Modification:Article Title: Replication stress increases de novo CNVs across the malaria parasite genome
Article Snippet: .. In summary, (i) we modified the pre-amplification random primer by adding five additional degenerate bases with 20% GC-content to increase annealing to AT-rich genome sequences (5′GTGAGTGATGGTTGAGGTAGTGTGGAG NNNNNNNNNN TTT 3′); (ii) we performed 19 of the 21 total linear cycles with the Bsu DNA Polymerase (Large Fragment, New England Biosciences), which has a lower optimal reaction temperature (37°C) to improve the amplification on AT-rich sequences [ ]; (iii) we lowered the extension temperature from 40/50°C to 37°C during the linear amplification cycles that used the Bsu enzyme (see full cycling parameters in and impacts of these changes in ); and (iv) we integrated robotic pipetting (Mosquito LV, SPT Labtech, Melbourn, UK) to increase the throughput of our assays (from 23 samples in Version 1 to 90 samples in the current Version 2) and limit contamination potential. .. Overall, we performed 21 total linear cycles (19 cycles with Bsu polymerase and 2 cycles with Bst polymerase, New England Biolabs, Ipswitch, MA) and 17 total exponential amplification cycles using Herculase II Fusion DNA polymerase (Agilent Technologies, Santa Clara, CA).
Amplification:Article Title: Replication stress increases de novo CNVs across the malaria parasite genome
Article Snippet: .. In summary, (i) we modified the pre-amplification random primer by adding five additional degenerate bases with 20% GC-content to increase annealing to AT-rich genome sequences (5′GTGAGTGATGGTTGAGGTAGTGTGGAG NNNNNNNNNN TTT 3′); (ii) we performed 19 of the 21 total linear cycles with the Bsu DNA Polymerase (Large Fragment, New England Biosciences), which has a lower optimal reaction temperature (37°C) to improve the amplification on AT-rich sequences [ ]; (iii) we lowered the extension temperature from 40/50°C to 37°C during the linear amplification cycles that used the Bsu enzyme (see full cycling parameters in and impacts of these changes in ); and (iv) we integrated robotic pipetting (Mosquito LV, SPT Labtech, Melbourn, UK) to increase the throughput of our assays (from 23 samples in Version 1 to 90 samples in the current Version 2) and limit contamination potential. .. Overall, we performed 21 total linear cycles (19 cycles with Bsu polymerase and 2 cycles with Bst polymerase, New England Biolabs, Ipswitch, MA) and 17 total exponential amplification cycles using Herculase II Fusion DNA polymerase (Agilent Technologies, Santa Clara, CA).
High Performance Liquid Chromatography:Article Title: Mechanistic design of cell-penetrating disruptors for phospho-dependent TACC3-CHC interaction.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Mosquito LV Crystal SPT labtech N/A MultiPep 2 peptide synthesizer CEM corp. N/A Agilent 1250 infinity HPLC Agilent N/A Agilent 1260 infinity HPLC Agilent N/A Agilent 1290 Infinity II HPLC Agilent N/A Kinetex EVO 5 μm C18 100 Å 21.2 × 250 mm RP column Phenomenex Cat# 00G-4633-P0-AX Agilent semi-prep Zorbax SB-C18 column Agilent N/A Agilent 6120 Single Quadrupole LC/MS Agilent N/A MagStrep ‘‘type 3’’ XT Sepharose beads IBA Cat# 2-4090-010 Biacore 1K+ SPR System Cytiva N/A Streptavidin SA chip Cytiva Cat# BR100398 APP Chirascan CD spectropolarimeter Applied Photophysics N/A Cytoflex S flow cytometer Beckman Coulter N/A Zeiss LSM880 upright confocal microscope Zeiss N/A 35 mm cell culture imaging dish with coverslip bottom Ibidi Cat# 81156 Zeiss Lattice Lightsheet 7 microscope Zeiss N/A ll OPEN ACCESS Article e7 Structure 34, 1–17.e1–e12, June 4, 2026 consisted of 2 g/L of 15NH4Cl and 4 g/L of 13C D-glucose in 50 mM Na2HPO4, 25 mM KH2PO4, 20 mM NaCl, 2 mM MgSO4, 0.2 mM CaCl2, 0.01 mM FeSO4, supplemented with micronutrients and vitamins (BME vitamins, Sigma-Merck). ..
SPR Assay:Article Title: Mechanistic design of cell-penetrating disruptors for phospho-dependent TACC3-CHC interaction.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Mosquito LV Crystal SPT labtech N/A MultiPep 2 peptide synthesizer CEM corp. N/A Agilent 1250 infinity HPLC Agilent N/A Agilent 1260 infinity HPLC Agilent N/A Agilent 1290 Infinity II HPLC Agilent N/A Kinetex EVO 5 μm C18 100 Å 21.2 × 250 mm RP column Phenomenex Cat# 00G-4633-P0-AX Agilent semi-prep Zorbax SB-C18 column Agilent N/A Agilent 6120 Single Quadrupole LC/MS Agilent N/A MagStrep ‘‘type 3’’ XT Sepharose beads IBA Cat# 2-4090-010 Biacore 1K+ SPR System Cytiva N/A Streptavidin SA chip Cytiva Cat# BR100398 APP Chirascan CD spectropolarimeter Applied Photophysics N/A Cytoflex S flow cytometer Beckman Coulter N/A Zeiss LSM880 upright confocal microscope Zeiss N/A 35 mm cell culture imaging dish with coverslip bottom Ibidi Cat# 81156 Zeiss Lattice Lightsheet 7 microscope Zeiss N/A ll OPEN ACCESS Article e7 Structure 34, 1–17.e1–e12, June 4, 2026 consisted of 2 g/L of 15NH4Cl and 4 g/L of 13C D-glucose in 50 mM Na2HPO4, 25 mM KH2PO4, 20 mM NaCl, 2 mM MgSO4, 0.2 mM CaCl2, 0.01 mM FeSO4, supplemented with micronutrients and vitamins (BME vitamins, Sigma-Merck). ..
Flow Cytometry:Article Title: Mechanistic design of cell-penetrating disruptors for phospho-dependent TACC3-CHC interaction.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Mosquito LV Crystal SPT labtech N/A MultiPep 2 peptide synthesizer CEM corp. N/A Agilent 1250 infinity HPLC Agilent N/A Agilent 1260 infinity HPLC Agilent N/A Agilent 1290 Infinity II HPLC Agilent N/A Kinetex EVO 5 μm C18 100 Å 21.2 × 250 mm RP column Phenomenex Cat# 00G-4633-P0-AX Agilent semi-prep Zorbax SB-C18 column Agilent N/A Agilent 6120 Single Quadrupole LC/MS Agilent N/A MagStrep ‘‘type 3’’ XT Sepharose beads IBA Cat# 2-4090-010 Biacore 1K+ SPR System Cytiva N/A Streptavidin SA chip Cytiva Cat# BR100398 APP Chirascan CD spectropolarimeter Applied Photophysics N/A Cytoflex S flow cytometer Beckman Coulter N/A Zeiss LSM880 upright confocal microscope Zeiss N/A 35 mm cell culture imaging dish with coverslip bottom Ibidi Cat# 81156 Zeiss Lattice Lightsheet 7 microscope Zeiss N/A ll OPEN ACCESS Article e7 Structure 34, 1–17.e1–e12, June 4, 2026 consisted of 2 g/L of 15NH4Cl and 4 g/L of 13C D-glucose in 50 mM Na2HPO4, 25 mM KH2PO4, 20 mM NaCl, 2 mM MgSO4, 0.2 mM CaCl2, 0.01 mM FeSO4, supplemented with micronutrients and vitamins (BME vitamins, Sigma-Merck). ..
Microscopy:Article Title: Mechanistic design of cell-penetrating disruptors for phospho-dependent TACC3-CHC interaction.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Mosquito LV Crystal SPT labtech N/A MultiPep 2 peptide synthesizer CEM corp. N/A Agilent 1250 infinity HPLC Agilent N/A Agilent 1260 infinity HPLC Agilent N/A Agilent 1290 Infinity II HPLC Agilent N/A Kinetex EVO 5 μm C18 100 Å 21.2 × 250 mm RP column Phenomenex Cat# 00G-4633-P0-AX Agilent semi-prep Zorbax SB-C18 column Agilent N/A Agilent 6120 Single Quadrupole LC/MS Agilent N/A MagStrep ‘‘type 3’’ XT Sepharose beads IBA Cat# 2-4090-010 Biacore 1K+ SPR System Cytiva N/A Streptavidin SA chip Cytiva Cat# BR100398 APP Chirascan CD spectropolarimeter Applied Photophysics N/A Cytoflex S flow cytometer Beckman Coulter N/A Zeiss LSM880 upright confocal microscope Zeiss N/A 35 mm cell culture imaging dish with coverslip bottom Ibidi Cat# 81156 Zeiss Lattice Lightsheet 7 microscope Zeiss N/A ll OPEN ACCESS Article e7 Structure 34, 1–17.e1–e12, June 4, 2026 consisted of 2 g/L of 15NH4Cl and 4 g/L of 13C D-glucose in 50 mM Na2HPO4, 25 mM KH2PO4, 20 mM NaCl, 2 mM MgSO4, 0.2 mM CaCl2, 0.01 mM FeSO4, supplemented with micronutrients and vitamins (BME vitamins, Sigma-Merck). ..
Cell Culture:Article Title: Mechanistic design of cell-penetrating disruptors for phospho-dependent TACC3-CHC interaction.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Mosquito LV Crystal SPT labtech N/A MultiPep 2 peptide synthesizer CEM corp. N/A Agilent 1250 infinity HPLC Agilent N/A Agilent 1260 infinity HPLC Agilent N/A Agilent 1290 Infinity II HPLC Agilent N/A Kinetex EVO 5 μm C18 100 Å 21.2 × 250 mm RP column Phenomenex Cat# 00G-4633-P0-AX Agilent semi-prep Zorbax SB-C18 column Agilent N/A Agilent 6120 Single Quadrupole LC/MS Agilent N/A MagStrep ‘‘type 3’’ XT Sepharose beads IBA Cat# 2-4090-010 Biacore 1K+ SPR System Cytiva N/A Streptavidin SA chip Cytiva Cat# BR100398 APP Chirascan CD spectropolarimeter Applied Photophysics N/A Cytoflex S flow cytometer Beckman Coulter N/A Zeiss LSM880 upright confocal microscope Zeiss N/A 35 mm cell culture imaging dish with coverslip bottom Ibidi Cat# 81156 Zeiss Lattice Lightsheet 7 microscope Zeiss N/A ll OPEN ACCESS Article e7 Structure 34, 1–17.e1–e12, June 4, 2026 consisted of 2 g/L of 15NH4Cl and 4 g/L of 13C D-glucose in 50 mM Na2HPO4, 25 mM KH2PO4, 20 mM NaCl, 2 mM MgSO4, 0.2 mM CaCl2, 0.01 mM FeSO4, supplemented with micronutrients and vitamins (BME vitamins, Sigma-Merck). ..
Imaging:Article Title: Mechanistic design of cell-penetrating disruptors for phospho-dependent TACC3-CHC interaction.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Mosquito LV Crystal SPT labtech N/A MultiPep 2 peptide synthesizer CEM corp. N/A Agilent 1250 infinity HPLC Agilent N/A Agilent 1260 infinity HPLC Agilent N/A Agilent 1290 Infinity II HPLC Agilent N/A Kinetex EVO 5 μm C18 100 Å 21.2 × 250 mm RP column Phenomenex Cat# 00G-4633-P0-AX Agilent semi-prep Zorbax SB-C18 column Agilent N/A Agilent 6120 Single Quadrupole LC/MS Agilent N/A MagStrep ‘‘type 3’’ XT Sepharose beads IBA Cat# 2-4090-010 Biacore 1K+ SPR System Cytiva N/A Streptavidin SA chip Cytiva Cat# BR100398 APP Chirascan CD spectropolarimeter Applied Photophysics N/A Cytoflex S flow cytometer Beckman Coulter N/A Zeiss LSM880 upright confocal microscope Zeiss N/A 35 mm cell culture imaging dish with coverslip bottom Ibidi Cat# 81156 Zeiss Lattice Lightsheet 7 microscope Zeiss N/A ll OPEN ACCESS Article e7 Structure 34, 1–17.e1–e12, June 4, 2026 consisted of 2 g/L of 15NH4Cl and 4 g/L of 13C D-glucose in 50 mM Na2HPO4, 25 mM KH2PO4, 20 mM NaCl, 2 mM MgSO4, 0.2 mM CaCl2, 0.01 mM FeSO4, supplemented with micronutrients and vitamins (BME vitamins, Sigma-Merck). ..
Crystallization Assay:
|
SPT Labtech is a verified supplier 
SPT Labtech manufactures this product 