Review



nucleocapsid protein n  (Sino Biological)


Bioz Verified Symbol Sino Biological is a verified supplier
Bioz Manufacturer Symbol Sino Biological manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 96

    Structured Review

    Sino Biological nucleocapsid protein n
    a The iSLK.219 cells were transfected with vector control or vectors encoding SARS-CoV-2 spike protein (S), nucleocapsid protein (N) and KSHV RTA (as a positive control) with or without low dose of doxycycline (Dox, 0.1 µg/mL) induction for 72 h. The expression of RFP (representing viral lytic reactivation) and GFP (representing infected cells) were detected using fluorescence microscopy. Error bars represent S.D. for 4 image fields per well. b , c BCP-1 cells were transfected as above with or without low dose of 12- O -tetradecanoyl-phorbol-13-acetate (TPA, 1.0 ng/mL) induction for 72 h, then the transcripts of representative lytic genes were quantified by using qRT-PCR. The supernatants from transfected cells were collected to infect naive HEK293T cells, then viral genome levels were quantified by using qPCR with Lana -specific primers. Error bars represent S.D. for 3 independent experiments, ** p < 0.01 (vs the vector control). d Expression of ACE2 and LANA (as well as representative IgG control) in formalin-fixed paraffin-embedded KS tissues from 3 HIV+ patients and normal skin tissues were determined by immunohistochemical staining as described in the “Methods”. Bars: 50 μm.
    Nucleocapsid Protein N, supplied by Sino Biological, used in various techniques. Bioz Stars score: 96/100, based on 327 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/hplc+system+system+controller+data+analysis+software/SARS-CoV-2+Nucleocapsid+Protein/pmc08175744-88-13-19
    Average 96 stars, based on 327 article reviews
    nucleocapsid protein n - by Bioz Stars, 2026-09
    96/100 stars

    Images

    1) Product Images from "SARS-CoV-2 proteins and anti-COVID-19 drugs induce lytic reactivation of an oncogenic virus"

    Article Title: SARS-CoV-2 proteins and anti-COVID-19 drugs induce lytic reactivation of an oncogenic virus

    Journal: Communications Biology

    doi: 10.1038/s42003-021-02220-z

    a The iSLK.219 cells were transfected with vector control or vectors encoding SARS-CoV-2 spike protein (S), nucleocapsid protein (N) and KSHV RTA (as a positive control) with or without low dose of doxycycline (Dox, 0.1 µg/mL) induction for 72 h. The expression of RFP (representing viral lytic reactivation) and GFP (representing infected cells) were detected using fluorescence microscopy. Error bars represent S.D. for 4 image fields per well. b , c BCP-1 cells were transfected as above with or without low dose of 12- O -tetradecanoyl-phorbol-13-acetate (TPA, 1.0 ng/mL) induction for 72 h, then the transcripts of representative lytic genes were quantified by using qRT-PCR. The supernatants from transfected cells were collected to infect naive HEK293T cells, then viral genome levels were quantified by using qPCR with Lana -specific primers. Error bars represent S.D. for 3 independent experiments, ** p < 0.01 (vs the vector control). d Expression of ACE2 and LANA (as well as representative IgG control) in formalin-fixed paraffin-embedded KS tissues from 3 HIV+ patients and normal skin tissues were determined by immunohistochemical staining as described in the “Methods”. Bars: 50 μm.
    Figure Legend Snippet: a The iSLK.219 cells were transfected with vector control or vectors encoding SARS-CoV-2 spike protein (S), nucleocapsid protein (N) and KSHV RTA (as a positive control) with or without low dose of doxycycline (Dox, 0.1 µg/mL) induction for 72 h. The expression of RFP (representing viral lytic reactivation) and GFP (representing infected cells) were detected using fluorescence microscopy. Error bars represent S.D. for 4 image fields per well. b , c BCP-1 cells were transfected as above with or without low dose of 12- O -tetradecanoyl-phorbol-13-acetate (TPA, 1.0 ng/mL) induction for 72 h, then the transcripts of representative lytic genes were quantified by using qRT-PCR. The supernatants from transfected cells were collected to infect naive HEK293T cells, then viral genome levels were quantified by using qPCR with Lana -specific primers. Error bars represent S.D. for 3 independent experiments, ** p < 0.01 (vs the vector control). d Expression of ACE2 and LANA (as well as representative IgG control) in formalin-fixed paraffin-embedded KS tissues from 3 HIV+ patients and normal skin tissues were determined by immunohistochemical staining as described in the “Methods”. Bars: 50 μm.

    Techniques Used: Transfection, Plasmid Preparation, Positive Control, Expressing, Infection, Fluorescence, Microscopy, Quantitative RT-PCR, Formalin-fixed Paraffin-Embedded, Immunohistochemical staining, Staining

    Related Articles

    Incubation:

    Article Title: Agreement Between Self‐Reported COVID‐19 and Dried Blood Spot Serology: A Cross‐Sectional Study
    Article Snippet: .. Briefly, 96‐well high‐binding plates (Thermo Fisher Scientific) were coated with SARS‐CoV‐2 Nucleocapsid protein (Sino Biological) diluted in PBS at 2 μg/mL and then incubated at 4°C overnight. ..

    Article Title: Utilizing Constrained Bicyclic Peptides for In Vitro Diagnostics.
    Article Snippet: To appropriate wells of a Thermo Scientific, Pierce Streptavidin Coated High Capacity Plate (Clear, 96-Well) was added 100 μL of biotinylated Bicycle molecule (B001, B002, B003, or B004) in PBS at 1 μM and incubated for 2 h at room temperature. .. The plate was then washed (3×) with PBST (400 μL·well−1) and 100 μL recombinant SARS-CoV-2 nucleocapsid protein (Sino Biological; cat: 40588- V08B) in PBST at 50 ng·mL−1 was added and incubated at room temperature for 30 min with PBST as a negative control. .. The wells were washed again (3×) with PBST and 100 μL of detection IgG (Sino Biological; cat: 41043-MM05, 41043-MM08, 40588-MM123, or 40588-MM124) in PBST at 0.25 ng·mL−1 was added to appropriate wells and incubated at room temperature for 30 min.

    Article Title: Amphotericin B promotes respiratory viral entry by enhancing late endosomal maturation and fusion via glucocerebrosidase-mediated ceramide remodeling
    Article Snippet: .. Antigen retrieval was performed in 10 mM sodium citrate buffer (pH 6.0) by microwave heating for 20 min. Endogenous peroxidase activity was quenched with 0.3% H2O2 for 15 min, and non-specific binding was blocked with normal serum for 30 min. After blocking, the sections were washed briefly in PBS and then incubated overnight at 4 °C with a primary antibody against the SARS-CoV-2 nucleocapsid protein (Cat# 40143-R001, dilution 1:500; Sino Biological, China). .. Following three 5-min washes with PBS, the sections were incubated with a horseradish peroxidase (HRP)-conjugated anti-rabbit IgG secondary antibody (Cat# SE134, dilution 1:200; Solarbio, China) for 1 h at room temperature.

    Article Title: SARS-CoV-2 infection during the first trimester leads to profound immune dysregulation at the maternal-fetal interface despite limited virus detection in placental tissues.
    Article Snippet: .. The sections were then incubated overnight at 4 °C in a humidified chamber with a primary antibody targeting the SARS-CoV-2 nucleocapsid protein (1:500 dilution; Sino Biological, China). .. After three washes with PBS, the sections were incubated with a goat anti-rabbit IgG H&L horseradish peroxidase-conjugated secondary antibody (1:2,000 dilution; Abcam, USA) for 30 minutes at 37 °C.

    SDS Page:

    Article Title: Targeted Delivery of Nucleic Acid and Protein Cargos into Primary Human Hematopoietic Stem Cells Using Bacteriophage T4
    Article Snippet: .. The quantity of capsid particles was determined by SDS-PAGE analysis of the major capsid protein gp23 (48.7 kDa, ∼.75μg gp23 per 10 10 T4 heads) compared with known quantities of T4 heads or SARS-CoV-2 nucleocapsid protein (Sino Biological). .. Media components included DMEM High glucose supplemented with pyruvate and GlutaMAX (ThermoFisher Scientific #10569044), fetal bovine serum (FBS, Avantor Sciences #89510-186), Penicillin-Streptomycin (PS, ThermoFisher Scientific #15140122), StemSpan SFEM II (Stemcell Technologies #9605), StemSpan Human CD34+ expansion supplement (Stemcell Technologies #2691), and UM729 (Stemcell Technologies #72332).

    Recombinant:

    Article Title: Utilizing Constrained Bicyclic Peptides for In Vitro Diagnostics.
    Article Snippet: To appropriate wells of a Thermo Scientific, Pierce Streptavidin Coated High Capacity Plate (Clear, 96-Well) was added 100 μL of biotinylated Bicycle molecule (B001, B002, B003, or B004) in PBS at 1 μM and incubated for 2 h at room temperature. .. The plate was then washed (3×) with PBST (400 μL·well−1) and 100 μL recombinant SARS-CoV-2 nucleocapsid protein (Sino Biological; cat: 40588- V08B) in PBST at 50 ng·mL−1 was added and incubated at room temperature for 30 min with PBST as a negative control. .. The wells were washed again (3×) with PBST and 100 μL of detection IgG (Sino Biological; cat: 41043-MM05, 41043-MM08, 40588-MM123, or 40588-MM124) in PBST at 0.25 ng·mL−1 was added to appropriate wells and incubated at room temperature for 30 min.

    Negative Control:

    Article Title: Utilizing Constrained Bicyclic Peptides for In Vitro Diagnostics.
    Article Snippet: To appropriate wells of a Thermo Scientific, Pierce Streptavidin Coated High Capacity Plate (Clear, 96-Well) was added 100 μL of biotinylated Bicycle molecule (B001, B002, B003, or B004) in PBS at 1 μM and incubated for 2 h at room temperature. .. The plate was then washed (3×) with PBST (400 μL·well−1) and 100 μL recombinant SARS-CoV-2 nucleocapsid protein (Sino Biological; cat: 40588- V08B) in PBST at 50 ng·mL−1 was added and incubated at room temperature for 30 min with PBST as a negative control. .. The wells were washed again (3×) with PBST and 100 μL of detection IgG (Sino Biological; cat: 41043-MM05, 41043-MM08, 40588-MM123, or 40588-MM124) in PBST at 0.25 ng·mL−1 was added to appropriate wells and incubated at room temperature for 30 min.

    Activity Assay:

    Article Title: Amphotericin B promotes respiratory viral entry by enhancing late endosomal maturation and fusion via glucocerebrosidase-mediated ceramide remodeling
    Article Snippet: .. Antigen retrieval was performed in 10 mM sodium citrate buffer (pH 6.0) by microwave heating for 20 min. Endogenous peroxidase activity was quenched with 0.3% H2O2 for 15 min, and non-specific binding was blocked with normal serum for 30 min. After blocking, the sections were washed briefly in PBS and then incubated overnight at 4 °C with a primary antibody against the SARS-CoV-2 nucleocapsid protein (Cat# 40143-R001, dilution 1:500; Sino Biological, China). .. Following three 5-min washes with PBS, the sections were incubated with a horseradish peroxidase (HRP)-conjugated anti-rabbit IgG secondary antibody (Cat# SE134, dilution 1:200; Solarbio, China) for 1 h at room temperature.

    Binding Assay:

    Article Title: Amphotericin B promotes respiratory viral entry by enhancing late endosomal maturation and fusion via glucocerebrosidase-mediated ceramide remodeling
    Article Snippet: .. Antigen retrieval was performed in 10 mM sodium citrate buffer (pH 6.0) by microwave heating for 20 min. Endogenous peroxidase activity was quenched with 0.3% H2O2 for 15 min, and non-specific binding was blocked with normal serum for 30 min. After blocking, the sections were washed briefly in PBS and then incubated overnight at 4 °C with a primary antibody against the SARS-CoV-2 nucleocapsid protein (Cat# 40143-R001, dilution 1:500; Sino Biological, China). .. Following three 5-min washes with PBS, the sections were incubated with a horseradish peroxidase (HRP)-conjugated anti-rabbit IgG secondary antibody (Cat# SE134, dilution 1:200; Solarbio, China) for 1 h at room temperature.

    Blocking Assay:

    Article Title: Amphotericin B promotes respiratory viral entry by enhancing late endosomal maturation and fusion via glucocerebrosidase-mediated ceramide remodeling
    Article Snippet: .. Antigen retrieval was performed in 10 mM sodium citrate buffer (pH 6.0) by microwave heating for 20 min. Endogenous peroxidase activity was quenched with 0.3% H2O2 for 15 min, and non-specific binding was blocked with normal serum for 30 min. After blocking, the sections were washed briefly in PBS and then incubated overnight at 4 °C with a primary antibody against the SARS-CoV-2 nucleocapsid protein (Cat# 40143-R001, dilution 1:500; Sino Biological, China). .. Following three 5-min washes with PBS, the sections were incubated with a horseradish peroxidase (HRP)-conjugated anti-rabbit IgG secondary antibody (Cat# SE134, dilution 1:200; Solarbio, China) for 1 h at room temperature.

    Staining:

    Article Title: SARS-CoV-2 Antivirals Identified from Small Molecule Modulators of Programmed -1 Ribosomal Frameshifting.
    Article Snippet: .. Thirty hours postinfection cells were fixed by 4% paraformaldehyde (PFA) and stained for SARS-CoV-2 nucleocapsid (Sino Biological Inc.) followed by Goat antirabbit secondary antibody Alexa Fluor 488-conjugated (ThermoFisher) and manually counted under the microscope. .. For RT-qPCR, cell-associated RNA was extracted by Trizol following manufacturer’s instructions (ThermoFisher Scientific), SARS-CoV-2 viral RNA was detected by reverse transcription and amplification using the TaqMan RNA-to-CT 1-Step Kit (ThermoFisher), utilizing the primers (Forward 5′ ATGCTGCAATCGTGCTACAA 3′; Reverse 5′ GACTGCCGCCTCTGCTC 3′) and probe (5′ TCAAGGAACAACATTGCCAA 3′) sequences as described before (PMID: 34214467).

    Microscopy:

    Article Title: SARS-CoV-2 Antivirals Identified from Small Molecule Modulators of Programmed -1 Ribosomal Frameshifting.
    Article Snippet: .. Thirty hours postinfection cells were fixed by 4% paraformaldehyde (PFA) and stained for SARS-CoV-2 nucleocapsid (Sino Biological Inc.) followed by Goat antirabbit secondary antibody Alexa Fluor 488-conjugated (ThermoFisher) and manually counted under the microscope. .. For RT-qPCR, cell-associated RNA was extracted by Trizol following manufacturer’s instructions (ThermoFisher Scientific), SARS-CoV-2 viral RNA was detected by reverse transcription and amplification using the TaqMan RNA-to-CT 1-Step Kit (ThermoFisher), utilizing the primers (Forward 5′ ATGCTGCAATCGTGCTACAA 3′; Reverse 5′ GACTGCCGCCTCTGCTC 3′) and probe (5′ TCAAGGAACAACATTGCCAA 3′) sequences as described before (PMID: 34214467).

    other:

    Article Title: MG-101, a cysteine protease inhibitor identified through high-throughput screening, exhibits in vivo efficacy and synergy with remdesivir against SARS-CoV-2.
    Article Snippet: Anti-SARS-CoV-2 nucleocapsid (N) protein antibody was obtained from Sino Biological Inc. (Beijing, China).



    Similar Products

    90
    Hichrom Limited the hplc work station software used for the instrument control and data analysis
    The Hplc Work Station Software Used For The Instrument Control And Data Analysis, supplied by Hichrom Limited, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/hplc+system+system+controller+data+analysis+software/the+hplc+work+station+software+used+for+the+instrument+control+and+data+analysis/pm24342511-79-25-4
    Average 90 stars, based on 1 article reviews
    the hplc work station software used for the instrument control and data analysis - by Bioz Stars, 2026-09
    90/100 stars
      Buy from Supplier

    90
    Shimadzu Corporation hplc system system controller data analysis software
    Hplc System System Controller Data Analysis Software, supplied by Shimadzu Corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/hplc+system+system+controller+data+analysis+software/iPad+Control+Enhances+Productivity+in+HPLC+System+Operations/pm21342096-44-1-0
    Average 90 stars, based on 1 article reviews
    hplc system system controller data analysis software - by Bioz Stars, 2026-09
    90/100 stars
      Buy from Supplier

    90
    Bio-Rad empower software for hplc operation control and data analysis
    Empower Software For Hplc Operation Control And Data Analysis, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/hplc+system+system+controller+data+analysis+software/empower+software+for+hplc+operation+control+and+data+analysis/pm18781694-65-23-10
    Average 90 stars, based on 1 article reviews
    empower software for hplc operation control and data analysis - by Bioz Stars, 2026-09
    90/100 stars
      Buy from Supplier

    Image Search Results