jpk spm data processing 7.0 (Bruker Corporation)
Bruker Corporation is a verified supplier 
90
Structured Review
Bruker Corporation
jpk spm data processing 7.0
Jpk Spm Data Processing 7.0, supplied by Bruker Corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/jpk+spm+data+processing/jpk+spm+software/pm40300310-101-7-14
Average 90 stars, based on 1 article reviews
Jpk Spm Data Processing 7.0, supplied by Bruker Corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/jpk+spm+data+processing/jpk+spm+software/pm40300310-101-7-14
Average 90 stars, based on 1 article reviews
jpk spm data processing 7.0 - by Bioz Stars,
2026-09
90/100 stars
Images
Related Articles
Recombinant:Article Title: A protein-DNA surface hydrogel mechanically protects the cell nucleus Article Snippet: The spring constant was calibrated before each measurement session using the Article Title: Elastic properties of leukemic cells linked to maturation stage and integrin activation Article Snippet: Any subheadings not relevant to your study can be skipped. (NOTE: references should be in numbered style, e.g., Smith et al.1) Key resources table REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Mouse monoclonal anti-CD29 PE Invitrogen Cat# 12-0299-42; RRID: AB_2572555 Mouse monoclonal CD34-FITC BD Biosciences Cat#345801; RRID: AB_2868825 Mouse monoclonal CD38-PE BD Biosciences Cat#345806; RRID: RRID: AB_2868828 Mouse monoclonal CD45-PERCP Biolegend Cat#304026; RRID: AB_893341 Human monoclonal CD34-PE Miltenyi Biotec Cat#130-120-520; RRID: AB_2811343 Mouse monoclonal CD38-FITC BD BD Pharmingen Cat#555459; RRID: AB_395852 Mouse monoclonal CD45-PE-Cy7 Biolegend Cat#368532; RRID: AB_2715891 Biological samples Bone marrow or peripheral blood samples of AML patients University Medical Center Groningen This paper Chemicals, peptides, and recombinant proteins Retronectin Takara Bio Cat#T100B TrypLE Express Gibco Cat #12604021 SU-8 2002 micro resist technology GmbH N/A Sylgard 184 Polydimethylsiloxane Mavom Cat#1060040 Fluorolink MD 700 Acota Ltd. N/A 2-Hydroxy-2-methylpropiophenone Sigma Aldrich Cat#405655 Alexa Fluor® 488 phalloidin Cell Signaling Technology Cat#8878 Experimental models: Cell lines Human: THP-1 DSMZ ACC16 Oligonucleotides Single guide RNA, DNA template sequence: GATCATTTAGGTGACACTATAGTGGAGAATGTATAC AAGCAGTTTAAGAGCTATGCTGGAAACAGCATAGCA AGTTTAAATAAGGCTAGTCCGTTATCAACTTGAAAAA GTGGCACCGAGTCGGTGC Eurofins genomics, Ebersberg, Germany N/A Primer exon3_for: GATAAAGGCCTGAGGGGATG Eurofins genomics, Ebersberg, Germany N/A Primer exon3_rev: GTGCTCAATAGCCACATCTG Eurofins genomics, Ebersberg, Germany N/A Software and algorithms ImageJ/FIJI Schneider et al.65, Schindelin et al.66 https://imagej.nih.go v/ij/ Jo urn al Pr e-p roo f FlowJo FlowJo, LLC https://www.flowjo.co m/ JPK SPM Data Processing Bruker N/A Other Duke StandardsTM 20 μm borosilicate glass microspheres Thermo Fisher Scientific Cat#9020 CB3 cantilever of the qp-BioAC-50 chip NANOSENSORS qp-BioAC-50 Jo urn al Pr e-p roo f Article Title: Melanocyte differentiation and mechanosensation are differentially modulated by distinct extracellular matrix proteins Article Snippet: For each force-distance curve, the Hertz fit ( ) was applied to the contact region of the extend curve to evaluate the Young’s Modulus with the JPK SPM Data Processing Software v8.0.1 (Bruker Nano GmbH, Germany). Article Title: Single molecule recognition of CD95 receptors on the surface of HepG2 cells under the curcumin. Article Snippet: Hepatocellular carcinoma (HCC) is a serious concern worldwide.. The published reports showed that aberrant CD95 receptor expression plays a critical role in apoptosis in liver cancer.. While curcumin has shown promise in inducing apoptosis in liver cancer cells, its direct effects on CD95 expression during this process have not been thoroughly investigated. Article Title: Alterations in paraffin wax crystal networks induced by asphaltenes and pour point depressants, investigated by atomic force microscopy Article Snippet: Young Modulus of the approach region and adhesion were quantified using Article Title: Melanocyte differentiation and mechanosensation are differentially modulated by distinct extracellular matrix proteins Article Snippet: For data analysis, the following softwares were used: GraphPad PRISM, version 10.2.1, ImageJ/Fiji, JPK SPM Data Processing Software v8.0.1 (Bruker, Nano, Germany). Article Title: The WIRS motifs in Fat2 are required for Drosophila egg chamber rotation but not for elongation. Article Snippet: The actual spring constant of the cantilever was measured before each experiment, using the Article Title: Elastic properties of leukemic cells linked to maturation stage and integrin activation Article Snippet: Sequencing:Article Title: A protein-DNA surface hydrogel mechanically protects the cell nucleus Article Snippet: The spring constant was calibrated before each measurement session using the Article Title: Elastic properties of leukemic cells linked to maturation stage and integrin activation Article Snippet: Any subheadings not relevant to your study can be skipped. (NOTE: references should be in numbered style, e.g., Smith et al.1) Key resources table REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Mouse monoclonal anti-CD29 PE Invitrogen Cat# 12-0299-42; RRID: AB_2572555 Mouse monoclonal CD34-FITC BD Biosciences Cat#345801; RRID: AB_2868825 Mouse monoclonal CD38-PE BD Biosciences Cat#345806; RRID: RRID: AB_2868828 Mouse monoclonal CD45-PERCP Biolegend Cat#304026; RRID: AB_893341 Human monoclonal CD34-PE Miltenyi Biotec Cat#130-120-520; RRID: AB_2811343 Mouse monoclonal CD38-FITC BD BD Pharmingen Cat#555459; RRID: AB_395852 Mouse monoclonal CD45-PE-Cy7 Biolegend Cat#368532; RRID: AB_2715891 Biological samples Bone marrow or peripheral blood samples of AML patients University Medical Center Groningen This paper Chemicals, peptides, and recombinant proteins Retronectin Takara Bio Cat#T100B TrypLE Express Gibco Cat #12604021 SU-8 2002 micro resist technology GmbH N/A Sylgard 184 Polydimethylsiloxane Mavom Cat#1060040 Fluorolink MD 700 Acota Ltd. N/A 2-Hydroxy-2-methylpropiophenone Sigma Aldrich Cat#405655 Alexa Fluor® 488 phalloidin Cell Signaling Technology Cat#8878 Experimental models: Cell lines Human: THP-1 DSMZ ACC16 Oligonucleotides Single guide RNA, DNA template sequence: GATCATTTAGGTGACACTATAGTGGAGAATGTATAC AAGCAGTTTAAGAGCTATGCTGGAAACAGCATAGCA AGTTTAAATAAGGCTAGTCCGTTATCAACTTGAAAAA GTGGCACCGAGTCGGTGC Eurofins genomics, Ebersberg, Germany N/A Primer exon3_for: GATAAAGGCCTGAGGGGATG Eurofins genomics, Ebersberg, Germany N/A Primer exon3_rev: GTGCTCAATAGCCACATCTG Eurofins genomics, Ebersberg, Germany N/A Software and algorithms ImageJ/FIJI Schneider et al.65, Schindelin et al.66 https://imagej.nih.go v/ij/ Jo urn al Pr e-p roo f FlowJo FlowJo, LLC https://www.flowjo.co m/ JPK SPM Data Processing Bruker N/A Other Duke StandardsTM 20 μm borosilicate glass microspheres Thermo Fisher Scientific Cat#9020 CB3 cantilever of the qp-BioAC-50 chip NANOSENSORS qp-BioAC-50 Jo urn al Pr e-p roo f Article Title: Melanocyte differentiation and mechanosensation are differentially modulated by distinct extracellular matrix proteins Article Snippet: For each force-distance curve, the Hertz fit ( ) was applied to the contact region of the extend curve to evaluate the Young’s Modulus with the JPK SPM Data Processing Software v8.0.1 (Bruker Nano GmbH, Germany). Article Title: Single molecule recognition of CD95 receptors on the surface of HepG2 cells under the curcumin. Article Snippet: Hepatocellular carcinoma (HCC) is a serious concern worldwide.. The published reports showed that aberrant CD95 receptor expression plays a critical role in apoptosis in liver cancer.. While curcumin has shown promise in inducing apoptosis in liver cancer cells, its direct effects on CD95 expression during this process have not been thoroughly investigated. Article Title: Alterations in paraffin wax crystal networks induced by asphaltenes and pour point depressants, investigated by atomic force microscopy Article Snippet: Young Modulus of the approach region and adhesion were quantified using Article Title: Melanocyte differentiation and mechanosensation are differentially modulated by distinct extracellular matrix proteins Article Snippet: For data analysis, the following softwares were used: GraphPad PRISM, version 10.2.1, ImageJ/Fiji, JPK SPM Data Processing Software v8.0.1 (Bruker, Nano, Germany). Article Title: The WIRS motifs in Fat2 are required for Drosophila egg chamber rotation but not for elongation. Article Snippet: The actual spring constant of the cantilever was measured before each experiment, using the Article Title: Elastic properties of leukemic cells linked to maturation stage and integrin activation Article Snippet: Software:Article Title: A protein-DNA surface hydrogel mechanically protects the cell nucleus Article Snippet: The spring constant was calibrated before each measurement session using the Article Title: Elastic properties of leukemic cells linked to maturation stage and integrin activation Article Snippet: Any subheadings not relevant to your study can be skipped. (NOTE: references should be in numbered style, e.g., Smith et al.1) Key resources table REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Mouse monoclonal anti-CD29 PE Invitrogen Cat# 12-0299-42; RRID: AB_2572555 Mouse monoclonal CD34-FITC BD Biosciences Cat#345801; RRID: AB_2868825 Mouse monoclonal CD38-PE BD Biosciences Cat#345806; RRID: RRID: AB_2868828 Mouse monoclonal CD45-PERCP Biolegend Cat#304026; RRID: AB_893341 Human monoclonal CD34-PE Miltenyi Biotec Cat#130-120-520; RRID: AB_2811343 Mouse monoclonal CD38-FITC BD BD Pharmingen Cat#555459; RRID: AB_395852 Mouse monoclonal CD45-PE-Cy7 Biolegend Cat#368532; RRID: AB_2715891 Biological samples Bone marrow or peripheral blood samples of AML patients University Medical Center Groningen This paper Chemicals, peptides, and recombinant proteins Retronectin Takara Bio Cat#T100B TrypLE Express Gibco Cat #12604021 SU-8 2002 micro resist technology GmbH N/A Sylgard 184 Polydimethylsiloxane Mavom Cat#1060040 Fluorolink MD 700 Acota Ltd. N/A 2-Hydroxy-2-methylpropiophenone Sigma Aldrich Cat#405655 Alexa Fluor® 488 phalloidin Cell Signaling Technology Cat#8878 Experimental models: Cell lines Human: THP-1 DSMZ ACC16 Oligonucleotides Single guide RNA, DNA template sequence: GATCATTTAGGTGACACTATAGTGGAGAATGTATAC AAGCAGTTTAAGAGCTATGCTGGAAACAGCATAGCA AGTTTAAATAAGGCTAGTCCGTTATCAACTTGAAAAA GTGGCACCGAGTCGGTGC Eurofins genomics, Ebersberg, Germany N/A Primer exon3_for: GATAAAGGCCTGAGGGGATG Eurofins genomics, Ebersberg, Germany N/A Primer exon3_rev: GTGCTCAATAGCCACATCTG Eurofins genomics, Ebersberg, Germany N/A Software and algorithms ImageJ/FIJI Schneider et al.65, Schindelin et al.66 https://imagej.nih.go v/ij/ Jo urn al Pr e-p roo f FlowJo FlowJo, LLC https://www.flowjo.co m/ JPK SPM Data Processing Bruker N/A Other Duke StandardsTM 20 μm borosilicate glass microspheres Thermo Fisher Scientific Cat#9020 CB3 cantilever of the qp-BioAC-50 chip NANOSENSORS qp-BioAC-50 Jo urn al Pr e-p roo f Article Title: Melanocyte differentiation and mechanosensation are differentially modulated by distinct extracellular matrix proteins Article Snippet: For each force-distance curve, the Hertz fit ( ) was applied to the contact region of the extend curve to evaluate the Young’s Modulus with the JPK SPM Data Processing Software v8.0.1 (Bruker Nano GmbH, Germany). Article Title: Single molecule recognition of CD95 receptors on the surface of HepG2 cells under the curcumin. Article Snippet: Hepatocellular carcinoma (HCC) is a serious concern worldwide.. The published reports showed that aberrant CD95 receptor expression plays a critical role in apoptosis in liver cancer.. While curcumin has shown promise in inducing apoptosis in liver cancer cells, its direct effects on CD95 expression during this process have not been thoroughly investigated. Article Title: Alterations in paraffin wax crystal networks induced by asphaltenes and pour point depressants, investigated by atomic force microscopy Article Snippet: Young Modulus of the approach region and adhesion were quantified using Article Title: Melanocyte differentiation and mechanosensation are differentially modulated by distinct extracellular matrix proteins Article Snippet: For data analysis, the following softwares were used: GraphPad PRISM, version 10.2.1, ImageJ/Fiji, JPK SPM Data Processing Software v8.0.1 (Bruker, Nano, Germany). Article Title: The WIRS motifs in Fat2 are required for Drosophila egg chamber rotation but not for elongation. Article Snippet: The actual spring constant of the cantilever was measured before each experiment, using the Article Title: Elastic properties of leukemic cells linked to maturation stage and integrin activation Article Snippet: |
