Review




Structured Review

Sequenom massarray assay design software
Figure 1: Single-nucleotide polymorphisms (SNPs) rs1800630 (-863A/C) genotyped in 958 endometriosis cases and 959 controls using Seque- nom <t>MassARRAY</t> platform (a) Genotypes for rs1800630 (known as -863C/A) were not consistent with Hardy–Weinberg equilibrium, (b) the assay showed good clusters and mass spectra and (c) the sequence of rs1800630 where arrows indicate positions of two neighbouring variants located adjacent to rs1800630 and in the site of the extension primer
Massarray Assay Design Software, supplied by Sequenom, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/multiplex+sequenom+massarray/assay+design+massarray+software/pm17595314-71-15-14
Average 86 stars, based on 1 article reviews
massarray assay design software - by Bioz Stars, 2026-10
86/100 stars

Images

1) Product Images from "Genetic variation in tumour necrosis factor and lymphotoxin is not associated with endometriosis in an Australian sample."

Article Title: Genetic variation in tumour necrosis factor and lymphotoxin is not associated with endometriosis in an Australian sample.

Journal: Human reproduction (Oxford, England)

doi: 10.1093/humrep/dem182

Figure 1: Single-nucleotide polymorphisms (SNPs) rs1800630 (-863A/C) genotyped in 958 endometriosis cases and 959 controls using Seque- nom MassARRAY platform (a) Genotypes for rs1800630 (known as -863C/A) were not consistent with Hardy–Weinberg equilibrium, (b) the assay showed good clusters and mass spectra and (c) the sequence of rs1800630 where arrows indicate positions of two neighbouring variants located adjacent to rs1800630 and in the site of the extension primer
Figure Legend Snippet: Figure 1: Single-nucleotide polymorphisms (SNPs) rs1800630 (-863A/C) genotyped in 958 endometriosis cases and 959 controls using Seque- nom MassARRAY platform (a) Genotypes for rs1800630 (known as -863C/A) were not consistent with Hardy–Weinberg equilibrium, (b) the assay showed good clusters and mass spectra and (c) the sequence of rs1800630 where arrows indicate positions of two neighbouring variants located adjacent to rs1800630 and in the site of the extension primer

Techniques Used: Sequencing

Related Articles

Software:

Article Title: TLR4 rs11536889 and rs1927914 SNPs are Associated with Ischemic Stroke Risk in a Southern Chinese Han Population
Article Snippet: .. The Sequenom Assay Designer 3.1 software was used to design the primers used in the polymerase chain reaction (PCR) amplification of the TLR4 gene. .. The genotypes were analyzed using the Sequenom MassARRAY iPLEX platform (Sequenom, San Diego, USA).

Article Title: GP6 polymorphisms and venous thromboembolism: a Chinese case-control study with cross-population assessment.
Article Snippet: .. All primers, including the extension primers for the SNP AR TIC LE IN PR ES S assay, were designed using MassARRAY Designer software (Sequenom). ..

Article Title: GP6 polymorphisms and venous thromboembolism: a Chinese case-control study with cross-population assessment
Article Snippet: .. All primers, including the extension primers for the SNP assay, were designed using MassARRAY Designer software (Sequenom). ..

Article Title: Analysis of MIR155HG gene polymorphisms and ulcerative colitis susceptibility in the Chinese Han Population
Article Snippet: .. Forward, reverse, and extension primers for PCR amplification were designed using the Assay Design software (Sequenom Inc, San Diego, CA, USA) ( ). .. Genotyping of candidate SNPs was performed using the iPLEX Assay and MassARRAY system (Sequenom Inc., San Diego, CA, USA) through chip-based matrix-assisted laser desorption/ionization time of flight mass spectrometry (MALDI-TOF MS).

Article Title: IL-17A rs2275913 polymorphism is associated with spinal tuberculosis but not with pulmonary tuberculosis: A study of the Han population in southern China.
Article Snippet: .. Designed for IL-17 a SNP genotyping of primers (Forward: 5'ATGGTGTTAATCTCATCTGGTGGG3′, Reverse: 5′ATGCCCACGGTCCAGAAATAC3′), primers for this locus were designed and synthesized using Mass Assay Designer 3.1 software (Sequenom, San Diego, CA, USA). ..

Article Title: Analysis of TNFAIP3, IRAK1, and TLR4 Gene Polymorphisms in Patients With Rheumatoid Arthritis.
Article Snippet: .. Primer sequences for PCR amplification and single base extension were designed using Sequenom's MassARRAY Assay Design software. ..

Article Title: Whole-genome resequencing uncovers population structure and candidate molecular markers for litter size in hetian sheep
Article Snippet: .. Based on gene sequence information from the NCBI database (Ovis aries), PCR primers and single-base extension primers were designed using AssayDesigner 3.1 software (Sequenom) (see Extended Data Table 1). .. All primers were synthesized by Beijing Compass Agricultural Technology Co., Ltd. Polymorphism detection of the 23 SNP loci was conducted in a cohort of 219 Hetian sheep using the Sequenom MassARRAY ® SNP genotyping platform, which utilizes matrix-assisted laser desorption/ionization time-of-flight (MALDI-TOF) mass spectrometry.

Article Title: Analysis of TNFAIP3, IRAK1, and TLR4 Gene Polymorphisms in Patients With Rheumatoid Arthritis
Article Snippet: .. Primer sequences for PCR amplification and single base extension were designed using Sequenom's MassARRAY Assay Design software. ..

Polymerase Chain Reaction:

Article Title: TLR4 rs11536889 and rs1927914 SNPs are Associated with Ischemic Stroke Risk in a Southern Chinese Han Population
Article Snippet: .. The Sequenom Assay Designer 3.1 software was used to design the primers used in the polymerase chain reaction (PCR) amplification of the TLR4 gene. .. The genotypes were analyzed using the Sequenom MassARRAY iPLEX platform (Sequenom, San Diego, USA).

Article Title: Analysis of MIR155HG gene polymorphisms and ulcerative colitis susceptibility in the Chinese Han Population
Article Snippet: .. Forward, reverse, and extension primers for PCR amplification were designed using the Assay Design software (Sequenom Inc, San Diego, CA, USA) ( ). .. Genotyping of candidate SNPs was performed using the iPLEX Assay and MassARRAY system (Sequenom Inc., San Diego, CA, USA) through chip-based matrix-assisted laser desorption/ionization time of flight mass spectrometry (MALDI-TOF MS).

Article Title: Analysis of TNFAIP3, IRAK1, and TLR4 Gene Polymorphisms in Patients With Rheumatoid Arthritis.
Article Snippet: .. Primer sequences for PCR amplification and single base extension were designed using Sequenom's MassARRAY Assay Design software. ..

Article Title: Whole-genome resequencing uncovers population structure and candidate molecular markers for litter size in hetian sheep
Article Snippet: .. Based on gene sequence information from the NCBI database (Ovis aries), PCR primers and single-base extension primers were designed using AssayDesigner 3.1 software (Sequenom) (see Extended Data Table 1). .. All primers were synthesized by Beijing Compass Agricultural Technology Co., Ltd. Polymorphism detection of the 23 SNP loci was conducted in a cohort of 219 Hetian sheep using the Sequenom MassARRAY ® SNP genotyping platform, which utilizes matrix-assisted laser desorption/ionization time-of-flight (MALDI-TOF) mass spectrometry.

Article Title: Analysis of TNFAIP3, IRAK1, and TLR4 Gene Polymorphisms in Patients With Rheumatoid Arthritis
Article Snippet: .. Primer sequences for PCR amplification and single base extension were designed using Sequenom's MassARRAY Assay Design software. ..

Amplification:

Article Title: TLR4 rs11536889 and rs1927914 SNPs are Associated with Ischemic Stroke Risk in a Southern Chinese Han Population
Article Snippet: .. The Sequenom Assay Designer 3.1 software was used to design the primers used in the polymerase chain reaction (PCR) amplification of the TLR4 gene. .. The genotypes were analyzed using the Sequenom MassARRAY iPLEX platform (Sequenom, San Diego, USA).

Article Title: Analysis of MIR155HG gene polymorphisms and ulcerative colitis susceptibility in the Chinese Han Population
Article Snippet: .. Forward, reverse, and extension primers for PCR amplification were designed using the Assay Design software (Sequenom Inc, San Diego, CA, USA) ( ). .. Genotyping of candidate SNPs was performed using the iPLEX Assay and MassARRAY system (Sequenom Inc., San Diego, CA, USA) through chip-based matrix-assisted laser desorption/ionization time of flight mass spectrometry (MALDI-TOF MS).

Article Title: Analysis of TNFAIP3, IRAK1, and TLR4 Gene Polymorphisms in Patients With Rheumatoid Arthritis.
Article Snippet: .. Primer sequences for PCR amplification and single base extension were designed using Sequenom's MassARRAY Assay Design software. ..

Article Title: Analysis of TNFAIP3, IRAK1, and TLR4 Gene Polymorphisms in Patients With Rheumatoid Arthritis
Article Snippet: .. Primer sequences for PCR amplification and single base extension were designed using Sequenom's MassARRAY Assay Design software. ..

Synthesized:

Article Title: IL-17A rs2275913 polymorphism is associated with spinal tuberculosis but not with pulmonary tuberculosis: A study of the Han population in southern China.
Article Snippet: .. Designed for IL-17 a SNP genotyping of primers (Forward: 5'ATGGTGTTAATCTCATCTGGTGGG3′, Reverse: 5′ATGCCCACGGTCCAGAAATAC3′), primers for this locus were designed and synthesized using Mass Assay Designer 3.1 software (Sequenom, San Diego, CA, USA). ..

Mass Assay:

Article Title: IL-17A rs2275913 polymorphism is associated with spinal tuberculosis but not with pulmonary tuberculosis: A study of the Han population in southern China.
Article Snippet: .. Designed for IL-17 a SNP genotyping of primers (Forward: 5'ATGGTGTTAATCTCATCTGGTGGG3′, Reverse: 5′ATGCCCACGGTCCAGAAATAC3′), primers for this locus were designed and synthesized using Mass Assay Designer 3.1 software (Sequenom, San Diego, CA, USA). ..

Sequencing:

Article Title: Whole-genome resequencing uncovers population structure and candidate molecular markers for litter size in hetian sheep
Article Snippet: .. Based on gene sequence information from the NCBI database (Ovis aries), PCR primers and single-base extension primers were designed using AssayDesigner 3.1 software (Sequenom) (see Extended Data Table 1). .. All primers were synthesized by Beijing Compass Agricultural Technology Co., Ltd. Polymorphism detection of the 23 SNP loci was conducted in a cohort of 219 Hetian sheep using the Sequenom MassARRAY ® SNP genotyping platform, which utilizes matrix-assisted laser desorption/ionization time-of-flight (MALDI-TOF) mass spectrometry.



Similar Products

90
Sequenom multiplex sequenom massarray
Multiplex Sequenom Massarray, supplied by Sequenom, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/multiplex+sequenom+massarray/sequenom+massarray/pmc10859749-96-14-15
Average 90 stars, based on 1 article reviews
multiplex sequenom massarray - by Bioz Stars, 2026-10
90/100 stars
  Buy from Supplier

90
Sequenom mass spectrometry-based panel of multiplexed assays sequenom massarray
Mass Spectrometry Based Panel Of Multiplexed Assays Sequenom Massarray, supplied by Sequenom, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/multiplex+sequenom+massarray/sequenom+massarray/pmc04472471-50-13-17
Average 90 stars, based on 1 article reviews
mass spectrometry-based panel of multiplexed assays sequenom massarray - by Bioz Stars, 2026-10
90/100 stars
  Buy from Supplier

90
Sequenom sequenom multiplex massarray
Sequenom Multiplex Massarray, supplied by Sequenom, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/multiplex+sequenom+massarray/sequenom+massarray/pmc09502058__mmc1-54-16-16
Average 90 stars, based on 1 article reviews
sequenom multiplex massarray - by Bioz Stars, 2026-10
90/100 stars
  Buy from Supplier

90
Sequenom custom-designed multiplex array sequenom massarray iplex gold
Custom Designed Multiplex Array Sequenom Massarray Iplex Gold, supplied by Sequenom, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/multiplex+sequenom+massarray/sequenom+massarray/pm34015137-70-20-22
Average 90 stars, based on 1 article reviews
custom-designed multiplex array sequenom massarray iplex gold - by Bioz Stars, 2026-10
90/100 stars
  Buy from Supplier

90
Sequenom multiplex sequenom massarray platform
Multiplex Sequenom Massarray Platform, supplied by Sequenom, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/multiplex+sequenom+massarray/sequenom+massarray/pm31071710-53-10-11
Average 90 stars, based on 1 article reviews
multiplex sequenom massarray platform - by Bioz Stars, 2026-10
90/100 stars
  Buy from Supplier

90
Sequenom custom sequenom multiplex massarray assay
Custom Sequenom Multiplex Massarray Assay, supplied by Sequenom, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/multiplex+sequenom+massarray/sequenom+massarray/pmc06502852-255-12-13
Average 90 stars, based on 1 article reviews
custom sequenom multiplex massarray assay - by Bioz Stars, 2026-10
90/100 stars
  Buy from Supplier

Image Search Results