multiple sequence alignment tool (clustalw) algorithm (Bioedit Company)
90
Structured Review
Bioedit Company
multiple sequence alignment tool (clustalw) algorithm
Multiple Sequence Alignment Tool (Clustalw) Algorithm, supplied by Bioedit Company, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/multiple+sequence+alignment+tool+(clustalw)+algorithm/sequence+alignment+editor+tool/pm40577448-70-7-13
Average 90 stars, based on 1 article reviews
Multiple Sequence Alignment Tool (Clustalw) Algorithm, supplied by Bioedit Company, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/multiple+sequence+alignment+tool+(clustalw)+algorithm/sequence+alignment+editor+tool/pm40577448-70-7-13
Average 90 stars, based on 1 article reviews
multiple sequence alignment tool (clustalw) algorithm - by Bioz Stars,
2026-09
90/100 stars
Images
Related Articles
Sequencing:Article Title: Specific Glycoprotein E (gE) Gene Based Nested Polymerase Chain Reaction Assay for Detection of Marek’s Disease Virus in Chickens Article Snippet: Poultry industry is one of the prime agricultural sectors that not only contributes to Global economy but also supports livelihood sustainability of the poultry farmers.. However, this sector often faces severe economic losses due to various infectious diseases.. Marek’s disease (MD) is one of the common viral diseases of poultry, caused by Marek’s disease virus (MDV). Article Title: Molecular genetic analyses of the N, NSm and NSs genes of a local population of Orthotospovirus tomatomaculae reveal purifying selection in crops in the southeastern USA. Article Snippet: Purified PCR products with 10–30 ng μl−1 of DNA concentration were sent for bidirectional Sanger’s sequencing at Eurofins Genomics (Eurofins MWG Operon Inc., Louisville, KY, USA) sequencing facility. .. The obtained full- length sequences of N, NSm and NSs genes were manually checked and aligned using the BioEdit ( Article Title: Exogenous application of dsRNAs targeting multiple genes of cucumber mosaic virus in Cucumis sativus significantly reduces the viral titre Article Snippet: Cucumber mosaic virus (CMV) (genus: Cucumovirus, family: Bromoviridae) causes substantial crop losses affecting more than 1200 cultivated plant species representing 100 different families (Mochizuki and Ohki 2012).. CMV is mainly transmitted by several different species of aphids, as well as mechanically by sap (Palukaitis and García-Arenal 2003).. Depending on the host plant and the virus strain, the symptom phenotype ranges from mild to severe leaf mosaic, chlorosis, crinkling and stunting, and necrosis accompanied with distortion of fruits (Zitter and Murphy 2009). Article Title: Comparative study of pro-inflammatory cytokine expression among two common freshwater Cichlids Article Snippet: .. melanotheron (SM) and Coptodon zillii (CZ) >Coptodon Tilapia zillii CGAGAAGAAATCACCCGCAGAGTGGATATGGAA GGTGTGCGCCGTCCTCGTCATCGTGGCTCTTTG TTTAGCAGGTGTCCTGCTGTTTGCCTGGTACTG GAATACAAGGCCAGAAAGGAGACACAATTAGGA CAGCCAGAAGCACTAAAGGCGAAGAACACTGGC GACAAAACAGAGCCCCACTCCACGCTAAAACGG ATCAGCAGCAAAGCCAAGGCAGCCATCCATCTA GAAGGTGAGTCACCGCTTCCCTTGATTTGGTCC TCAGCAAACAATAGGCTCATAATCTCGGCCTTCA GAGGAGCTTTTCTGAGTTTTTCTTCTCCCTCTGT GGTATTGGTAGCTCTCTTCTTTTTTGAAACTAAG AGCGCTATAAGAAAGTCCCATAAGTTTACTGGCT TGTCAATACTTCATTCTGCTCTCCAAATAACAAA CCTGTCAGTAATTCACACTCAGGTATTTCAAGGC TGTAACGTTTCTGATCTTTACTTGCAGGCAGGAC TCAAAAGGTCATCTGGAGTGGAGGGATGGTCAA GGCCAGGCGTTCACTCAGGGGAGGCCAACA >Sarotherodon melanotheron TGAGAAGATCTCACCCGCAGAGCACATATGGAA GGTGCGCCCCCTCCTCGTCATCGTGTCTCTCTG TTTCACAGGTGTCCCCCTGTCCGCCCGGTTCCG GTACACGAGCACAGAGAGGAGACACAATTAGGA CAGCCAGAAGCACTAAAGGCGAAGAACACTGGC GACAAAACAGAGCCCCACTCCACGCTAAAACGG ATCAGCAGCAAAGCCAAGGCAGCCATCCATCTA GAAGGTGAGTCACCGCTTACCTTGATTTGGTCC TCAGCAAACAATAGGCTCATAATCTCGGCCTTCA GAGGAGCTTTTCTGAGTTTTTCTTCTCCCTCTGT GGTATTGGTAGCTCTCTTCTTTTTTGAAACTAAG AGCGCTATAAGAAAGTCCCATAAGTTTACTGGCT TGTCAATACTTCATTCTGCTCTCCAAATAACAAA CCTGTCAGTAATTCACACTCAGGTATTTCAAGGC TGTAACGTTTCTGATCTTTACTTGCAGGCAGGAC TCAAAAGGTCATCTGGAGTGGAGGGATGGTCAA GGCCAGGCGTTCACTCAGGGGAGGCCAACA Nucleotide Sequence Pairwise Sequence Alignment Pairwise alignment of TNF-α sequences analyzed using the BioEdit Article Title: Eco-friendly biotransformation of penicillin G by free and immobilized marine halophilic Bacillus pseudomycoides AH1 Article Snippet: .. The Biotransformation efficiency (%) = (initial PEN−G concentration) − (final PEN−G concentration)/(initial PEN−G concentration)×100 Biotransformation rate (mg/h) = (degraded PEN−G (mg))/(fermentation period (h)) sequence was determined using the BioEdit Article Title: Comprehensive analysis of little leaf disease incidence and resistance in eggplant Article Snippet: PCR products of R16F2n/R16R2 were outsourced and sequenced bidirectionally at Eurofins Genomics India Pvt Ltd, Bangalore, India. .. The BioEdit other:Article Title: Genetic Diversity in the Fusion Gene of Respiratory Syncytial Virus (RSV) Isolated From Iraqi Patients: A First Report Article Snippet: Using the Article Title: Mapping and phylogeny of Biomphalaria snail in the Adamawa Region of Cameroon: A step towards vector control and schistosomiasis elimination. Article Snippet: Consensus sequences were aligned using the multiple Concentration Assay:Article Title: Eco-friendly biotransformation of penicillin G by free and immobilized marine halophilic Bacillus pseudomycoides AH1 Article Snippet: .. The Biotransformation efficiency (%) = (initial PEN−G concentration) − (final PEN−G concentration)/(initial PEN−G concentration)×100 Biotransformation rate (mg/h) = (degraded PEN−G (mg))/(fermentation period (h)) sequence was determined using the BioEdit |