Review



luria bertani lb agar plates  (Thermo Fisher)


Bioz Verified Symbol Thermo Fisher is a verified supplier
Bioz Manufacturer Symbol Thermo Fisher manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 97
      Buy from Supplier

    Structured Review

    Thermo Fisher luria bertani lb agar plates
    Luria Bertani Lb Agar Plates, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/lb/LB+AGAR/pm40535595-49-5-23
    Average 97 stars, based on 1 article reviews
    luria bertani lb agar plates - by Bioz Stars, 2026-10
    97/100 stars

    Images

    Related Articles

    Centrifugation:

    Article Title: TLR7/8 signaling balances cytokine responses in neonatal monocytes.
    Article Snippet: .. After centrifugation, the pellet was resuspended in LB and applied to LB agar plates (PO5309A, Thermo-Fisher-Scientific, NRW, Germany). ..

    Article Title: TLR7/8 signaling balances cytokine responses in neonatal monocytes
    Article Snippet: .. After centrifugation, the pellet was resuspended in LB and applied to LB agar plates (PO5309A, Thermo-Fisher-Scientific, NRW, Germany). .. After centrifugation, the pellet was resuspended in LB and applied to LB agar plates (PO5309A, Thermo-Fisher-Scientific, NRW, Germany).

    other:

    Article Title: Distinct synaptic mechanisms underlie NRXN1 variant and disorder background-dependent phenotypes in iPSC-derived neurons.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Rabbit anti-VGAT primary antibody Millipore RRID:AB_2301998; Cat # AB5062P Mouse anti VGLUT1 primary Antibody Synaptic Systems RRID:AB_887877; Cat #135302 Goat anti-mouse 647 secondary antibody Thermo Fisher RRID:AB_2535813; Cat # A-21245 Goat anti-Rabbit 546 secondary antibody Thermo Fisher RRID:AB_2534077; Cat # A-11010 Bacterial and virus strains Top10 E. Coli bacteria Thermo Fisher Cat #C404010 pTet-O-Ngn2-puro LV Produced in the Pak Lab N/A pTet-O-Ascl1-puro LV Produced in the Pak Lab N/A pTet-O-Dlx2-hygro LV Produced in the Pak Lab N/A pTet-O-EGFP LV Produced in the Pak Lab N/A pTet-O-TdTomato LV Produced in the Pak Lab N/A FUW-M2rtTA LV Produced in the Pak Lab N/A FLP-GFP LV Produced in the Pak Lab N/A Cre-GFP LV Produced in the Pak Lab N/A Biological samples Goat serum Gibco Cat # 16-210-064 Fetal bovine serum (for neuronal media) Fisher Cat # SH3007003 Fetal bovine serum (for HEK media) Sigma Cat #F0926-500ML Mouse laminin Thermo Fisher Cat # 23017-015 Chemicals, peptides, and recombinant proteins Calcium chloride (CaCl2) Sigma C5670-500G Magnesium chloride (MgCl2) Sigma Cat #M8266-100G Sucrose Sigma Cat #S0839-1KG DPBS Gibco Cat # 14190-250 Matrigel Corning Cat # 356235 TergaZyme Alconox Cat #Z273287 Trypan Blue Thermo Cat # 15250061 Paraformaldehyde (PFA) Electron Microscopy Sciences Cat # 1457141 Dimethyl sulfoxide (DMSO) Sigma Cat #D2650-5X5ML Triton X-100 Sigma Cat #T8787-250ML Buffer RLT Qiagen Cat # 79216 B-mercaptoethanol Sigma Cat #M6250 Sodium chloride Sigma Cat #S9888-5KG Sodium phosphate dibasic Sigma Cat #S7907 HEPES Sigma Cat #H4034-100G LB agar powder Thermo Cat# J75851-A1 Borate buffer Thermo Cat # 28341 Polyethyleneumine (PEI) Sigma/Merck Cat #P3143 K-Gluconate Sigma Cat #G4500-100G Potassium chloride (KCl) Sigma Cat #P3911 ATP-Mg Sigma Cat # A9187-100MG GTP-Na2 Sigma Cat #G8877-25MG Phosphocreatine Sigma Cat #P7936-10MG (Continued on next page) Cell Reports 45, 117115, April 28, 2026 15

    Article Title: Transplantation of Saccharomyces cerevisiae Rmd9p peptide into mammalian mitochondrial IF2 substitutes for the IF1 function in Escherichia coli .
    Article Snippet: For E. coli, cultures were grown in Luria–Bertani (LB) broth or LB agar plates containing 1.8% Bacto agar (Gibco).

    Virus:

    Article Title: Protocol for the genome-wide identification of intrinsic transcription factor binding motifs by mammalian-optimized pull-down sequencing.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Bacterial and virus strains BL21 (DE3) Stratagene Cat#230130 Chemicals, peptides, and recombinant proteins Ampicillin sodium salt Merck Cat#BP785 Amylose resin NEB Cat#E8021L Acryl/Bis 40% solution Thermo Fisher Scientific Cat#HC2040 APS Thermo Fisher Scientific Cat#HC2005 Agarose Thermo Fisher Scientific Cat#16500500 Acetic Acid Glacial Thermo Fisher Scientific Cat#039745.AE Absolute ethyl alcohol Merck Cat#E7023 Boric acid Thermo Fisher Scientific Cat#A16624.0 B DNase I ZYMO RESEARCH Cat#E1010 DTT Merck Cat#646563 EDTA⋅2H 2 O Thermo Fisher Scientific Cat#15576028 IPTG Thermo Fisher Scientific Cat#15529019 Imidazole Merck Cat#I202 LB premix Thermo Fisher Scientific Cat#12780052 LB Agar premix Thermo Fisher Scientific Cat22700041 MgCl 2 ⋅6H 2 O Thermo Fisher Scientific Cat#AM9530G Ni-NTA agarose QIAGEN Cat#30210 Proteinase K NEB Cat#P8107S PBS Merck Cat#P2272 Protease Inhibitor Cocktail Powder Thermo Fisher Scientific Cat#78429 PMSF Merck Cat#93482 (Continued on next page) 2 STAR Protocols 7, 104513, June 19, 2026 MATERIALS AND EQUIPMENT Continued REAGENT or RESOURCE SOURCE IDENTIFIER SPRIselect Beckman Coulter Cat#B23317 SYBR Gold Thermo Fisher Scientific Cat#S11494 SYBR Green I Thermo Fisher Scientific Cat#S7567 TCEP Merck Cat#646547 Ultra Low Range DNA Ladder NEB Cat#N0558S 1Kb DNA Ladder Thermo Fisher Scientific Cat#10787026 100bp DNA Ladder Thermo Fisher Scientific Cat#15628019 100% Glycerol Merck Cat#G7893 1 M Tris-HCl Thermo Fisher Scientific Cat#15567027 5 M NaCl Thermo Fisher Scientific Cat#A57006 Critical commercial assays Qiagen Blood & Cell Culture DNA Maxi Kit QIAGEN Cat#13343 QIAquick PCR & Gel Cleanup Kit QIAGEN Cat#28506 NEBNext Ultra II DNA Library Prep with Sample Purification Beads NEB Cat#E7103S NEBNext Multiplex Oligos for Illumina NEB Cat#E7600S Experimental models: Cell lines EL4 ATCC TIB-39 Oligonucleotides IR-FKHM-F: ATGGCGCTTGAACTTCTGTTTACTA CAGTAAACAGTCGGCTGGGAGAACA IDTDNA https://www.idtdna.com ..

    Recombinant:

    Article Title: Protocol for the genome-wide identification of intrinsic transcription factor binding motifs by mammalian-optimized pull-down sequencing.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Bacterial and virus strains BL21 (DE3) Stratagene Cat#230130 Chemicals, peptides, and recombinant proteins Ampicillin sodium salt Merck Cat#BP785 Amylose resin NEB Cat#E8021L Acryl/Bis 40% solution Thermo Fisher Scientific Cat#HC2040 APS Thermo Fisher Scientific Cat#HC2005 Agarose Thermo Fisher Scientific Cat#16500500 Acetic Acid Glacial Thermo Fisher Scientific Cat#039745.AE Absolute ethyl alcohol Merck Cat#E7023 Boric acid Thermo Fisher Scientific Cat#A16624.0 B DNase I ZYMO RESEARCH Cat#E1010 DTT Merck Cat#646563 EDTA⋅2H 2 O Thermo Fisher Scientific Cat#15576028 IPTG Thermo Fisher Scientific Cat#15529019 Imidazole Merck Cat#I202 LB premix Thermo Fisher Scientific Cat#12780052 LB Agar premix Thermo Fisher Scientific Cat22700041 MgCl 2 ⋅6H 2 O Thermo Fisher Scientific Cat#AM9530G Ni-NTA agarose QIAGEN Cat#30210 Proteinase K NEB Cat#P8107S PBS Merck Cat#P2272 Protease Inhibitor Cocktail Powder Thermo Fisher Scientific Cat#78429 PMSF Merck Cat#93482 (Continued on next page) 2 STAR Protocols 7, 104513, June 19, 2026 MATERIALS AND EQUIPMENT Continued REAGENT or RESOURCE SOURCE IDENTIFIER SPRIselect Beckman Coulter Cat#B23317 SYBR Gold Thermo Fisher Scientific Cat#S11494 SYBR Green I Thermo Fisher Scientific Cat#S7567 TCEP Merck Cat#646547 Ultra Low Range DNA Ladder NEB Cat#N0558S 1Kb DNA Ladder Thermo Fisher Scientific Cat#10787026 100bp DNA Ladder Thermo Fisher Scientific Cat#15628019 100% Glycerol Merck Cat#G7893 1 M Tris-HCl Thermo Fisher Scientific Cat#15567027 5 M NaCl Thermo Fisher Scientific Cat#A57006 Critical commercial assays Qiagen Blood & Cell Culture DNA Maxi Kit QIAGEN Cat#13343 QIAquick PCR & Gel Cleanup Kit QIAGEN Cat#28506 NEBNext Ultra II DNA Library Prep with Sample Purification Beads NEB Cat#E7103S NEBNext Multiplex Oligos for Illumina NEB Cat#E7600S Experimental models: Cell lines EL4 ATCC TIB-39 Oligonucleotides IR-FKHM-F: ATGGCGCTTGAACTTCTGTTTACTA CAGTAAACAGTCGGCTGGGAGAACA IDTDNA https://www.idtdna.com ..

    Protease Inhibitor:

    Article Title: Protocol for the genome-wide identification of intrinsic transcription factor binding motifs by mammalian-optimized pull-down sequencing.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Bacterial and virus strains BL21 (DE3) Stratagene Cat#230130 Chemicals, peptides, and recombinant proteins Ampicillin sodium salt Merck Cat#BP785 Amylose resin NEB Cat#E8021L Acryl/Bis 40% solution Thermo Fisher Scientific Cat#HC2040 APS Thermo Fisher Scientific Cat#HC2005 Agarose Thermo Fisher Scientific Cat#16500500 Acetic Acid Glacial Thermo Fisher Scientific Cat#039745.AE Absolute ethyl alcohol Merck Cat#E7023 Boric acid Thermo Fisher Scientific Cat#A16624.0 B DNase I ZYMO RESEARCH Cat#E1010 DTT Merck Cat#646563 EDTA⋅2H 2 O Thermo Fisher Scientific Cat#15576028 IPTG Thermo Fisher Scientific Cat#15529019 Imidazole Merck Cat#I202 LB premix Thermo Fisher Scientific Cat#12780052 LB Agar premix Thermo Fisher Scientific Cat22700041 MgCl 2 ⋅6H 2 O Thermo Fisher Scientific Cat#AM9530G Ni-NTA agarose QIAGEN Cat#30210 Proteinase K NEB Cat#P8107S PBS Merck Cat#P2272 Protease Inhibitor Cocktail Powder Thermo Fisher Scientific Cat#78429 PMSF Merck Cat#93482 (Continued on next page) 2 STAR Protocols 7, 104513, June 19, 2026 MATERIALS AND EQUIPMENT Continued REAGENT or RESOURCE SOURCE IDENTIFIER SPRIselect Beckman Coulter Cat#B23317 SYBR Gold Thermo Fisher Scientific Cat#S11494 SYBR Green I Thermo Fisher Scientific Cat#S7567 TCEP Merck Cat#646547 Ultra Low Range DNA Ladder NEB Cat#N0558S 1Kb DNA Ladder Thermo Fisher Scientific Cat#10787026 100bp DNA Ladder Thermo Fisher Scientific Cat#15628019 100% Glycerol Merck Cat#G7893 1 M Tris-HCl Thermo Fisher Scientific Cat#15567027 5 M NaCl Thermo Fisher Scientific Cat#A57006 Critical commercial assays Qiagen Blood & Cell Culture DNA Maxi Kit QIAGEN Cat#13343 QIAquick PCR & Gel Cleanup Kit QIAGEN Cat#28506 NEBNext Ultra II DNA Library Prep with Sample Purification Beads NEB Cat#E7103S NEBNext Multiplex Oligos for Illumina NEB Cat#E7600S Experimental models: Cell lines EL4 ATCC TIB-39 Oligonucleotides IR-FKHM-F: ATGGCGCTTGAACTTCTGTTTACTA CAGTAAACAGTCGGCTGGGAGAACA IDTDNA https://www.idtdna.com ..

    SYBR Green Assay:

    Article Title: Protocol for the genome-wide identification of intrinsic transcription factor binding motifs by mammalian-optimized pull-down sequencing.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Bacterial and virus strains BL21 (DE3) Stratagene Cat#230130 Chemicals, peptides, and recombinant proteins Ampicillin sodium salt Merck Cat#BP785 Amylose resin NEB Cat#E8021L Acryl/Bis 40% solution Thermo Fisher Scientific Cat#HC2040 APS Thermo Fisher Scientific Cat#HC2005 Agarose Thermo Fisher Scientific Cat#16500500 Acetic Acid Glacial Thermo Fisher Scientific Cat#039745.AE Absolute ethyl alcohol Merck Cat#E7023 Boric acid Thermo Fisher Scientific Cat#A16624.0 B DNase I ZYMO RESEARCH Cat#E1010 DTT Merck Cat#646563 EDTA⋅2H 2 O Thermo Fisher Scientific Cat#15576028 IPTG Thermo Fisher Scientific Cat#15529019 Imidazole Merck Cat#I202 LB premix Thermo Fisher Scientific Cat#12780052 LB Agar premix Thermo Fisher Scientific Cat22700041 MgCl 2 ⋅6H 2 O Thermo Fisher Scientific Cat#AM9530G Ni-NTA agarose QIAGEN Cat#30210 Proteinase K NEB Cat#P8107S PBS Merck Cat#P2272 Protease Inhibitor Cocktail Powder Thermo Fisher Scientific Cat#78429 PMSF Merck Cat#93482 (Continued on next page) 2 STAR Protocols 7, 104513, June 19, 2026 MATERIALS AND EQUIPMENT Continued REAGENT or RESOURCE SOURCE IDENTIFIER SPRIselect Beckman Coulter Cat#B23317 SYBR Gold Thermo Fisher Scientific Cat#S11494 SYBR Green I Thermo Fisher Scientific Cat#S7567 TCEP Merck Cat#646547 Ultra Low Range DNA Ladder NEB Cat#N0558S 1Kb DNA Ladder Thermo Fisher Scientific Cat#10787026 100bp DNA Ladder Thermo Fisher Scientific Cat#15628019 100% Glycerol Merck Cat#G7893 1 M Tris-HCl Thermo Fisher Scientific Cat#15567027 5 M NaCl Thermo Fisher Scientific Cat#A57006 Critical commercial assays Qiagen Blood & Cell Culture DNA Maxi Kit QIAGEN Cat#13343 QIAquick PCR & Gel Cleanup Kit QIAGEN Cat#28506 NEBNext Ultra II DNA Library Prep with Sample Purification Beads NEB Cat#E7103S NEBNext Multiplex Oligos for Illumina NEB Cat#E7600S Experimental models: Cell lines EL4 ATCC TIB-39 Oligonucleotides IR-FKHM-F: ATGGCGCTTGAACTTCTGTTTACTA CAGTAAACAGTCGGCTGGGAGAACA IDTDNA https://www.idtdna.com ..

    Cell Culture:

    Article Title: Protocol for the genome-wide identification of intrinsic transcription factor binding motifs by mammalian-optimized pull-down sequencing.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Bacterial and virus strains BL21 (DE3) Stratagene Cat#230130 Chemicals, peptides, and recombinant proteins Ampicillin sodium salt Merck Cat#BP785 Amylose resin NEB Cat#E8021L Acryl/Bis 40% solution Thermo Fisher Scientific Cat#HC2040 APS Thermo Fisher Scientific Cat#HC2005 Agarose Thermo Fisher Scientific Cat#16500500 Acetic Acid Glacial Thermo Fisher Scientific Cat#039745.AE Absolute ethyl alcohol Merck Cat#E7023 Boric acid Thermo Fisher Scientific Cat#A16624.0 B DNase I ZYMO RESEARCH Cat#E1010 DTT Merck Cat#646563 EDTA⋅2H 2 O Thermo Fisher Scientific Cat#15576028 IPTG Thermo Fisher Scientific Cat#15529019 Imidazole Merck Cat#I202 LB premix Thermo Fisher Scientific Cat#12780052 LB Agar premix Thermo Fisher Scientific Cat22700041 MgCl 2 ⋅6H 2 O Thermo Fisher Scientific Cat#AM9530G Ni-NTA agarose QIAGEN Cat#30210 Proteinase K NEB Cat#P8107S PBS Merck Cat#P2272 Protease Inhibitor Cocktail Powder Thermo Fisher Scientific Cat#78429 PMSF Merck Cat#93482 (Continued on next page) 2 STAR Protocols 7, 104513, June 19, 2026 MATERIALS AND EQUIPMENT Continued REAGENT or RESOURCE SOURCE IDENTIFIER SPRIselect Beckman Coulter Cat#B23317 SYBR Gold Thermo Fisher Scientific Cat#S11494 SYBR Green I Thermo Fisher Scientific Cat#S7567 TCEP Merck Cat#646547 Ultra Low Range DNA Ladder NEB Cat#N0558S 1Kb DNA Ladder Thermo Fisher Scientific Cat#10787026 100bp DNA Ladder Thermo Fisher Scientific Cat#15628019 100% Glycerol Merck Cat#G7893 1 M Tris-HCl Thermo Fisher Scientific Cat#15567027 5 M NaCl Thermo Fisher Scientific Cat#A57006 Critical commercial assays Qiagen Blood & Cell Culture DNA Maxi Kit QIAGEN Cat#13343 QIAquick PCR & Gel Cleanup Kit QIAGEN Cat#28506 NEBNext Ultra II DNA Library Prep with Sample Purification Beads NEB Cat#E7103S NEBNext Multiplex Oligos for Illumina NEB Cat#E7600S Experimental models: Cell lines EL4 ATCC TIB-39 Oligonucleotides IR-FKHM-F: ATGGCGCTTGAACTTCTGTTTACTA CAGTAAACAGTCGGCTGGGAGAACA IDTDNA https://www.idtdna.com ..

    Polymerase Chain Reaction:

    Article Title: Protocol for the genome-wide identification of intrinsic transcription factor binding motifs by mammalian-optimized pull-down sequencing.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Bacterial and virus strains BL21 (DE3) Stratagene Cat#230130 Chemicals, peptides, and recombinant proteins Ampicillin sodium salt Merck Cat#BP785 Amylose resin NEB Cat#E8021L Acryl/Bis 40% solution Thermo Fisher Scientific Cat#HC2040 APS Thermo Fisher Scientific Cat#HC2005 Agarose Thermo Fisher Scientific Cat#16500500 Acetic Acid Glacial Thermo Fisher Scientific Cat#039745.AE Absolute ethyl alcohol Merck Cat#E7023 Boric acid Thermo Fisher Scientific Cat#A16624.0 B DNase I ZYMO RESEARCH Cat#E1010 DTT Merck Cat#646563 EDTA⋅2H 2 O Thermo Fisher Scientific Cat#15576028 IPTG Thermo Fisher Scientific Cat#15529019 Imidazole Merck Cat#I202 LB premix Thermo Fisher Scientific Cat#12780052 LB Agar premix Thermo Fisher Scientific Cat22700041 MgCl 2 ⋅6H 2 O Thermo Fisher Scientific Cat#AM9530G Ni-NTA agarose QIAGEN Cat#30210 Proteinase K NEB Cat#P8107S PBS Merck Cat#P2272 Protease Inhibitor Cocktail Powder Thermo Fisher Scientific Cat#78429 PMSF Merck Cat#93482 (Continued on next page) 2 STAR Protocols 7, 104513, June 19, 2026 MATERIALS AND EQUIPMENT Continued REAGENT or RESOURCE SOURCE IDENTIFIER SPRIselect Beckman Coulter Cat#B23317 SYBR Gold Thermo Fisher Scientific Cat#S11494 SYBR Green I Thermo Fisher Scientific Cat#S7567 TCEP Merck Cat#646547 Ultra Low Range DNA Ladder NEB Cat#N0558S 1Kb DNA Ladder Thermo Fisher Scientific Cat#10787026 100bp DNA Ladder Thermo Fisher Scientific Cat#15628019 100% Glycerol Merck Cat#G7893 1 M Tris-HCl Thermo Fisher Scientific Cat#15567027 5 M NaCl Thermo Fisher Scientific Cat#A57006 Critical commercial assays Qiagen Blood & Cell Culture DNA Maxi Kit QIAGEN Cat#13343 QIAquick PCR & Gel Cleanup Kit QIAGEN Cat#28506 NEBNext Ultra II DNA Library Prep with Sample Purification Beads NEB Cat#E7103S NEBNext Multiplex Oligos for Illumina NEB Cat#E7600S Experimental models: Cell lines EL4 ATCC TIB-39 Oligonucleotides IR-FKHM-F: ATGGCGCTTGAACTTCTGTTTACTA CAGTAAACAGTCGGCTGGGAGAACA IDTDNA https://www.idtdna.com ..

    Sample Purification:

    Article Title: Protocol for the genome-wide identification of intrinsic transcription factor binding motifs by mammalian-optimized pull-down sequencing.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Bacterial and virus strains BL21 (DE3) Stratagene Cat#230130 Chemicals, peptides, and recombinant proteins Ampicillin sodium salt Merck Cat#BP785 Amylose resin NEB Cat#E8021L Acryl/Bis 40% solution Thermo Fisher Scientific Cat#HC2040 APS Thermo Fisher Scientific Cat#HC2005 Agarose Thermo Fisher Scientific Cat#16500500 Acetic Acid Glacial Thermo Fisher Scientific Cat#039745.AE Absolute ethyl alcohol Merck Cat#E7023 Boric acid Thermo Fisher Scientific Cat#A16624.0 B DNase I ZYMO RESEARCH Cat#E1010 DTT Merck Cat#646563 EDTA⋅2H 2 O Thermo Fisher Scientific Cat#15576028 IPTG Thermo Fisher Scientific Cat#15529019 Imidazole Merck Cat#I202 LB premix Thermo Fisher Scientific Cat#12780052 LB Agar premix Thermo Fisher Scientific Cat22700041 MgCl 2 ⋅6H 2 O Thermo Fisher Scientific Cat#AM9530G Ni-NTA agarose QIAGEN Cat#30210 Proteinase K NEB Cat#P8107S PBS Merck Cat#P2272 Protease Inhibitor Cocktail Powder Thermo Fisher Scientific Cat#78429 PMSF Merck Cat#93482 (Continued on next page) 2 STAR Protocols 7, 104513, June 19, 2026 MATERIALS AND EQUIPMENT Continued REAGENT or RESOURCE SOURCE IDENTIFIER SPRIselect Beckman Coulter Cat#B23317 SYBR Gold Thermo Fisher Scientific Cat#S11494 SYBR Green I Thermo Fisher Scientific Cat#S7567 TCEP Merck Cat#646547 Ultra Low Range DNA Ladder NEB Cat#N0558S 1Kb DNA Ladder Thermo Fisher Scientific Cat#10787026 100bp DNA Ladder Thermo Fisher Scientific Cat#15628019 100% Glycerol Merck Cat#G7893 1 M Tris-HCl Thermo Fisher Scientific Cat#15567027 5 M NaCl Thermo Fisher Scientific Cat#A57006 Critical commercial assays Qiagen Blood & Cell Culture DNA Maxi Kit QIAGEN Cat#13343 QIAquick PCR & Gel Cleanup Kit QIAGEN Cat#28506 NEBNext Ultra II DNA Library Prep with Sample Purification Beads NEB Cat#E7103S NEBNext Multiplex Oligos for Illumina NEB Cat#E7600S Experimental models: Cell lines EL4 ATCC TIB-39 Oligonucleotides IR-FKHM-F: ATGGCGCTTGAACTTCTGTTTACTA CAGTAAACAGTCGGCTGGGAGAACA IDTDNA https://www.idtdna.com ..

    Multiplex Assay:

    Article Title: Protocol for the genome-wide identification of intrinsic transcription factor binding motifs by mammalian-optimized pull-down sequencing.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Bacterial and virus strains BL21 (DE3) Stratagene Cat#230130 Chemicals, peptides, and recombinant proteins Ampicillin sodium salt Merck Cat#BP785 Amylose resin NEB Cat#E8021L Acryl/Bis 40% solution Thermo Fisher Scientific Cat#HC2040 APS Thermo Fisher Scientific Cat#HC2005 Agarose Thermo Fisher Scientific Cat#16500500 Acetic Acid Glacial Thermo Fisher Scientific Cat#039745.AE Absolute ethyl alcohol Merck Cat#E7023 Boric acid Thermo Fisher Scientific Cat#A16624.0 B DNase I ZYMO RESEARCH Cat#E1010 DTT Merck Cat#646563 EDTA⋅2H 2 O Thermo Fisher Scientific Cat#15576028 IPTG Thermo Fisher Scientific Cat#15529019 Imidazole Merck Cat#I202 LB premix Thermo Fisher Scientific Cat#12780052 LB Agar premix Thermo Fisher Scientific Cat22700041 MgCl 2 ⋅6H 2 O Thermo Fisher Scientific Cat#AM9530G Ni-NTA agarose QIAGEN Cat#30210 Proteinase K NEB Cat#P8107S PBS Merck Cat#P2272 Protease Inhibitor Cocktail Powder Thermo Fisher Scientific Cat#78429 PMSF Merck Cat#93482 (Continued on next page) 2 STAR Protocols 7, 104513, June 19, 2026 MATERIALS AND EQUIPMENT Continued REAGENT or RESOURCE SOURCE IDENTIFIER SPRIselect Beckman Coulter Cat#B23317 SYBR Gold Thermo Fisher Scientific Cat#S11494 SYBR Green I Thermo Fisher Scientific Cat#S7567 TCEP Merck Cat#646547 Ultra Low Range DNA Ladder NEB Cat#N0558S 1Kb DNA Ladder Thermo Fisher Scientific Cat#10787026 100bp DNA Ladder Thermo Fisher Scientific Cat#15628019 100% Glycerol Merck Cat#G7893 1 M Tris-HCl Thermo Fisher Scientific Cat#15567027 5 M NaCl Thermo Fisher Scientific Cat#A57006 Critical commercial assays Qiagen Blood & Cell Culture DNA Maxi Kit QIAGEN Cat#13343 QIAquick PCR & Gel Cleanup Kit QIAGEN Cat#28506 NEBNext Ultra II DNA Library Prep with Sample Purification Beads NEB Cat#E7103S NEBNext Multiplex Oligos for Illumina NEB Cat#E7600S Experimental models: Cell lines EL4 ATCC TIB-39 Oligonucleotides IR-FKHM-F: ATGGCGCTTGAACTTCTGTTTACTA CAGTAAACAGTCGGCTGGGAGAACA IDTDNA https://www.idtdna.com ..

    Transformation Assay:

    Article Title: Construction and characterization of the first Arcobacter butzleri - Escherichia coli shuttle vector
    Article Snippet: All reagents were obtained from Sigma-Aldrich, St. Louis, USA, unless otherwise specified. .. Plasmids were introduced into competent E. coli DH5α cells by heat-shock transformation, and transformants were selected on LB agar supplemented with ampicillin, 80 μg/mL X-Gal (CAS: 7240-90-6; ThermoScientific, Vilnius, Lithuania), and 0.2 mM IPTG (CAS: 367-93-1; ThermoScientific, Vilnius, Lithuania). ..

    Article Title: Construction and characterization of the first Arcobacter butzleri - Escherichia coli shuttle vector.
    Article Snippet: All reagents were obtained from SigmaAldrich, St. Louis, USA, unless otherwise specified. .. Plasmids were introduced into competent E. coli DH5α cells by heat-shock transformation, and transformants were selected on LB agar supplemented with ampicillin, 80 μg/ mL X-Gal (CAS: 7240-90-6; ThermoScientific, Vilnius, Lithuania), and 0.2 mM IPTG (CAS: 367-93-1; ThermoScientific, Vilnius, Lithuania). ..



    Similar Products

    luria bertani lb broth  (Valiant Co Ltd)
    95
    Valiant Co Ltd luria bertani lb broth
    Luria Bertani Lb Broth, supplied by Valiant Co Ltd, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/lb/LB+broth/med_rxiv__64898__2026__09__23__26363803-46-18-21
    Average 95 stars, based on 1 article reviews
    luria bertani lb broth - by Bioz Stars, 2026-10
    95/100 stars
    		  Buy from Supplier
    recombinant human il-1 beta/il-1f2 protein  (Bio-Techne corporation)
    97
    Bio-Techne corporation recombinant human il-1 beta/il-1f2 protein
    Recombinant Human Il 1 Beta/Il 1f2 Protein, supplied by Bio-Techne corporation, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/lb/Recombinant+Human+IL-1+beta%2FIL-1F2+Protein/custom%40201-lb%4042721887
    Average 97 stars, based on 1 article reviews
    recombinant human il-1 beta/il-1f2 protein - by Bioz Stars, 2026-10
    97/100 stars
    		  Buy from Supplier
    pump, aladdin, high pressure, 200 lbs  (World Precision Instruments)
    93
    World Precision Instruments pump, aladdin, high pressure, 200 lbs
    Pump, Aladdin, High Pressure, 200 Lbs, supplied by World Precision Instruments, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/lb/Pump%2C+Aladdin%2C+High+Pressure%2C+200+Lbs/custom%40al-1000hp2%4010%2E1016%2Fj%2Esaa%2E2026%2E128776
    Average 93 stars, based on 1 article reviews
    pump, aladdin, high pressure, 200 lbs - by Bioz Stars, 2026-10
    93/100 stars
    		  Buy from Supplier
    lb agar plates  (Thermo Fisher)
    94
    Thermo Fisher lb agar plates
    Lb Agar Plates, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/lb/Kanamycin+monosulfate/pm42176792-240-31-39
    Average 94 stars, based on 1 article reviews
    lb agar plates - by Bioz Stars, 2026-10
    94/100 stars
    		  Buy from Supplier
    fresh lb broth  (Neogen)
    86
    Neogen fresh lb broth
    Fresh Lb Broth, supplied by Neogen, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/lb/bertani+broth+luria/pmc13199987-95-32-35
    Average 86 stars, based on 1 article reviews
    fresh lb broth - by Bioz Stars, 2026-10
    86/100 stars
    		  Buy from Supplier

    Image Search Results