massarray assay designer software (Sequenom)
86
Structured Review
Sequenom
massarray assay designer software
Massarray Assay Designer Software, supplied by Sequenom, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/massarray+system+designer+software/assay+design+massarray+software/pmc12463820-107-10-9
Average 86 stars, based on 1 article reviews
Massarray Assay Designer Software, supplied by Sequenom, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/massarray+system+designer+software/assay+design+massarray+software/pmc12463820-107-10-9
Average 86 stars, based on 1 article reviews
massarray assay designer software - by Bioz Stars,
2026-09
86/100 stars
Images
Related Articles
Software:Article Title: TLR4 rs11536889 and rs1927914 SNPs are Associated with Ischemic Stroke Risk in a Southern Chinese Han Population Article Snippet: .. The Sequenom Article Title: GP6 polymorphisms and venous thromboembolism: a Chinese case-control study with cross-population assessment. Article Snippet: .. All primers, including the extension primers for the SNP AR TIC LE IN PR ES S assay, were designed using Article Title: GP6 polymorphisms and venous thromboembolism: a Chinese case-control study with cross-population assessment Article Snippet: .. All primers, including the extension primers for the SNP assay, were designed using Article Title: Analysis of MIR155HG gene polymorphisms and ulcerative colitis susceptibility in the Chinese Han Population Article Snippet: .. Forward, reverse, and extension primers for PCR amplification were designed using the Article Title: IL-17A rs2275913 polymorphism is associated with spinal tuberculosis but not with pulmonary tuberculosis: A study of the Han population in southern China. Article Snippet: .. Designed for IL-17 a SNP genotyping of primers (Forward: 5'ATGGTGTTAATCTCATCTGGTGGG3′, Reverse: 5′ATGCCCACGGTCCAGAAATAC3′), primers for this locus were designed and synthesized using Article Title: Analysis of TNFAIP3, IRAK1, and TLR4 Gene Polymorphisms in Patients With Rheumatoid Arthritis. Article Snippet: .. Primer sequences for PCR amplification and single base extension were designed using Sequenom's Article Title: Whole-genome resequencing uncovers population structure and candidate molecular markers for litter size in hetian sheep Article Snippet: .. Based on gene sequence information from the NCBI database (Ovis aries), PCR primers and single-base extension primers were designed using Article Title: Analysis of TNFAIP3, IRAK1, and TLR4 Gene Polymorphisms in Patients With Rheumatoid Arthritis Article Snippet: .. Primer sequences for PCR amplification and single base extension were designed using Sequenom's Polymerase Chain Reaction:Article Title: TLR4 rs11536889 and rs1927914 SNPs are Associated with Ischemic Stroke Risk in a Southern Chinese Han Population Article Snippet: .. The Sequenom Article Title: Analysis of MIR155HG gene polymorphisms and ulcerative colitis susceptibility in the Chinese Han Population Article Snippet: .. Forward, reverse, and extension primers for PCR amplification were designed using the Article Title: Analysis of TNFAIP3, IRAK1, and TLR4 Gene Polymorphisms in Patients With Rheumatoid Arthritis. Article Snippet: .. Primer sequences for PCR amplification and single base extension were designed using Sequenom's Article Title: Whole-genome resequencing uncovers population structure and candidate molecular markers for litter size in hetian sheep Article Snippet: .. Based on gene sequence information from the NCBI database (Ovis aries), PCR primers and single-base extension primers were designed using Article Title: Analysis of TNFAIP3, IRAK1, and TLR4 Gene Polymorphisms in Patients With Rheumatoid Arthritis Article Snippet: .. Primer sequences for PCR amplification and single base extension were designed using Sequenom's Amplification:Article Title: TLR4 rs11536889 and rs1927914 SNPs are Associated with Ischemic Stroke Risk in a Southern Chinese Han Population Article Snippet: .. The Sequenom Article Title: Analysis of MIR155HG gene polymorphisms and ulcerative colitis susceptibility in the Chinese Han Population Article Snippet: .. Forward, reverse, and extension primers for PCR amplification were designed using the Article Title: Analysis of TNFAIP3, IRAK1, and TLR4 Gene Polymorphisms in Patients With Rheumatoid Arthritis. Article Snippet: .. Primer sequences for PCR amplification and single base extension were designed using Sequenom's Article Title: Analysis of TNFAIP3, IRAK1, and TLR4 Gene Polymorphisms in Patients With Rheumatoid Arthritis Article Snippet: .. Primer sequences for PCR amplification and single base extension were designed using Sequenom's Synthesized:Article Title: IL-17A rs2275913 polymorphism is associated with spinal tuberculosis but not with pulmonary tuberculosis: A study of the Han population in southern China. Article Snippet: .. Designed for IL-17 a SNP genotyping of primers (Forward: 5'ATGGTGTTAATCTCATCTGGTGGG3′, Reverse: 5′ATGCCCACGGTCCAGAAATAC3′), primers for this locus were designed and synthesized using Mass Assay:Article Title: IL-17A rs2275913 polymorphism is associated with spinal tuberculosis but not with pulmonary tuberculosis: A study of the Han population in southern China. Article Snippet: .. Designed for IL-17 a SNP genotyping of primers (Forward: 5'ATGGTGTTAATCTCATCTGGTGGG3′, Reverse: 5′ATGCCCACGGTCCAGAAATAC3′), primers for this locus were designed and synthesized using Sequencing:Article Title: Whole-genome resequencing uncovers population structure and candidate molecular markers for litter size in hetian sheep Article Snippet: .. Based on gene sequence information from the NCBI database (Ovis aries), PCR primers and single-base extension primers were designed using |