Review



length codon  (Twist Bioscience)


Bioz Verified Symbol Twist Bioscience is a verified supplier
Bioz Manufacturer Symbol Twist Bioscience manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 86
      Buy from Supplier

    Structured Review

    Twist Bioscience length codon
    Length Codon, supplied by Twist Bioscience, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/length+codon/fdx1+full+length+oligonucleotides+orf+variant/pm42086908-276-1-19
    Average 86 stars, based on 1 article reviews
    length codon - by Bioz Stars, 2026-11
    86/100 stars

    Images

    Related Articles

    Variant Assay:

    Article Title: Deep Mutational Scanning of FDX1 Identifies Key Structural Determinants of Lipoylation and Cuproptosis.
    Article Snippet: .. A library of FDX1 full-length ORF variant oligonucleotides was synthesized at Twist BioScience. ..

    Article Title: Deep Mutational Scanning of FDX1 Identifies Key Structural Determinants of Lipoylation and Cuproptosis
    Article Snippet: .. A library of FDX1 full-length ORF variant oligonucleotides was synthesized at Twist BioScience. ..

    Synthesized:

    Article Title: Deep Mutational Scanning of FDX1 Identifies Key Structural Determinants of Lipoylation and Cuproptosis.
    Article Snippet: .. A library of FDX1 full-length ORF variant oligonucleotides was synthesized at Twist BioScience. ..

    Article Title: A brain reward circuit inhibited by next-generation weight-loss drugs in mice.
    Article Snippet: The primers used were: 5′–3′ F (AAA GCTAGCGCCACCATGAAGACGATCATCGCCCTGAGC) and 5′–3′ R (TTTGGCGCGCCCTAA-GAGCAGGACGCCTGACAAGT), ligating the product into pAAV-hSyn-DIO-EGFP (plasmid from Addgene, 50457, RRID: Addgene_50457) in place of the EGFP in NheI and AscI sites to produce the human GLP1R virus construct (AAV-hSyn-DIO-hGLP1R). .. The full-length mouse Glp1r WT gene was synthesized by Twist Biosciences, generating an NheI and an AscI fragment. ..

    Article Title: Deep Mutational Scanning of FDX1 Identifies Key Structural Determinants of Lipoylation and Cuproptosis
    Article Snippet: .. A library of FDX1 full-length ORF variant oligonucleotides was synthesized at Twist BioScience. ..

    Article Title: Posttranslational modifications remodel proteome-wide ligandability.
    Article Snippet: .. The full-length codon-optimized human NPC2 (including wild-type, N58A or N135A mutation) and human GABARAPL2 (wild-type and S87/88A) were synthesized (Twist Bioscience) and cloned into a pTWIST-CMV-puro vector individually. .. The full-length codon-optimized human TNFRSF10B−Flag was synthesized (GenScript) and cloned into a pcDNA3.1 vector individually. pBabe−HA− KRAS (75282), pRK5−p14−Flag (42330) and pRK5F−TACE (31713) were obtained from Addgene.

    Article Title: Recombinant influenza A H5N1 viruses expressing fluorescent and luminescent reporter proteins
    Article Snippet: Bovine uterine epithelial cells (Cal-1, developed in house at the Virology Laboratory at AHDC) were cultured in minimal essential medium (MEM, Corning Inc., Corning, NY) supplemented with 10% fetal bovine serum (FBS) and 1X Antibiotic-Antimycotic. .. Briefly, full-length genome sequences of the HA, NA, M, NP, PA, PB1, and PB2 gene segments of the TX2/24 strain (H5N1 clade 2.3.4.4b, genotype B3.13; GISAID accession number EPI_ISL_19155861) were commercially synthesized (Twist Bioscience) and cloned into the dual-promoter influenza reverse genetics plasmid pHW2000 (kindly provided by Dr. Richard Webby, St. Jude Children’s Research Hospital) using BsmBI restriction sites (New England Biolabs). .. Briefly, full-length genome sequences of the HA, NA, M, NP, PA, PB1, and PB2 gene segments of the TX2/24 strain (H5N1 clade 2.3.4.4b, genotype B3.13; GISAID accession number EPI_ISL_19155861) were commercially synthesized (Twist Bioscience) and cloned into the dual-promoter influenza reverse genetics plasmid pHW2000 (kindly provided by Dr. Richard Webby, St. Jude Children’s Research Hospital) using BsmBI restriction sites (New England Biolabs).

    Article Title: Nir1-Nir2 Heterodimerization Confers Robustness to the Phosphoinositide Cycle
    Article Snippet: .. The full-length DDHD2 (accession code: NP_001157704.1) was codon optimized for expression in E. coli (Twist Biosciences) and gene synthesized in the pET28a plasmid. .. Point mutagenesis to generate the inactive mutant DDHD2-S315A plasmid used the Q5 Site-Directed Mutagenesis Kit described above.

    Mutagenesis:

    Article Title: Posttranslational modifications remodel proteome-wide ligandability.
    Article Snippet: .. The full-length codon-optimized human NPC2 (including wild-type, N58A or N135A mutation) and human GABARAPL2 (wild-type and S87/88A) were synthesized (Twist Bioscience) and cloned into a pTWIST-CMV-puro vector individually. .. The full-length codon-optimized human TNFRSF10B−Flag was synthesized (GenScript) and cloned into a pcDNA3.1 vector individually. pBabe−HA− KRAS (75282), pRK5−p14−Flag (42330) and pRK5F−TACE (31713) were obtained from Addgene.

    Clone Assay:

    Article Title: Posttranslational modifications remodel proteome-wide ligandability.
    Article Snippet: .. The full-length codon-optimized human NPC2 (including wild-type, N58A or N135A mutation) and human GABARAPL2 (wild-type and S87/88A) were synthesized (Twist Bioscience) and cloned into a pTWIST-CMV-puro vector individually. .. The full-length codon-optimized human TNFRSF10B−Flag was synthesized (GenScript) and cloned into a pcDNA3.1 vector individually. pBabe−HA− KRAS (75282), pRK5−p14−Flag (42330) and pRK5F−TACE (31713) were obtained from Addgene.

    Article Title: Recombinant influenza A H5N1 viruses expressing fluorescent and luminescent reporter proteins
    Article Snippet: Bovine uterine epithelial cells (Cal-1, developed in house at the Virology Laboratory at AHDC) were cultured in minimal essential medium (MEM, Corning Inc., Corning, NY) supplemented with 10% fetal bovine serum (FBS) and 1X Antibiotic-Antimycotic. .. Briefly, full-length genome sequences of the HA, NA, M, NP, PA, PB1, and PB2 gene segments of the TX2/24 strain (H5N1 clade 2.3.4.4b, genotype B3.13; GISAID accession number EPI_ISL_19155861) were commercially synthesized (Twist Bioscience) and cloned into the dual-promoter influenza reverse genetics plasmid pHW2000 (kindly provided by Dr. Richard Webby, St. Jude Children’s Research Hospital) using BsmBI restriction sites (New England Biolabs). .. Briefly, full-length genome sequences of the HA, NA, M, NP, PA, PB1, and PB2 gene segments of the TX2/24 strain (H5N1 clade 2.3.4.4b, genotype B3.13; GISAID accession number EPI_ISL_19155861) were commercially synthesized (Twist Bioscience) and cloned into the dual-promoter influenza reverse genetics plasmid pHW2000 (kindly provided by Dr. Richard Webby, St. Jude Children’s Research Hospital) using BsmBI restriction sites (New England Biolabs).

    Plasmid Preparation:

    Article Title: Recombinant influenza A H5N1 viruses expressing fluorescent and luminescent reporter proteins
    Article Snippet: Bovine uterine epithelial cells (Cal-1, developed in house at the Virology Laboratory at AHDC) were cultured in minimal essential medium (MEM, Corning Inc., Corning, NY) supplemented with 10% fetal bovine serum (FBS) and 1X Antibiotic-Antimycotic. .. Briefly, full-length genome sequences of the HA, NA, M, NP, PA, PB1, and PB2 gene segments of the TX2/24 strain (H5N1 clade 2.3.4.4b, genotype B3.13; GISAID accession number EPI_ISL_19155861) were commercially synthesized (Twist Bioscience) and cloned into the dual-promoter influenza reverse genetics plasmid pHW2000 (kindly provided by Dr. Richard Webby, St. Jude Children’s Research Hospital) using BsmBI restriction sites (New England Biolabs). .. Briefly, full-length genome sequences of the HA, NA, M, NP, PA, PB1, and PB2 gene segments of the TX2/24 strain (H5N1 clade 2.3.4.4b, genotype B3.13; GISAID accession number EPI_ISL_19155861) were commercially synthesized (Twist Bioscience) and cloned into the dual-promoter influenza reverse genetics plasmid pHW2000 (kindly provided by Dr. Richard Webby, St. Jude Children’s Research Hospital) using BsmBI restriction sites (New England Biolabs).

    Article Title: Molecular determinants of cotranslational chaperone recruitment to nascent p53
    Article Snippet: .. The vectors were amplified using DH5α bacterial strain in LB medium supplemented with 100 μg ml −1 ampicillin. p53 was subcloned from WT R72 p53 pCB6+ plasmid (Addgene) using Gibson Assembly Master Mix (NEB), while other full-length proteins were synthesised by Twist Bioscience. .. RNC truncations and mutations were produced by PCR using Q5 Site-Directed Mutagenesis Kit (NEB) or Phusion High-Fidelity PCR Kit (NEB).

    Article Title: Nir1-Nir2 Heterodimerization Confers Robustness to the Phosphoinositide Cycle
    Article Snippet: .. The full-length DDHD2 (accession code: NP_001157704.1) was codon optimized for expression in E. coli (Twist Biosciences) and gene synthesized in the pET28a plasmid. .. Point mutagenesis to generate the inactive mutant DDHD2-S315A plasmid used the Q5 Site-Directed Mutagenesis Kit described above.

    Amplification:

    Article Title: Molecular determinants of cotranslational chaperone recruitment to nascent p53
    Article Snippet: .. The vectors were amplified using DH5α bacterial strain in LB medium supplemented with 100 μg ml −1 ampicillin. p53 was subcloned from WT R72 p53 pCB6+ plasmid (Addgene) using Gibson Assembly Master Mix (NEB), while other full-length proteins were synthesised by Twist Bioscience. .. RNC truncations and mutations were produced by PCR using Q5 Site-Directed Mutagenesis Kit (NEB) or Phusion High-Fidelity PCR Kit (NEB).

    Derivative Assay:

    Article Title: Evolution of Translation Initiation Factor 2 Extensions Links Initiation to Bacterial Stress Response
    Article Snippet: .. For IF2 derived from G. stearothermophilus , the full-length sequence was ordered from Twist Bioscience. ..

    Sequencing:

    Article Title: Evolution of Translation Initiation Factor 2 Extensions Links Initiation to Bacterial Stress Response
    Article Snippet: .. For IF2 derived from G. stearothermophilus , the full-length sequence was ordered from Twist Bioscience. ..

    Expressing:

    Article Title: Nir1-Nir2 Heterodimerization Confers Robustness to the Phosphoinositide Cycle
    Article Snippet: .. The full-length DDHD2 (accession code: NP_001157704.1) was codon optimized for expression in E. coli (Twist Biosciences) and gene synthesized in the pET28a plasmid. .. Point mutagenesis to generate the inactive mutant DDHD2-S315A plasmid used the Q5 Site-Directed Mutagenesis Kit described above.



    Similar Products

    length codon  (Twist Bioscience)
    86
    Twist Bioscience length codon
    Length Codon, supplied by Twist Bioscience, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/length+codon/fdx1+full+length+oligonucleotides+orf+variant/pm42086908-276-1-19
    Average 86 stars, based on 1 article reviews
    length codon - by Bioz Stars, 2026-11
    86/100 stars
    		  Buy from Supplier
    codon optimized full length erbb2 cdnas  (Twist Bioscience)
    95
    Twist Bioscience codon optimized full length erbb2 cdnas
    Codon Optimized Full Length Erbb2 Cdnas, supplied by Twist Bioscience, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/length+codon/HER2/pm41448537-175-6-29
    Average 95 stars, based on 1 article reviews
    codon optimized full length erbb2 cdnas - by Bioz Stars, 2026-11
    95/100 stars
    		  Buy from Supplier
    codon-optimized gene containing full-length human snx27  (GenScript corporation)
    90
    GenScript corporation codon-optimized gene containing full-length human snx27
    Codon Optimized Gene Containing Full Length Human Snx27, supplied by GenScript corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/length+codon/codon+optimized+gene+containing+full+length+human+snx27/pmc11331091__pnas__2405041121__sapp-12-3-12
    Average 90 stars, based on 1 article reviews
    codon-optimized gene containing full-length human snx27 - by Bioz Stars, 2026-11
    90/100 stars
    		  Buy from Supplier
    mare a codon-optimized gene encoding the full-length mare protein (amino acids 1 – 284)  (GenScript corporation)
    90
    GenScript corporation mare a codon-optimized gene encoding the full-length mare protein (amino acids 1 – 284)
    Mare A Codon Optimized Gene Encoding The Full Length Mare Protein (Amino Acids 1 – 284), supplied by GenScript corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/length+codon/mare+a+codon+optimized+gene+encoding+the+full+length+mare+protein++amino+acids+1+++284+/pm40555689-155-11-31
    Average 90 stars, based on 1 article reviews
    mare a codon-optimized gene encoding the full-length mare protein (amino acids 1 – 284) - by Bioz Stars, 2026-11
    90/100 stars
    		  Buy from Supplier
    synthetic escherichia coli codon-optimized gene of the full-length protein l3p mutant  (GenScript corporation)
    90
    GenScript corporation synthetic escherichia coli codon-optimized gene of the full-length protein l3p mutant
    Synthetic Escherichia Coli Codon Optimized Gene Of The Full Length Protein L3p Mutant, supplied by GenScript corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/length+codon/synthetic+escherichia+coli+codon+optimized+gene+of+the+full+length+protein+l3p+mutant/pm40503686-95-27-33
    Average 90 stars, based on 1 article reviews
    synthetic escherichia coli codon-optimized gene of the full-length protein l3p mutant - by Bioz Stars, 2026-11
    90/100 stars
    		  Buy from Supplier
    discrete reverse primers incorporating tails comprising different lengths of trimer- defined (trim) codons  (Ella Biotech GmbH)
    90
    Ella Biotech GmbH discrete reverse primers incorporating tails comprising different lengths of trimer- defined (trim) codons
    Discrete Reverse Primers Incorporating Tails Comprising Different Lengths Of Trimer Defined (Trim) Codons, supplied by Ella Biotech GmbH, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/length+codon/discrete+reverse+primers+incorporating+tails+comprising+different+lengths+of+trimer++defined++trim++codons/pm40498839-255-18-22
    Average 90 stars, based on 1 article reviews
    discrete reverse primers incorporating tails comprising different lengths of trimer- defined (trim) codons - by Bioz Stars, 2026-11
    90/100 stars
    		  Buy from Supplier
    codon-optimized gene encoding the full-length e2 ectodomain from hcv strain 1b09  (GenScript corporation)
    90
    GenScript corporation codon-optimized gene encoding the full-length e2 ectodomain from hcv strain 1b09
    Codon Optimized Gene Encoding The Full Length E2 Ectodomain From Hcv Strain 1b09, supplied by GenScript corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/length+codon/codon+optimized+gene+encoding+the+full+length+e2+ectodomain+from+hcv+strain+1b09/pm40442315-298-9-17
    Average 90 stars, based on 1 article reviews
    codon-optimized gene encoding the full-length e2 ectodomain from hcv strain 1b09 - by Bioz Stars, 2026-11
    90/100 stars
    		  Buy from Supplier
    plasmids encoding full-length codon-optimized gp160 of indian origin  (GenScript corporation)
    90
    GenScript corporation plasmids encoding full-length codon-optimized gp160 of indian origin
    Plasmids Encoding Full Length Codon Optimized Gp160 Of Indian Origin, supplied by GenScript corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/length+codon/full+length++native+gp160+sequences/pm40377318-459-0-10
    Average 90 stars, based on 1 article reviews
    plasmids encoding full-length codon-optimized gp160 of indian origin - by Bioz Stars, 2026-11
    90/100 stars
    		  Buy from Supplier
    codon-optimized full-length human na v 1.5 (hna v 1.5) cdna  (GenScript corporation)
    90
    GenScript corporation codon-optimized full-length human na v 1.5 (hna v 1.5) cdna
    Codon Optimized Full Length Human Na V 1.5 (Hna V 1.5) Cdna, supplied by GenScript corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/length+codon/codon+optimized+full+length+human+na+v+1+5++hna+v+1+5++cdna/pmc12107192-147-0-12
    Average 90 stars, based on 1 article reviews
    codon-optimized full-length human na v 1.5 (hna v 1.5) cdna - by Bioz Stars, 2026-11
    90/100 stars
    		  Buy from Supplier

    Image Search Results