maxiscript t7 rna synthesis kit (Promega)
90
Structured Review
Promega
maxiscript t7 rna synthesis kit
Maxiscript T7 Rna Synthesis Kit, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/maxiscript+t7/maxiscript+t7+rna+synthesis+kit/pmc09689654-92-25-30
Average 90 stars, based on 1 article reviews
Maxiscript T7 Rna Synthesis Kit, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/maxiscript+t7/maxiscript+t7+rna+synthesis+kit/pmc09689654-92-25-30
Average 90 stars, based on 1 article reviews
maxiscript t7 rna synthesis kit - by Bioz Stars,
2026-09
90/100 stars
Images
Related Articles
In Vitro:Article Title: Molecular characterization and functional analysis of multidrug resistance-associated genes of Pinewood nematode (Bursaphelenchus xylophilus) for nematicides. Article Snippet: Bursaphelenchus xylophilus (Pinewood nematode, PWN) is the causative agent of pine wilt disease (PWD) which caused serious threat to pine forests in the world, especially in East Asia and Western Europe.. At present, the control of PWD mainly rely on the massive use of pesticide despite the damage to human health and environmental safety.. Developing novel drug targets is the optimized strategy for developing new method to control PWN. Software:Article Title: Molecular characterization and functional analysis of glutathione S-transferase genes of pine wood nematode (Bursaphelenchus xylophilus) for avermectin. Article Snippet: Pine wilt disease (PWD), caused by Bursaphelenchus xylophilus (pine wood nematodes, PWNs), is a forest disease that seriously threatens the health of Pinus forestry.. Glutathione S-transferases (GSTs) play important roles in xenobiotic metabolism, lipophilic compound transport, antioxidative stress reactions, anti-mutagenesis, and antitumor activity.. The analysis and investigation of the specific functions of GSTs in the metabolism of toxic substances in nematodes are important for identifying potential target genes to control the spread and transmission of B. xylophilus. Article Title: Functional Study on Cytochrome P450 in Response to L(−)-Carvone Stress in Bursaphelenchus xylophilus Article Snippet: .. RNAi primers were designed by BioXM2.6 software based on Bx-cyp29A3 (Bx-cyp29A3 -iF: GCTAATACGACTCACTATAGGGATCGCCGTCCAGAAGTTCAACCATC; Bx-cyp29A3 -iR: AGTAATACGACTCACTATAGGGATCATGACAAGCCAATGCCCAAAGG) and then a transcriptional synthesis of dsRNA by a Blocking Assay:Article Title: Molecular characterization and functional analysis of glutathione S-transferase genes of pine wood nematode (Bursaphelenchus xylophilus) for avermectin. Article Snippet: Pine wilt disease (PWD), caused by Bursaphelenchus xylophilus (pine wood nematodes, PWNs), is a forest disease that seriously threatens the health of Pinus forestry.. Glutathione S-transferases (GSTs) play important roles in xenobiotic metabolism, lipophilic compound transport, antioxidative stress reactions, anti-mutagenesis, and antitumor activity.. The analysis and investigation of the specific functions of GSTs in the metabolism of toxic substances in nematodes are important for identifying potential target genes to control the spread and transmission of B. xylophilus. other:Article Title: Exploring the role of detoxification genes in the resistance of Bursaphelenchus xylophilus to different exogenous nematicidal substances using transcriptomic analyses. Article Snippet: Bursaphelenchus xylophilus (Pine wood nematode, PWN) has become a worldwide forest disease due to its rapid infection ability, high lethality and difficulty in control.. The main means of countering B. xylophilus is currently chemical control, but nematicides can present problems such as environmental pollution and drug resistance.. The development of novel environmentally-friendly nematicides has thus become a focus of recent research. |