitary Adenoma by Inhibiting HuR Degradation Article Snippet: Short hairpin RNA (shRNA) targeting AFAP1-AS1 (sh-AFAP1-AS1-1: CCGGGAGTACATCACCTCAAATTATCTCGAGATAATTTGAGGTGATGTACTC-TTTTTT; sh-AFAP1-AS1-2: CCGGAGGCAGAACTGGAGAAGAAATCTCGAGATTTCTTCTCCAGTTCTGCCTTTTTTT), and Article Title: Akt2 inhibition alleviates temporomandibular joint osteoarthritis by preventing subchondral bone loss. Article Snippet: For specific knockdown of Akt2 in rats, an Article Title: Clinical, pathological and gene expression profiling of estrogen receptor discordance in breast cancer. Article Snippet: Background Breast cancer (BC) is the world’s largest tumor species in which hormone receptor-positive patients have relatively good prognosis.. However, majority of patients will develop late resistance, one of the important factors is due to the loss of the original estrogen receptor (ER) expression.. Methods We conducted this study in 115 patients with BC who experienced second biopsy at Jiangsu Province Hospital (JSPH) and divided patients into two subgroups ER + to – and ER + to + . Article Title: TMAO Induces Vascular Endothelial Cells Pyroptosis Through TET2-CYTB-ROS Pathway Article Snippet: Article Title: miR-144-3p Targets GABRB2 to Suppress Thyroid Cancer Progression In Vitro. Article Snippet: Thyroid cancer, as one of the most common cancers in many countries, has attracted increasing attention, but its pathogenesis is still unclear.. This research explored the effects of miR-144-3p and GABRB2 on thyroid cancer cells and the underlying mechanism.. Gene expression data was obtained from the GEO database to analyze differential expression of mRNAs and miRNAs in patients with thyroid cancer. Article Title: tRF3-IleAAT reduced extracellular matrix synthesis in diabetic kidney disease mice by targeting ZNF281 and inhibiting ferroptosis. Article Snippet: It is well established that the synthesis of extracellular matrix (ECM) in mesangial cells is a major determinant of diabetic kidney disease (DKD).. Elucidating the major players in ECM synthesis may be helpful to provide promising candidates for protecting against DKD progression. tRF3-IleAAT is a tRNA-derived fragment (tRF) produced by nucleases at tRNA-specific sites, which is differentially expressed in the sera of patients with diabetes mellitus and DKD.. In this study we investigated the potential roles of tRFs in DKD. Article Title: Immune alterations and overexpression of CTCF in endometrial carcinoma: insights from molecular subtyping. Article Snippet: To down-regulate CTCF expression, 3 CTCF short hairpin RNA (sh-CTCF) and Article Title: The roles of lncRNA AP001469.3 in clinical implications, immune landscape and carcinogenesis of colorectal cancer Article Snippet: The small interfering RNA (siRNA)- ENST00000430259 and Recombinant:Article Title: Exosomal AFAP1-AS1 Promotes the Growth, Metastasis, and Glycolysis of Pituitary Adenoma by Inhibiting HuR Degradation Article Snippet: Short hairpin RNA (shRNA) targeting AFAP1-AS1 (sh-AFAP1-AS1-1: CCGGGAGTACATCACCTCAAATTATCTCGAGATAATTTGAGGTGATGTACTC-TTTTTT; sh-AFAP1-AS1-2: CCGGAGGCAGAACTGGAGAAGAAATCTCGAGATTTCTTCTCCAGTTCTGCCTTTTTTT), and Article Title: Akt2 inhibition alleviates temporomandibular joint osteoarthritis by preventing subchondral bone loss. Article Snippet: For specific knockdown of Akt2 in rats, an Article Title: Clinical, pathological and gene expression profiling of estrogen receptor discordance in breast cancer. Article Snippet: Background Breast cancer (BC) is the world’s largest tumor species in which hormone receptor-positive patients have relatively good prognosis.. However, majority of patients will develop late resistance, one of the important factors is due to the loss of the original estrogen receptor (ER) expression.. Methods We conducted this study in 115 patients with BC who experienced second biopsy at Jiangsu Province Hospital (JSPH) and divided patients into two subgroups ER + to – and ER + to + . Article Title: TMAO Induces Vascular Endothelial Cells Pyroptosis Through TET2-CYTB-ROS Pathway Article Snippet: Article Title: miR-144-3p Targets GABRB2 to Suppress Thyroid Cancer Progression In Vitro. Article Snippet: Thyroid cancer, as one of the most common cancers in many countries, has attracted increasing attention, but its pathogenesis is still unclear.. This research explored the effects of miR-144-3p and GABRB2 on thyroid cancer cells and the underlying mechanism.. Gene expression data was obtained from the GEO database to analyze differential expression of mRNAs and miRNAs in patients with thyroid cancer. Article Title: tRF3-IleAAT reduced extracellular matrix synthesis in diabetic kidney disease mice by targeting ZNF281 and inhibiting ferroptosis. Article Snippet: It is well established that the synthesis of extracellular matrix (ECM) in mesangial cells is a major determinant of diabetic kidney disease (DKD).. Elucidating the major players in ECM synthesis may be helpful to provide promising candidates for protecting against DKD progression. tRF3-IleAAT is a tRNA-derived fragment (tRF) produced by nucleases at tRNA-specific sites, which is differentially expressed in the sera of patients with diabetes mellitus and DKD.. In this study we investigated the potential roles of tRFs in DKD. Article Title: Immune alterations and overexpression of CTCF in endometrial carcinoma: insights from molecular subtyping. Article Snippet: To down-regulate CTCF expression, 3 CTCF short hairpin RNA (sh-CTCF) and Article Title: The roles of lncRNA AP001469.3 in clinical implications, immune landscape and carcinogenesis of colorectal cancer Article Snippet: The small interfering RNA (siRNA)- ENST00000430259 and |
