end repair buffer 1 (New England Biolabs)

New England Biolabs is a verified supplier

New England Biolabs manufactures this product

About

News

Press Release

Team

Advisors

Partners

Contact

Bioz Stars

Bioz vStars

Buy from Supplier

Structured Review

New England Biolabs end repair buffer 1
End Repair Buffer 1, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 11322 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/nebuffer+2+1+buffer/T4+Polynucleotide+Kinase/pm40603633-256-19-24
Average 99 stars, based on 11322 article reviews

end repair buffer 1 - by Bioz Stars, 2026-10

99/100 stars

Images

Recombinant:

Article Title: A novel Torque teno virus qPCR assay reveals longitudinal viral load variability among non-immunosuppressed subjects.
Article Snippet: .. Reagents and tools table Reagent/resource Reference or source Identifier or catalog number Recombinant DNA 10-beta Competent E. coli (High Efficiency) New England Biolabs C3019H Oligonucleotides and other sequence-based reagents PCR Primers This study Appendix Table S2 Chemicals, enzymes and other reagents Agarose, universal, DNA pure grade VWR International, LLC 732–2789 Aqua ad iniectabilia B. Braun Melsungen AG 3000910 Cobas omni lysis reagent Roche Holding AG 06997538190 Cobas omni MGP reagent Roche Holding AG 06997546190 Cobas omni specimen diluent Roche Holding AG 06997511190 Cobas omni wash reagent Roche Holding AG 06997503190 Cobas buffer negative control kit Roche Holding AG 09051953190 FastDigest Green Buffer (10X) Thermo Fisher Scientific Inc. B72 Fetal Bovine Serum (FBS) Gibco A5670701 GeneRuler DNA Ladder Mix, readyto-use Thermo Fisher Scientific Inc. SM0334 ROTI GelStain CARL ROTH 3865.1 T4 DNA Ligase Buffer (10X) Thermo Fisher Scientific Inc. B69 FastAP Thermosensitive Alkaline Phosphatase (1 U/μl) Thermo Fisher Scientific Inc. EF0651 FastDigest BpiI (Class IIs) Thermo Fisher Thermo Fisher Scientific Inc. FD1014 Reagent/resource Reference or source Identifier or catalog number T4 DNA Ligase (5 U/μl) Thermo Fisher Scientific Inc. EL0011 T4 Polynucleotide Kinase New England Biolabs M0201S Universal Transport Medium for viruses COPAN ITALIA 305 C SOC Outgrowth Medium New England Biolabs B9020S 50x Tris-Acetate-EDTAElectrophoresis buffer In-house made Software Cobas omni utility channel optimization tool v5.1 Roche Holding AG Cobas omni utility channel RFID tool 1.0.0.27 Roche Holding AG Eurofins qPCR Primer & Probe Design Tool Eurofins Genomics Excel Microsoft GenBank NLM GenScript Online PCR Primers Design Tool GenScript GraphPad Prism GraphPad Software LightCycler 480 SW UDF 2.1.0 Roche Holding AG NCBI blast NLM Primer3web version 4.1.0 Tool Primer3 SnapGene GSL Biotech LLC Other Cobas omni optimization kit Roche Holding AG 07731663190 Cobas omni utility channel reagent kit Roche Holding AG 09052011190 GeneJET Gel Extraction kit Thermo Scientific K0691 LightCycler 480 high-resolution melting master Roche Holding AG 04909631001 Plasmid Plus Midi Kit QIAGEN 12945 STARMag 96 ProPrep (Plate type) Seegene Inc. EX00009P STARMag 96 ProPrep (Tube type) Seegene Inc. EX00009T 96 Well Lightcycler plate SARSTEDT AG & Co. KG 72.1982.202 Cobas z 480 Analyzer Roche Holding AG Cobas 5800 Roche Holding AG NanoDrop One Microvolume UV Spectrophotometer Thermo Fisher Scientific Inc. ND-ONE-W PCR Plate centrifuge II, 230 V VWR International, LLC. ..

Article Title: Oxidative DNA damage drives centromere fragility and chromosome instability.
Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies anti-alpha-tubulin (TUBA1) mouse monoclonal antibody Millipore Sigma cat#T9026 RRID:AB_477593 anti-beta-actin mouse monoclonal Millipore Sigma cat#A1978 RRID:AB_476692 anti-CENPA mouse monoclonal antibody Invitrogen cat#MA1-20832 RRID:AB_2078763 anti-CENPB rabbit polyclonal antibody Invitrogen cat#PA5-65869 RRID:AB_2662433 anti-CENPB rabbit polyclonal antibody Abcam cat#ab25734 RRID:AB_726801 anti-Centromere human polyclonal antibody (ACA) antibodiesinc cat#SKU 15– 234 RRID:AB_2939058 anti-Chk2 (1C12) mouse monoclonal antibody Cell Signaling cat#3440 RRID:AB_2229490 anti-gamma H2A.X (phospho S139) rabbit polyclonal abcam cat#ab2893 RRID:AB_303388 anti-Histone H3 mouse monoclonal antibody Novus cat#NBP2-36468 RRID:AB_2925191 anti-OGG1 rabbit monoclonal antibody abcam cat#ab124741 RRID:AB_10973360 anti-PARP rabbit polyclonal antibody Cell Signaling cat#9542 RRID:AB_2160739 anti-PCNA (PC10) mouse monoclonal antibody Cell Signaling cat#2586 RRID:AB_2160343 anti-phospho-Chk2 (Thr68)(C13C1) rabbit monoclonal antibody Cell Signaling cat#2197 RRID:AB_2080501 anti-Poly/Mono-ADP Ribose E6F6A rabbit monoclonal antibody Cell Signaling cat#83732 RRID:AB_2749858 anti-p21 Waf1/Cip1 rabbit (12D1) Cell Signaling cat#2947 RRID:AB_823586 anti-p53 (DO-1) mouse monoclonal Santa Cruz cat#sc-126 RRID:AB_628082 anti-RFP polyclonal antibody GeneTex cat#GTX127897 RRID:AB_2885652 anti-53BP1 clone BP13 Millipore Sigma cat#MAB3802 RRID:AB_2206767 Chemicals, peptides, and recombinant proteins Alexa FluorTM 647 ThermoFisher Cat# A10277 ATR inhibitor (AZD6738) MedChemExpress Cat# HY-19323 ATM inhibitor (AZD0156) MedChemExpress Cat# HY-100016 bis[4-(dimethylamino)phenyl](4 -(3-carboethoxypropyl)-3,5-diiodophenyl)-chloride (MG-2I) He et al., 201641 NA Butylated hydroxytoluene Sigma Cat# W218405 CDK1 inhibitor (Ro3306) Tocris Cat# 4181 copper (II) sulfate Sigma Cat# 209198-250G Deferoxamine mesylate salt Sigma Cat# D9533 DNA-pk inhibitor (nu7441) MedChemExpress Cat# HY-11006 Doxycycline Hydrochloride Fisher Cat# BP26531 Dulbecco’s modified Eagle’s medium/F-12 (gibco) ThermoFisher Cat# 11320033 FuGENE HD transfection reagent Promega Cat# E2311 Geneticin (gibco) ThermoFisher Cat# 10131027 KaryoMAXTM ColcemidTM ThermoFisher Cat# 15212012 Opti-MEMTM reduced serum media no phenol red (gibco) ThermoFisher Cat# 11058021 PARG inhibitor (PDD00017273) Sigma Cat# SML1781-5MG PARP1 inhibitor (AZD5305) MedChemExpress Cat# HY-132167 Penicillin-Streptomycin (Gibco) ThermoFisher Cat# 15140122 potassium bromate (KBrO3) Sigma Cat# 309087-100G potassium chloride Fisher Cat# P217-500 Rad51 inhibitor (B02) Sigma Cat# SML0364 sodium azide (NaN3) Fisher Cat# BP922l-500 sodium L-ascorbate Sigma Cat# 102673582 (Continued on next page) 16 Cell Reports 45, 118109, October 27, 2026 .. REAGENT or RESOURCE SOURCE IDENTIFIER SPY505-DNA Spirochrome Cat# SPY505-DNA SYBRTM Gold Nucleic Acid Gel Stain ThermoFisher Cat# S11494 S1 nuclease ThermoFisher Cat# EN0321 Tet-system approved fetal bovine serum Cell Culture Collective Cat# FB-24 AluI NEB Cat# R0137S EcoO109I NEB Cat# R0503S FPG NEB Cat# M0240L HinfI NEB Cat# R0155S HphI NEB Cat# R0158S MnlI NEB Cat# R0163S NIaIV NEB Cat# R0126S ScrFI NEB Cat# R0110S T4 Polynucleotide Kinase NEB Cat# M0201S Critical commercial assays Apoptosis Staining Detection Kit Abcam Cat# ab14085 CellEventTM Senescence Green Detection Kit Thermo Fisher Cat# C10851 GatewayTM BP ClonaseTM II Enzyme mix Invitrogen Cat# 11789020 GatewayTM LR ClonaseTM II Enzyme mix Invitrogen Cat# 11791100 LookOut Mycoplasma PCR kit Sigma Cat# MP0035 Pierce BCA protein assay kit Thermo Fisher Cat# 23227 Senescence beta-galactosidase Staining kit Cell Signaling Cat# 9860 Subcellular Protein Fractionation Kit Thermo Fisher Cat# 78840 Qiagen Genomic Tip-20 kit Qiagen Cat# 10223 Universal Mycoplasma Detection kit ATCC Cat# 30-1012K Experimental models: Cell lines hTERT RPE1 pInducer FAP mCer CENPB This paper N/A hTERT RPE1 PCNA-mTq2 DHB-mCherry Gift from Dr. Wayne Stallaert N/A Oligonucleotides DharmaconTM ON-TARGETplus SMARTpool siRNA for human OGG1 Dharmacon Cat# L-005147-00-0005 CENPB-Alexa488 (ATTCGTTGGAAACGGGA) PNA Cat# F3004 Pan centromere-Cy3 (AAACTAGACAGAAGCATT) PNA Cat# F3003 TelC-Cy5 (CCCTAACCCTAACCCTAA) PNA Cat# F1003 TelC-Cy3 (CCCTAACCCTAACCCTAA) PNA Cat# F1002 attB Forward: AAAAAGCAGGCTTACAGGCCGTCGTTACCCAAG IDT N/A attB Reverse: AGAAAGCTGGGTTTCAGCTTTGATGTCCAAGACCTCG IDT N/A attB1 Adapter (29-mer): GGGGACAAGTTTGTACAAAAAAGCAGGCT IDT N/A attB2 Adapter (29-mer): GGGGACCACTTTGTACAAGAAAGCTGGGT IDT N/A CenpB primer for32P probe - ATTCGTTGGAAACGGGA IDT N/A Telomere primer for32P probe - TTAGGGTTAGGGTTAGGGTTAGGG IDT N/A Recombinant DNA psPAX2 Addgene, gift from Dr. Didier Trono Cat# 12260 pCMV-VSV-G Addgene, gift from Dr. Bob Weinberg Cat# 8454 pInducer 20 Addgene Cat# 44012 pLVX-puro-FAP-CENPB This paper N/A pLVX-puro-FAP-mCer-CENPB This paper N/A pDONRTM221 Thermo Cat# 12536017 (Continued on next page) Cell Reports 45, 118109, October 27, 2026 17 .. The pInducer mCerulean FAP CENPB cell line was obtained by infection of hTERT RPE-1 with lentivirus containing a pInducer FAP CENPB plasmid.

Sequencing:

Polymerase Chain Reaction:

Article Title: A premitotic polarity program patterns the grass leaf epidermis.
Article Snippet: EL0011 T4 Polynucleotide Kinase NEB Cat.No. .. M0201L OneTaq Polymerase NEB Cat. No M0509L Agarose, low gelling temperature Sigma Cat.No A9045 Linsmaier & Skoog medium Duchefa Cat.No L0230.0025 2′,4′-Dichlorophenoxyacetic acid (2,4-D) Sigma Cat.No D7299 3′,5′-Dimethoxy-4′-hydroxyacetophenone (Acetosyringone) Sigma Cat.No D134406 Synperonic Acid (GC stationary phase Synperonic PE/F68) Sigma Cat.No 81112 Hygromycin B Sigma Cat.No 10843555001 Ticarcillin disodium / clavulanate potassium (Timentin) Duchefa Cat.No T0190.0025 Critical commercial assays NucleoSpin Gel and PCR Clean-up Kit Macherey-Nagel Cat.No. ..

Article Title: Geometry of braided DNA dictates supercoiling partitioning.
Article Snippet: This intermediate plasmid had an unwanted Nt.BbvCI (NEB, R0632) recognition sequence on top of four that was included by design. .. This site was removed using site directed mutagenesis, first using PCR amplification from the intermediate plasmid with primers (KLD nickRemoval F, KLD nickRemoval R, Supplementary Table 4), followed by a KLD reaction on the PCR product with T4 PNK (NEB, M0201S), T4 ligase (NEB, M0202S), and DpnI (NEB, R0176S). ..

Article Title: Protocol for Cas9 nickase-mediated induction and two-dimensional gel detection of i-loops at human telomeric and alpha satellite repeats.
Article Snippet: E. coli One Shot Stbl3 chemically competent cells Invitrogen Cat# C737303 Lentiviral particles: Lenti-iCas9-neo (parent backbone) Addgene Cat# 85400; RRID: Addgene_85400 Lentiviral particles: LentiGuide-Puro (sgRNA backbone) Addgene Cat# 52963; RRID: Addgene_52963 Chemicals, peptides and recombinant proteins Agarose (standard grade) Euroclone Cat# EMR010500 Agarose Low EEO (for 2D-gels and alkaline gels) US Biological Cat# A1015 Agarose, low melting point (for plug casting) Lonza Cat# 50104 Ampicillin Sigma-Aldrich Cat# A9518 Boric acid VWR Cat# 20185 Bromocresol green Sigma-Aldrich Cat # 114359 Bromophenol blue Sigma-Aldrich Cat# B0126 BSA (molecular biology grade) NEB Cat# B9000 BsmBI-v2 NEB Cat# R0739S CaCl2 Sigma-Aldrich Cat# C1016 Chloroform (molecular biology grade) Sigma-Aldrich Cat# C2432 CutSmart Buffer (10x) NEB Cat# B6004S Dimethyl sulfoxide (DMSO), sterile Sigma-Aldrich Cat# D2438 DNase I (RNase-free, lyophilized) Worthington Cat# LS006333 dNTP Set (100 mM solutions) Invitrogen Cat# 10297018 Doxycycline hydrochloride Sigma-Aldrich Cat# D9891; CAS: 24390-14-5 DpnI restriction enzyme NEB Cat# R0176L DTT (dithiothreitol), 1 M Sigma-Aldrich Cat# D9779 EDTA Sigma-Aldrich Cat# E9884 EGTA Sigma-Aldrich Cat# E3889 Ethanol, absolute (molecular biology grade) Sigma-Aldrich CAS: 64-17-5 Ethidium Bromide solution (10 mg/mL) Sigma-Aldrich Cat# E1510 Ficoll 400 Sigma-Aldrich Cat# F4375 Geneticin G418 sulfate (powder) Life Technologies Cat# 11811031 Glycerol (molecular biology grade) Sigma-Aldrich Cat# G5516 HCl, 37% (12 N) Sigma-Aldrich Cat# 320331 HinfI NEB Cat# R0155L Isopropanol (molecular biology grade) Sigma-Aldrich CAS: 67-63-0 KCl Sigma-Aldrich Cat# P9333 Klenow Fragment (3’→5′ exo-) NEB Cat# M0212S L-Glutamine, 200 mM Euroclone Cat# LOBE1760F LB Broth, Miller BD Diagnostic Systems Cat# 244620 Magnesium acetate Sigma-Aldrich Cat# M5661 MgCl2 Sigma-Aldrich Cat# M8266 MspI NEB Cat# R0106L N-Lauroylsarcosine sodium salt Sigma-Aldrich Cat# L9150 NaOH Sigma-Aldrich Cat# 1.09137 Phenol:chloroform:isoamyl alcohol (25:24:1) Sigma-Aldrich Cat# P2069 PMSF (phenylmethylsulfonyl fluoride) Sigma-Aldrich Cat# 78830 Polybrene (Hexadimethrine bromide) Sigma-Aldrich Cat# H9268 Polyethylenimine Max 40000 (PEI Max) Histo-Line Laboratories Cat# 24765-1 Potassium phosphate monobasic Sigma-Aldrich Cat# P0662 Protease Inhibitor Cocktail (cOmplete, EDTA-free) Roche Cat# 11836170001 Proteinase K (20 mg/mL stock solution) Roche Cat# 3115887001 Puromycin dihydrochloride Adipogen Cat# AG-CN2-0078-M100 Q5 High-Fidelity DNA Polymerase NEB Cat# M0491S Quick Ligation Kit NEB Cat# M2200S RNase A (10 mg/mL, DNase-free) Sigma-Aldrich Cat# R5000 RsaI NEB Cat# R0167L (Continued on next page) 6 STAR Protocols 7, 104888, December 18, 2026 .. SDS 20% (w/v) solution ITW Reagents Cat# A3942,1000 Skim milk powder Millipore Cat# 70166 Sodium acetate, 3 M, pH 5.2 Sigma-Aldrich CAS: 127-09-3 Sodium citrate dihydrate Sigma-Aldrich Cat# W302600 Sodium deoxycholate Sigma-Aldrich Cat# D6750 Sodium phosphate dibasic Sigma-Aldrich Cat# S3264 Sodium chloride Carlo Erba Cat# 479687 Sucrose Sigma-Aldrich Cat# S0389 T4 DNA Ligase (400,000 U/mL) NEB Cat# M0202S T4 Polynucleotide Kinase (PNK) NEB Cat# M0201S Tris base Sigma-Aldrich Cat# T1503 Triton X-100 (10% solution, cell culture tested) Sigma-Aldrich Cat# X100 Trypsin-EDTA Euroclone Cat# ECB3052D Tween-20 Sigma-Aldrich Cat# P9416 Xylene cyanol Sigma-Aldrich Cat# X4126 α-32P-dCTP (3000 Ci/mmol, 10 mCi/mL) PerkinElmer Cat# NEG513Z γ-32P-ATP (6000 Ci/mmol, 10 mCi/mL) PerkinElmer Cat# NEG5502Z Critical commercial assays GenePrint 10 System (STR cell line authentication) Promega Cat# B9510 MycoAlert Mycoplasma Detection Kit Lonza Cat# LT07-418 NucleoBond Xtra Maxi Kit (maxiprep) Macherey-Nagel Cat# 740414.50 Prime-a-Gene Labeling System (random-prime labeling) Promega Cat# U1100 QuBit dsDNA Assay Kit, Broad Range Invitrogen Cat# Q32850 SuperSignal West Pico Plus Chemiluminescent Substrate Thermo Scientific Cat# 34580 Wizard Plus SV Miniprep DNA Purification System Promega Cat# A1330 Wizard SV Gel and PCR Clean-Up System Promega Cat# A9281 Deposited data Original images and source data (Zanella et al., 2026)1 Zanella et al.1 Mendeley Data: https://doi.org/10.17632/ hwf38mddyt.1 Experimental models: cell lines Human: HT1080 (fibrosarcoma, male) ATCC Cat# CCL-121; RRID: CVCL_0317 Human: HEK293-T (embryonic kidney, female) ATCC Cat# CRL-3216; RRID: CVCL_0063 Human: HT1080 Lenti-iCas9D10A-Neo (generated in this study) Zanella et al.1; Doksani Lab plasmid #123 N/A Human: HT1080 Lenti-iCas9H840A-Neo (generated in this study) Zanella et al.1; Doksani Lab plasmid #124 N/A Oligonucleotides Telomere-specific sgRNA-FW: 5′-CACCGTTAGGGTTAGGGTTAGGGTTA-3′ Zanella et al.1 N/A Telomere-specific sgRNA-RV: 5′-AAACAACCCTAACCCTAACCCTAAC-3′ Zanella et al.1 N/A Alpha satellite-specific sgRNA-FW: 5′-CACCGGAATCTGCAAGTGGATATTG-3′ Zanella et al.; Gao et al.1,7 N/A Alpha satellite-specific sgRNA-RV: 5′- AAACCAATATCCACTTGCAGATTCC-3′ Zanella et al.; Gao et al.1,7 N/A C-strand telomeric probe: (CCCTAA)4 Zanella et al. 1 N/A G-strand telomeric probe: (TTAGGG)5 Zanella et al. 1 N/A Alpha satellite primer α27: 5′-CATCACAAAGAAGTTTCTGAGAATGCTTC-3′ Choo et al.; Catacchio et al.10,11 N/A Alpha satellite primer α30: 5′-TGCATTCAACTCACAGAGTTGAACCTTCC-3′ Choo et al.; Catacchio et al.10,11 N/A Cas9D10A mutagenic FW: 5′-cctggCcatcggcaccaactctgtgg-3′ Zanella et al.1 N/A Cas9D10A mutagenic RV: 5′-cgatgGccaggccgatgctgtacttc-3′ Zanella et al.1 N/A (Continued on next page) STAR Protocols 7, 104888, December 18, 2026 7 .. Cas9H840A mutagenic FW: 5′-gtggacGCtatcgtgcctcagagctttc-3′ Zanella et al.1 N/A Cas9H840A mutagenic RV: 5′-cacgataGCgtccacatcgtagtcggac-3′ Zanella et al.1 N/A Recombinant DNA Lenti-iCas9-Neo (doxycycline-inducible FLAG-Cas9 backbone) Addgene Cat# 85400; RRID: Addgene_85400 Lenti-iCas9D10A-Neo Zanella et al.1; Doksani Lab plasmid #123 N/A Lenti-iCas9H840A-Neo Zanella et al.1; Doksani Lab plasmid #124 N/A LentiGuide-Puro (sgRNA expression backbone) Addgene Cat# 52963; RRID: Addgene_52963 Teloguide: LentiGuide-Puro + telomere sgRNA Zanella et al.1; Doksani Lab plasmid #129 N/A Alphaguide: LentiGuide-Puro + alpha satellite sgRNA Zanella et al.1; Doksani Lab plasmid #138 N/A pSty11 (800 bp EcoRI telomeric probe template) Titia de Lange Lab/Addgene Cat# 12401; RRID: Addgene_12401 pMD2.G - lentiviral packaging 1/3 Addgene Cat# 12259 pMDLg/pRRE - lentiviral packaging 2/3 Addgene Cat# 12251 pRSV-Rev - lentiviral packaging 3/3 Addgene Cat# 12253 α-satellite pSP73 (316 bp probe template, this study) Zanella et al.1; Doksani Lab plasmid #139 N/A Software and algorithms ImageJ/Fiji v1.54 (gel quantification) Schneider et al.12 https://imagej.nih.gov/ij/; RRID: SCR_002285 GraphPad Prism v9+ GraphPad Software https://www.graphpad.com/; RRID: SCR_002798 Typhoon scanner control software Cytiva/GE Healthcare N/A Other Amersham Typhoon 5 PhosphorImager scanner Cytiva RRID: SCR_025702 ChemiDoc Imaging System (or equivalent gel documentation system) Bio-Rad N/A DMEM High Glucose (cell culture medium) Euroclone Cat# ECB7501L DNA ladder, 1 kb, dye-free (alkaline gels) NEB Cat# N3232L Lambda DNA-HindIII digest NEB Cat# N3012L Gel electrophoresis apparatus with recirculating buffer pump (2D-gels) Thermo Scientific Cat# A5 Hybond-N+ nylon membrane Cytiva Cat# RPN203B Hybridization cassette VWR Cat# RPN11645 Hybridization Mesh Sheets Thermo Scientific Cat# 222053 MicroSpin G-25 Columns (purification of end-labeled probes) GE Healthcare Cat# 27532501 MicroSpin G-50 Columns (purification of randomly primed probes) GE Healthcare Cat# 27533001 Protran nitrocellulose membrane, 0.45 μm GE Healthcare Cat# 10600002 Penicillin/Streptomycin (1003 stock) Euroclone Cat# ECB3001L Peristaltic pump (for alkaline gel electrophoresis) Variable — any model rated 5–20 mL/min N/A Phosphor storage screen (BAS-MS type) GE Healthcare Cat# 28-9564-76 Plug molds (0.5 mL CHEF plug molds) Bio-Rad Cat# 1703713 QuBit 4 Fluorometer Invitrogen Cat# Q33226 Safe Imager 2.0 Blue-Light Transilluminator Thermo Fisher Scientific Cat# G6600 Syringe filters, 0.45 μm, low protein binding (PVDF) Merck Millipore Cat# SLHV033RS Standard horizontal gel electrophoresis apparatus Thermo Scientific Cat# A2-BP Tet-System Approved FBS (tetracycline-free fetal bovine serum) Euroclone Cat# ECS0182L (Continued on next page) 8 STAR Protocols 7, 104888, December 18, 2026 CRITICAL: Use tetracycline-free FBS, low-EEO agarose and freshly prepared alkaline electrophoresis buffer.

Lysis:

Negative Control:

Software:

Real-time Polymerase Chain Reaction:

Gel Extraction:

Plasmid Preparation:

Spectrophotometry:

CMC:

Article Title: PUS7 pseudouridylation of 7SK orchestrates human somatic cell reprogramming into iPS cells.
Article Snippet: .. The CMC-treated and untreated RNA samples were resuspended in 6.5 μl of water and incubated with 0.5 μl of RNase inhibitor (New England Biolabs, M0307L), 1 μl of 1 mM ATP, 1 μl of 10× T4 polynucleotide kinase reaction buffer A and 1 μl of T4 polynucleotide kinase (New England Biolabs, M0201S) at 37 °C for 30 min. For RNA linker ligation, the following were added: 1 μl of 10× T4 RNA ligase reaction buffer, 1 μl of 100 μM RNA-5 oligo (/5AmMC6/ rArCrCrCrA/; Integrated DNA Technologies), 1 μl of T4 RNA Ligase I (New England Biolabs, M0437M), 1 μl of RNase inhibitor, 1 μl of 1 mM ATP, 3 μl of DMSO and 2 μl of water. ..

Incubation:

Article Title: tRNA-derived second messengers confer bacterial immunity
Article Snippet: .. Approximately 1 μg of each purified Cas13 cleavage-product preparation or 40 pmol of synthetic RNA was incubated with 10 U T4 polynucleotide kinase (PNK; New England Biolabs, M0201) in a 10-μl reaction containing 1× T4 PNK Reaction Buffer, without added ATP. ..

Article Title: Single-allele nanoscale mapping of regulatory variants.
Article Snippet: The remaining reaction was centrifuged, PBS washed and resuspended in DNA ligation buffer (Thermo Fisher Scientific; final concentrations: 40 mM Tris-HCl, pH 7.5, 10 mM MgCl2, 10 mM dithiothreitol and 5 mM ATP) supplemented with dNTPs (final concentration 400 μM each for dATP, dCTP, dGTP and dTTP (Thermo Fisher Scientific, cat. no. R0191)) and EGTA 5 mM. .. T4 polynucleotide kinase PNK (NEB, cat. no. M0201L) and DNA polymerase I large (Klenow) fragment (NEB, cat. no. M0210L) were at final concentrations of 200 U ml−1 and 100 U ml−1, respectively, T4 DNA ligase (Thermo Fisher Scientific, high-concentration ligase (30 U μl−1), cat. no. EL0013) to a final concentration of 300 U ml−1 was added and the reaction was incubated at 37 °C for 2 h before cooling to 20 °C and overnight incubation on an Eppendorf Thermomixer with intermittent 500-r.p.m. ..

Review

end repair buffer 1 (New England Biolabs)

Structured Review

Images

Related Articles

Recombinant:

Sequencing:

Polymerase Chain Reaction:

Lysis:

Negative Control:

Software:

Real-time Polymerase Chain Reaction:

Gel Extraction:

Plasmid Preparation:

Spectrophotometry:

CMC:

Incubation:

Ligation:

Staining:

Cell Culture:

BIA-KA:

Cell-Signaling:

Fractionation:

Gas Chromatography:

Purification:

Concentration Assay:

Mutagenesis:

Amplification:

Labeling:

Qubit:

dsDNA Assay:

DNA Purification:

Generated:

Similar Products

Image Search Results