Review



pcr amplification kit phusion high fidelity pcr master mix  (New England Biolabs)


Bioz Verified Symbol New England Biolabs is a verified supplier
Bioz Manufacturer Symbol New England Biolabs manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99

    Structured Review

    New England Biolabs pcr amplification kit phusion high fidelity pcr master mix
    Pcr Amplification Kit Phusion High Fidelity Pcr Master Mix, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 6324 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/kit+formulation+buffer/Phusion+High-Fidelity+PCR+Master+Mix+with+HF+Buffer/us12252687-78-7-20
    Average 99 stars, based on 6324 article reviews
    pcr amplification kit phusion high fidelity pcr master mix - by Bioz Stars, 2026-09
    99/100 stars

    Images

    Related Articles

    Polymerase Chain Reaction:

    Article Title: Incorporation of genome-bound cellular proteins into HIV-1 particles regulates viral infection
    Article Snippet: .. Pre-amplification was performed using 2X Phusion HF PCR Master mix (New England Biolabs, #M0531L) with P5Solexa_s and P3Solexa_s primers for six cycles, followed by ProNex (Promega, #NG2001) size-selective purification. .. Optimal qPCR cycles were determined on a CFX96 Touch Real-Time PCR Detection System (Bio-Rad) using EvaGreen (Biotium, #31000), 2X Phusion HF PCR Master mix and P5/P3 Solexa primers.

    Article Title: Incorporation of genome-bound cellular proteins into HIV-1 particles regulates viral infection.
    Article Snippet: .. Pre-amplification was performed using 2X Phusion HF PCR Master mix (New England Biolabs, #M0531L) with P5Solexa_s and P3Solexa_s primers for six cycles, followed by ProNex (Promega, #NG2001) size-selective purification. .. Optimal qPCR cycles were determined on a CFX96 Touch RealTime PCR Detection System (Bio-Rad) using EvaGreen (Biotium, #31000), 2X Phusion HF PCR Master mix and P5/P3 Solexa primers.

    Article Title: Systematic discovery of pro- and anti-HIV host factors in primary human CD4+ T cells.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Phusion High-Fidelity PCR Master Mix with HF Buffer New England Biolabs Cat# M0531L Qubit 1X dsDNA HS Assay Kit Fisher Scientific Cat# Q33231 Plasmid Plus Giga Kit Qiagen Cat# 12991 NEB Golden Gate Assembly Kit (BsmBI-v2) New England Biolabs Cat# E1602L DNA Clean and Concentrator-25 Kit Zymo Research Cat# D4065 Zymoclean Gel DNA Recovery kit Zymo Research Cat# D4008 HIV1 p24 ELISA Kit Abcam Cat# ab218268 QIAamp Blood Mini Kit Qiagen Cat# 51104 Deposited data Genome-wide HIV screens and secondary screen datasets This paper GEO: GSE318876 PI16 proteomics dataset This paper PRIDE: PXD071892 Cytokine genome-wide screen datasets Schmidt et al.18 GEO: GSE174292, GSE190604, and GSE190846 Bulk RNA-seq DICE dataset DICE database https://dice-database.org/ Bulk RNA-seq GTEx dataset GTEx Consortium https://gtexportal.org Tabula Sapiens scRNA-seq dataset Tabula Sapiens Consortium et al.50 https://tabula-sapiens-portal.ds. czbiohub.org/ CORUM dataset CORUM https://mips.helmholtz-muenchen. de/corum/; RRID:SCR_002254 STRING dataset STRING Consortium https://string-db.org/; RRID:SCR_005223 HumanNet dataset HumanNet https://www.inetbio.org/humannet/; RRID:SCR_016146 Experimental models: Cell lines Lenti-X HEK293T cells Takara Bio Cat# 632180; RRID:CVCL_0063 human embryonic kidney 293T cells American Type Culture Collection ATCC CRL-3216; RRID:CVCL_0063 Jurkat cells NIH AIDS Reagent Program ARP-177; RRID:CVCL_0367 CEMx174 cells NIH AIDS Reagent Program, Division of AIDS, NIAID ARP-272; RRID:CVCL_2200 HeLa cells American Type Culture Collection ATCC CCL-2; RRID:CVCL_0030 Oligonucleotides See Table S1E for sgRNA sequences (used for CRISPRa and CRISPRn arrayed validations) and qPCR primers/probes (2-LTR circle nuclear import assay). .. This paper N/A single-stranded donor oligonucleotide (ssODN; TTAGCTCTG TTTACGTCCCAGCGGGCATGAGAGTAACAAGAGGGTGTG GTAATATTACGGTACCGAGCACTATCGATACAATATGTGT CATACGGACACG) IDT N/A Recombinant DNA lentiCas9-Blast Addgene RRID:Addgene_52962 pZR112 Addgene RRID:Addgene_180263 Genome-wide CRISPRn library (Brunello) Addgene RRID:Addgene_73178 Genome-wide CRISPRa library (Calabrese A) Addgene RRID:Addgene_92379 Genome-wide CRISPRa library (Calabrese B) Addgene RRID:Addgene_92380 lentiGuide-Puro Addgene RRID:Addgene_52963 pXPR_502 Addgene RRID:Addgene_96923 pAdVAntage Promega Corporation RRID:Addgene_E1711 pCMV4-BlaM-Vpr Addgene RRID:Addgene_21950 pMD2.G Addgene RRID:Addgene_12259 (Continued on next page) ll OPEN ACCESS Cell 189, 1–18.e1–e13, June 11, 2026 e3 Please cite this article in press as: Rathore et al., Systematic discovery of pro- and anti-HIV host factors in primary human CD4+ T cells, Cell (2026), https://doi.org/10.1016/j.cell.2026.03.046 Article

    Article Title: In Vivo Massively Parallel Reporter Assay Reveals Sequence Determinants of mRNA Localization in Astrocytes
    Article Snippet: .. Sparc Δ661-890 was cloned using PCR stitching (primers in Table 5) with Phusion High-Fidelity PCR Master Mix (NEB, M0531). .. To clone constructs into the reporter plasmid, the plasmid and validation constructs were separately digested with KpnI-HF (NEB, R3142L), NheI-HF (NEB, R3131) in rCutsmart buffer (NEB, B6004) and gel purified with NucleoSpin Gel & PCR Clean-up Mini Kit (Macherey-Nagal, 740609.50).

    Article Title: Ligase-dependent and independent functions of the C-terminus of Mms21 contribute to optimal growth and genome stability in <i>Saccharomyces cerevisiae</i>
    Article Snippet: An evolutionarily conserved E3 SUMO ligase, Mms21, orchestrates genome integrity processes.. Our study examined a mutant of Saccharomyces cerevisiae Mms21, analogous to a mutant identified in a rare human condition characterized by genome instability.. The human mutation Cterminally truncated the Mms21 protein, without affecting the residues in the E3 ligase domain.

    Purification:

    Article Title: Incorporation of genome-bound cellular proteins into HIV-1 particles regulates viral infection
    Article Snippet: .. Pre-amplification was performed using 2X Phusion HF PCR Master mix (New England Biolabs, #M0531L) with P5Solexa_s and P3Solexa_s primers for six cycles, followed by ProNex (Promega, #NG2001) size-selective purification. .. Optimal qPCR cycles were determined on a CFX96 Touch Real-Time PCR Detection System (Bio-Rad) using EvaGreen (Biotium, #31000), 2X Phusion HF PCR Master mix and P5/P3 Solexa primers.

    Article Title: Incorporation of genome-bound cellular proteins into HIV-1 particles regulates viral infection.
    Article Snippet: .. Pre-amplification was performed using 2X Phusion HF PCR Master mix (New England Biolabs, #M0531L) with P5Solexa_s and P3Solexa_s primers for six cycles, followed by ProNex (Promega, #NG2001) size-selective purification. .. Optimal qPCR cycles were determined on a CFX96 Touch RealTime PCR Detection System (Bio-Rad) using EvaGreen (Biotium, #31000), 2X Phusion HF PCR Master mix and P5/P3 Solexa primers.

    Amplification:

    Article Title: A single-nucleotide enhancer mutation overrides chromosomal sex to drive XX male development
    Article Snippet: To clone DNA inserts into luciferase plasmids, gDNA was extracted from earpieces of XY Enh13 WT, XX Enh13 SOX9*−3bp -/- and XX Enh13 SOX9*+1bp -/- homozygous mice using DNeasy Blood & Tissue kit (Qiagen, 69504). .. Enh13 was amplified along with the addition of restriction enzymes BglII and HindIII sites using 2X Phusion (NEB, M0531L, Primers used in Table ). .. DNA inserts were digested using BglII and HindIII enzymes (Thermo, K1991) and ligated into the pGL4.26 plasmid (Promega) between the BglII and HindIII sites in the multiple cloning site using a DNA ligation kit (Takara, 6022).

    Article Title: A single-nucleotide enhancer mutation overrides chromosomal sex to drive XX male development.
    Article Snippet: Nature Communications | (2026) 17:3186 13 To clone DNA inserts into luciferase plasmids, gDNA was extracted from earpieces of XY Enh13 WT, XX Enh13SOX9*−3bp -/- and XX Enh13SOX9*+1bp -/- homozygous mice using DNeasy Blood & Tissue kit (Qiagen, 69504). .. Enh13 was amplified along with the addition of restriction enzymes BglII and HindIII sites using 2X Phusion (NEB, M0531L, Primers used in Table S1). .. DNA inserts were digested using BglII and HindIII enzymes (Thermo, K1991) and ligated into the pGL4.26 plasmid (Promega) between the BglII and HindIII sites in the multiple cloning site using a DNA ligation kit (Takara, 6022).

    Plasmid Preparation:

    Article Title: Systematic discovery of pro- and anti-HIV host factors in primary human CD4+ T cells.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Phusion High-Fidelity PCR Master Mix with HF Buffer New England Biolabs Cat# M0531L Qubit 1X dsDNA HS Assay Kit Fisher Scientific Cat# Q33231 Plasmid Plus Giga Kit Qiagen Cat# 12991 NEB Golden Gate Assembly Kit (BsmBI-v2) New England Biolabs Cat# E1602L DNA Clean and Concentrator-25 Kit Zymo Research Cat# D4065 Zymoclean Gel DNA Recovery kit Zymo Research Cat# D4008 HIV1 p24 ELISA Kit Abcam Cat# ab218268 QIAamp Blood Mini Kit Qiagen Cat# 51104 Deposited data Genome-wide HIV screens and secondary screen datasets This paper GEO: GSE318876 PI16 proteomics dataset This paper PRIDE: PXD071892 Cytokine genome-wide screen datasets Schmidt et al.18 GEO: GSE174292, GSE190604, and GSE190846 Bulk RNA-seq DICE dataset DICE database https://dice-database.org/ Bulk RNA-seq GTEx dataset GTEx Consortium https://gtexportal.org Tabula Sapiens scRNA-seq dataset Tabula Sapiens Consortium et al.50 https://tabula-sapiens-portal.ds. czbiohub.org/ CORUM dataset CORUM https://mips.helmholtz-muenchen. de/corum/; RRID:SCR_002254 STRING dataset STRING Consortium https://string-db.org/; RRID:SCR_005223 HumanNet dataset HumanNet https://www.inetbio.org/humannet/; RRID:SCR_016146 Experimental models: Cell lines Lenti-X HEK293T cells Takara Bio Cat# 632180; RRID:CVCL_0063 human embryonic kidney 293T cells American Type Culture Collection ATCC CRL-3216; RRID:CVCL_0063 Jurkat cells NIH AIDS Reagent Program ARP-177; RRID:CVCL_0367 CEMx174 cells NIH AIDS Reagent Program, Division of AIDS, NIAID ARP-272; RRID:CVCL_2200 HeLa cells American Type Culture Collection ATCC CCL-2; RRID:CVCL_0030 Oligonucleotides See Table S1E for sgRNA sequences (used for CRISPRa and CRISPRn arrayed validations) and qPCR primers/probes (2-LTR circle nuclear import assay). .. This paper N/A single-stranded donor oligonucleotide (ssODN; TTAGCTCTG TTTACGTCCCAGCGGGCATGAGAGTAACAAGAGGGTGTG GTAATATTACGGTACCGAGCACTATCGATACAATATGTGT CATACGGACACG) IDT N/A Recombinant DNA lentiCas9-Blast Addgene RRID:Addgene_52962 pZR112 Addgene RRID:Addgene_180263 Genome-wide CRISPRn library (Brunello) Addgene RRID:Addgene_73178 Genome-wide CRISPRa library (Calabrese A) Addgene RRID:Addgene_92379 Genome-wide CRISPRa library (Calabrese B) Addgene RRID:Addgene_92380 lentiGuide-Puro Addgene RRID:Addgene_52963 pXPR_502 Addgene RRID:Addgene_96923 pAdVAntage Promega Corporation RRID:Addgene_E1711 pCMV4-BlaM-Vpr Addgene RRID:Addgene_21950 pMD2.G Addgene RRID:Addgene_12259 (Continued on next page) ll OPEN ACCESS Cell 189, 1–18.e1–e13, June 11, 2026 e3 Please cite this article in press as: Rathore et al., Systematic discovery of pro- and anti-HIV host factors in primary human CD4+ T cells, Cell (2026), https://doi.org/10.1016/j.cell.2026.03.046 Article

    Enzyme-linked Immunosorbent Assay:

    Article Title: Systematic discovery of pro- and anti-HIV host factors in primary human CD4+ T cells.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Phusion High-Fidelity PCR Master Mix with HF Buffer New England Biolabs Cat# M0531L Qubit 1X dsDNA HS Assay Kit Fisher Scientific Cat# Q33231 Plasmid Plus Giga Kit Qiagen Cat# 12991 NEB Golden Gate Assembly Kit (BsmBI-v2) New England Biolabs Cat# E1602L DNA Clean and Concentrator-25 Kit Zymo Research Cat# D4065 Zymoclean Gel DNA Recovery kit Zymo Research Cat# D4008 HIV1 p24 ELISA Kit Abcam Cat# ab218268 QIAamp Blood Mini Kit Qiagen Cat# 51104 Deposited data Genome-wide HIV screens and secondary screen datasets This paper GEO: GSE318876 PI16 proteomics dataset This paper PRIDE: PXD071892 Cytokine genome-wide screen datasets Schmidt et al.18 GEO: GSE174292, GSE190604, and GSE190846 Bulk RNA-seq DICE dataset DICE database https://dice-database.org/ Bulk RNA-seq GTEx dataset GTEx Consortium https://gtexportal.org Tabula Sapiens scRNA-seq dataset Tabula Sapiens Consortium et al.50 https://tabula-sapiens-portal.ds. czbiohub.org/ CORUM dataset CORUM https://mips.helmholtz-muenchen. de/corum/; RRID:SCR_002254 STRING dataset STRING Consortium https://string-db.org/; RRID:SCR_005223 HumanNet dataset HumanNet https://www.inetbio.org/humannet/; RRID:SCR_016146 Experimental models: Cell lines Lenti-X HEK293T cells Takara Bio Cat# 632180; RRID:CVCL_0063 human embryonic kidney 293T cells American Type Culture Collection ATCC CRL-3216; RRID:CVCL_0063 Jurkat cells NIH AIDS Reagent Program ARP-177; RRID:CVCL_0367 CEMx174 cells NIH AIDS Reagent Program, Division of AIDS, NIAID ARP-272; RRID:CVCL_2200 HeLa cells American Type Culture Collection ATCC CCL-2; RRID:CVCL_0030 Oligonucleotides See Table S1E for sgRNA sequences (used for CRISPRa and CRISPRn arrayed validations) and qPCR primers/probes (2-LTR circle nuclear import assay). .. This paper N/A single-stranded donor oligonucleotide (ssODN; TTAGCTCTG TTTACGTCCCAGCGGGCATGAGAGTAACAAGAGGGTGTG GTAATATTACGGTACCGAGCACTATCGATACAATATGTGT CATACGGACACG) IDT N/A Recombinant DNA lentiCas9-Blast Addgene RRID:Addgene_52962 pZR112 Addgene RRID:Addgene_180263 Genome-wide CRISPRn library (Brunello) Addgene RRID:Addgene_73178 Genome-wide CRISPRa library (Calabrese A) Addgene RRID:Addgene_92379 Genome-wide CRISPRa library (Calabrese B) Addgene RRID:Addgene_92380 lentiGuide-Puro Addgene RRID:Addgene_52963 pXPR_502 Addgene RRID:Addgene_96923 pAdVAntage Promega Corporation RRID:Addgene_E1711 pCMV4-BlaM-Vpr Addgene RRID:Addgene_21950 pMD2.G Addgene RRID:Addgene_12259 (Continued on next page) ll OPEN ACCESS Cell 189, 1–18.e1–e13, June 11, 2026 e3 Please cite this article in press as: Rathore et al., Systematic discovery of pro- and anti-HIV host factors in primary human CD4+ T cells, Cell (2026), https://doi.org/10.1016/j.cell.2026.03.046 Article

    Genome Wide:

    Article Title: Systematic discovery of pro- and anti-HIV host factors in primary human CD4+ T cells.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Phusion High-Fidelity PCR Master Mix with HF Buffer New England Biolabs Cat# M0531L Qubit 1X dsDNA HS Assay Kit Fisher Scientific Cat# Q33231 Plasmid Plus Giga Kit Qiagen Cat# 12991 NEB Golden Gate Assembly Kit (BsmBI-v2) New England Biolabs Cat# E1602L DNA Clean and Concentrator-25 Kit Zymo Research Cat# D4065 Zymoclean Gel DNA Recovery kit Zymo Research Cat# D4008 HIV1 p24 ELISA Kit Abcam Cat# ab218268 QIAamp Blood Mini Kit Qiagen Cat# 51104 Deposited data Genome-wide HIV screens and secondary screen datasets This paper GEO: GSE318876 PI16 proteomics dataset This paper PRIDE: PXD071892 Cytokine genome-wide screen datasets Schmidt et al.18 GEO: GSE174292, GSE190604, and GSE190846 Bulk RNA-seq DICE dataset DICE database https://dice-database.org/ Bulk RNA-seq GTEx dataset GTEx Consortium https://gtexportal.org Tabula Sapiens scRNA-seq dataset Tabula Sapiens Consortium et al.50 https://tabula-sapiens-portal.ds. czbiohub.org/ CORUM dataset CORUM https://mips.helmholtz-muenchen. de/corum/; RRID:SCR_002254 STRING dataset STRING Consortium https://string-db.org/; RRID:SCR_005223 HumanNet dataset HumanNet https://www.inetbio.org/humannet/; RRID:SCR_016146 Experimental models: Cell lines Lenti-X HEK293T cells Takara Bio Cat# 632180; RRID:CVCL_0063 human embryonic kidney 293T cells American Type Culture Collection ATCC CRL-3216; RRID:CVCL_0063 Jurkat cells NIH AIDS Reagent Program ARP-177; RRID:CVCL_0367 CEMx174 cells NIH AIDS Reagent Program, Division of AIDS, NIAID ARP-272; RRID:CVCL_2200 HeLa cells American Type Culture Collection ATCC CCL-2; RRID:CVCL_0030 Oligonucleotides See Table S1E for sgRNA sequences (used for CRISPRa and CRISPRn arrayed validations) and qPCR primers/probes (2-LTR circle nuclear import assay). .. This paper N/A single-stranded donor oligonucleotide (ssODN; TTAGCTCTG TTTACGTCCCAGCGGGCATGAGAGTAACAAGAGGGTGTG GTAATATTACGGTACCGAGCACTATCGATACAATATGTGT CATACGGACACG) IDT N/A Recombinant DNA lentiCas9-Blast Addgene RRID:Addgene_52962 pZR112 Addgene RRID:Addgene_180263 Genome-wide CRISPRn library (Brunello) Addgene RRID:Addgene_73178 Genome-wide CRISPRa library (Calabrese A) Addgene RRID:Addgene_92379 Genome-wide CRISPRa library (Calabrese B) Addgene RRID:Addgene_92380 lentiGuide-Puro Addgene RRID:Addgene_52963 pXPR_502 Addgene RRID:Addgene_96923 pAdVAntage Promega Corporation RRID:Addgene_E1711 pCMV4-BlaM-Vpr Addgene RRID:Addgene_21950 pMD2.G Addgene RRID:Addgene_12259 (Continued on next page) ll OPEN ACCESS Cell 189, 1–18.e1–e13, June 11, 2026 e3 Please cite this article in press as: Rathore et al., Systematic discovery of pro- and anti-HIV host factors in primary human CD4+ T cells, Cell (2026), https://doi.org/10.1016/j.cell.2026.03.046 Article

    RNA Sequencing:

    Article Title: Systematic discovery of pro- and anti-HIV host factors in primary human CD4+ T cells.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Phusion High-Fidelity PCR Master Mix with HF Buffer New England Biolabs Cat# M0531L Qubit 1X dsDNA HS Assay Kit Fisher Scientific Cat# Q33231 Plasmid Plus Giga Kit Qiagen Cat# 12991 NEB Golden Gate Assembly Kit (BsmBI-v2) New England Biolabs Cat# E1602L DNA Clean and Concentrator-25 Kit Zymo Research Cat# D4065 Zymoclean Gel DNA Recovery kit Zymo Research Cat# D4008 HIV1 p24 ELISA Kit Abcam Cat# ab218268 QIAamp Blood Mini Kit Qiagen Cat# 51104 Deposited data Genome-wide HIV screens and secondary screen datasets This paper GEO: GSE318876 PI16 proteomics dataset This paper PRIDE: PXD071892 Cytokine genome-wide screen datasets Schmidt et al.18 GEO: GSE174292, GSE190604, and GSE190846 Bulk RNA-seq DICE dataset DICE database https://dice-database.org/ Bulk RNA-seq GTEx dataset GTEx Consortium https://gtexportal.org Tabula Sapiens scRNA-seq dataset Tabula Sapiens Consortium et al.50 https://tabula-sapiens-portal.ds. czbiohub.org/ CORUM dataset CORUM https://mips.helmholtz-muenchen. de/corum/; RRID:SCR_002254 STRING dataset STRING Consortium https://string-db.org/; RRID:SCR_005223 HumanNet dataset HumanNet https://www.inetbio.org/humannet/; RRID:SCR_016146 Experimental models: Cell lines Lenti-X HEK293T cells Takara Bio Cat# 632180; RRID:CVCL_0063 human embryonic kidney 293T cells American Type Culture Collection ATCC CRL-3216; RRID:CVCL_0063 Jurkat cells NIH AIDS Reagent Program ARP-177; RRID:CVCL_0367 CEMx174 cells NIH AIDS Reagent Program, Division of AIDS, NIAID ARP-272; RRID:CVCL_2200 HeLa cells American Type Culture Collection ATCC CCL-2; RRID:CVCL_0030 Oligonucleotides See Table S1E for sgRNA sequences (used for CRISPRa and CRISPRn arrayed validations) and qPCR primers/probes (2-LTR circle nuclear import assay). .. This paper N/A single-stranded donor oligonucleotide (ssODN; TTAGCTCTG TTTACGTCCCAGCGGGCATGAGAGTAACAAGAGGGTGTG GTAATATTACGGTACCGAGCACTATCGATACAATATGTGT CATACGGACACG) IDT N/A Recombinant DNA lentiCas9-Blast Addgene RRID:Addgene_52962 pZR112 Addgene RRID:Addgene_180263 Genome-wide CRISPRn library (Brunello) Addgene RRID:Addgene_73178 Genome-wide CRISPRa library (Calabrese A) Addgene RRID:Addgene_92379 Genome-wide CRISPRa library (Calabrese B) Addgene RRID:Addgene_92380 lentiGuide-Puro Addgene RRID:Addgene_52963 pXPR_502 Addgene RRID:Addgene_96923 pAdVAntage Promega Corporation RRID:Addgene_E1711 pCMV4-BlaM-Vpr Addgene RRID:Addgene_21950 pMD2.G Addgene RRID:Addgene_12259 (Continued on next page) ll OPEN ACCESS Cell 189, 1–18.e1–e13, June 11, 2026 e3 Please cite this article in press as: Rathore et al., Systematic discovery of pro- and anti-HIV host factors in primary human CD4+ T cells, Cell (2026), https://doi.org/10.1016/j.cell.2026.03.046 Article

    Real-time Polymerase Chain Reaction:

    Article Title: Systematic discovery of pro- and anti-HIV host factors in primary human CD4+ T cells.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Phusion High-Fidelity PCR Master Mix with HF Buffer New England Biolabs Cat# M0531L Qubit 1X dsDNA HS Assay Kit Fisher Scientific Cat# Q33231 Plasmid Plus Giga Kit Qiagen Cat# 12991 NEB Golden Gate Assembly Kit (BsmBI-v2) New England Biolabs Cat# E1602L DNA Clean and Concentrator-25 Kit Zymo Research Cat# D4065 Zymoclean Gel DNA Recovery kit Zymo Research Cat# D4008 HIV1 p24 ELISA Kit Abcam Cat# ab218268 QIAamp Blood Mini Kit Qiagen Cat# 51104 Deposited data Genome-wide HIV screens and secondary screen datasets This paper GEO: GSE318876 PI16 proteomics dataset This paper PRIDE: PXD071892 Cytokine genome-wide screen datasets Schmidt et al.18 GEO: GSE174292, GSE190604, and GSE190846 Bulk RNA-seq DICE dataset DICE database https://dice-database.org/ Bulk RNA-seq GTEx dataset GTEx Consortium https://gtexportal.org Tabula Sapiens scRNA-seq dataset Tabula Sapiens Consortium et al.50 https://tabula-sapiens-portal.ds. czbiohub.org/ CORUM dataset CORUM https://mips.helmholtz-muenchen. de/corum/; RRID:SCR_002254 STRING dataset STRING Consortium https://string-db.org/; RRID:SCR_005223 HumanNet dataset HumanNet https://www.inetbio.org/humannet/; RRID:SCR_016146 Experimental models: Cell lines Lenti-X HEK293T cells Takara Bio Cat# 632180; RRID:CVCL_0063 human embryonic kidney 293T cells American Type Culture Collection ATCC CRL-3216; RRID:CVCL_0063 Jurkat cells NIH AIDS Reagent Program ARP-177; RRID:CVCL_0367 CEMx174 cells NIH AIDS Reagent Program, Division of AIDS, NIAID ARP-272; RRID:CVCL_2200 HeLa cells American Type Culture Collection ATCC CCL-2; RRID:CVCL_0030 Oligonucleotides See Table S1E for sgRNA sequences (used for CRISPRa and CRISPRn arrayed validations) and qPCR primers/probes (2-LTR circle nuclear import assay). .. This paper N/A single-stranded donor oligonucleotide (ssODN; TTAGCTCTG TTTACGTCCCAGCGGGCATGAGAGTAACAAGAGGGTGTG GTAATATTACGGTACCGAGCACTATCGATACAATATGTGT CATACGGACACG) IDT N/A Recombinant DNA lentiCas9-Blast Addgene RRID:Addgene_52962 pZR112 Addgene RRID:Addgene_180263 Genome-wide CRISPRn library (Brunello) Addgene RRID:Addgene_73178 Genome-wide CRISPRa library (Calabrese A) Addgene RRID:Addgene_92379 Genome-wide CRISPRa library (Calabrese B) Addgene RRID:Addgene_92380 lentiGuide-Puro Addgene RRID:Addgene_52963 pXPR_502 Addgene RRID:Addgene_96923 pAdVAntage Promega Corporation RRID:Addgene_E1711 pCMV4-BlaM-Vpr Addgene RRID:Addgene_21950 pMD2.G Addgene RRID:Addgene_12259 (Continued on next page) ll OPEN ACCESS Cell 189, 1–18.e1–e13, June 11, 2026 e3 Please cite this article in press as: Rathore et al., Systematic discovery of pro- and anti-HIV host factors in primary human CD4+ T cells, Cell (2026), https://doi.org/10.1016/j.cell.2026.03.046 Article

    Clone Assay:

    Article Title: In Vivo Massively Parallel Reporter Assay Reveals Sequence Determinants of mRNA Localization in Astrocytes
    Article Snippet: .. Sparc Δ661-890 was cloned using PCR stitching (primers in Table 5) with Phusion High-Fidelity PCR Master Mix (NEB, M0531). .. To clone constructs into the reporter plasmid, the plasmid and validation constructs were separately digested with KpnI-HF (NEB, R3142L), NheI-HF (NEB, R3131) in rCutsmart buffer (NEB, B6004) and gel purified with NucleoSpin Gel & PCR Clean-up Mini Kit (Macherey-Nagal, 740609.50).



    Similar Products

    90
    Virapur Inc kit formulation buffer
    Kit Formulation Buffer, supplied by Virapur Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/kit+formulation+buffer/kit+formulation+buffer/us07700571-968-5-9
    Average 90 stars, based on 1 article reviews
    kit formulation buffer - by Bioz Stars, 2026-09
    90/100 stars
      Buy from Supplier

    Image Search Results