high throughput sequencing kit (Complete Genomics Inc)
Complete Genomics Inc is a verified supplier 
Complete Genomics Inc manufactures this product 
99
Structured Review
Complete Genomics Inc
high throughput sequencing kit
High Throughput Sequencing Kit, supplied by Complete Genomics Inc, used in various techniques. Bioz Stars score: 99/100, based on 42 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/high+throughput+sequencing+kit/DNBSEQ-T7RS+High-throughput+Sequencing+Set/pm42002238-72-11-15
Average 99 stars, based on 42 article reviews
High Throughput Sequencing Kit, supplied by Complete Genomics Inc, used in various techniques. Bioz Stars score: 99/100, based on 42 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/high+throughput+sequencing+kit/DNBSEQ-T7RS+High-throughput+Sequencing+Set/pm42002238-72-11-15
Average 99 stars, based on 42 article reviews
high throughput sequencing kit - by Bioz Stars,
2026-11
99/100 stars
Images
Related Articles
RNA Sequencing:Article Title: METTL5-mediated m6A modification of 18S rRNA drives oral squamous cell carcinoma progression by enhancing CCND3 translation Article Snippet: RNAs in total cell lysates and RNC-mRNAs were extracted with TRIzol reagent (cat. no. 15596018; Thermo Fisher Scientific, Inc.) and subjected to RNA-sequencing (RNA-seq). .. For RNA-seq experiments, the following details were followed: i) RNA sample preparation kit: TRIzol reagent (cat. no. 15596018; Thermo Fisher Scientific, Inc.); ii) sample quality/integrity verification: RNA quality was assessed by Q20 (>90%), Q30 (>85%) values, and RNA integrity number (RIN) ≥7.0 using a Microplate Reader (Molecular Devices, Gemini XPS) and Qubit 4 Fluorometer (cat. no. Q33216 , Thermo Fisher Scientific, Inc.); iii) sequencing type: Paired-end sequencing (PE150) on the DNBSEQ platform; iv) sequencing kit: Sample Prep:Article Title: METTL5-mediated m6A modification of 18S rRNA drives oral squamous cell carcinoma progression by enhancing CCND3 translation Article Snippet: RNAs in total cell lysates and RNC-mRNAs were extracted with TRIzol reagent (cat. no. 15596018; Thermo Fisher Scientific, Inc.) and subjected to RNA-sequencing (RNA-seq). .. For RNA-seq experiments, the following details were followed: i) RNA sample preparation kit: TRIzol reagent (cat. no. 15596018; Thermo Fisher Scientific, Inc.); ii) sample quality/integrity verification: RNA quality was assessed by Q20 (>90%), Q30 (>85%) values, and RNA integrity number (RIN) ≥7.0 using a Microplate Reader (Molecular Devices, Gemini XPS) and Qubit 4 Fluorometer (cat. no. Q33216 , Thermo Fisher Scientific, Inc.); iii) sequencing type: Paired-end sequencing (PE150) on the DNBSEQ platform; iv) sequencing kit: Qubit:Article Title: METTL5-mediated m6A modification of 18S rRNA drives oral squamous cell carcinoma progression by enhancing CCND3 translation Article Snippet: RNAs in total cell lysates and RNC-mRNAs were extracted with TRIzol reagent (cat. no. 15596018; Thermo Fisher Scientific, Inc.) and subjected to RNA-sequencing (RNA-seq). .. For RNA-seq experiments, the following details were followed: i) RNA sample preparation kit: TRIzol reagent (cat. no. 15596018; Thermo Fisher Scientific, Inc.); ii) sample quality/integrity verification: RNA quality was assessed by Q20 (>90%), Q30 (>85%) values, and RNA integrity number (RIN) ≥7.0 using a Microplate Reader (Molecular Devices, Gemini XPS) and Qubit 4 Fluorometer (cat. no. Q33216 , Thermo Fisher Scientific, Inc.); iii) sequencing type: Paired-end sequencing (PE150) on the DNBSEQ platform; iv) sequencing kit: Sequencing:Article Title: METTL5-mediated m6A modification of 18S rRNA drives oral squamous cell carcinoma progression by enhancing CCND3 translation Article Snippet: RNAs in total cell lysates and RNC-mRNAs were extracted with TRIzol reagent (cat. no. 15596018; Thermo Fisher Scientific, Inc.) and subjected to RNA-sequencing (RNA-seq). .. For RNA-seq experiments, the following details were followed: i) RNA sample preparation kit: TRIzol reagent (cat. no. 15596018; Thermo Fisher Scientific, Inc.); ii) sample quality/integrity verification: RNA quality was assessed by Q20 (>90%), Q30 (>85%) values, and RNA integrity number (RIN) ≥7.0 using a Microplate Reader (Molecular Devices, Gemini XPS) and Qubit 4 Fluorometer (cat. no. Q33216 , Thermo Fisher Scientific, Inc.); iii) sequencing type: Paired-end sequencing (PE150) on the DNBSEQ platform; iv) sequencing kit: Next-Generation Sequencing:Article Title: METTL5-mediated m6A modification of 18S rRNA drives oral squamous cell carcinoma progression by enhancing CCND3 translation Article Snippet: RNAs in total cell lysates and RNC-mRNAs were extracted with TRIzol reagent (cat. no. 15596018; Thermo Fisher Scientific, Inc.) and subjected to RNA-sequencing (RNA-seq). .. For RNA-seq experiments, the following details were followed: i) RNA sample preparation kit: TRIzol reagent (cat. no. 15596018; Thermo Fisher Scientific, Inc.); ii) sample quality/integrity verification: RNA quality was assessed by Q20 (>90%), Q30 (>85%) values, and RNA integrity number (RIN) ≥7.0 using a Microplate Reader (Molecular Devices, Gemini XPS) and Qubit 4 Fluorometer (cat. no. Q33216 , Thermo Fisher Scientific, Inc.); iii) sequencing type: Paired-end sequencing (PE150) on the DNBSEQ platform; iv) sequencing kit: Article Title: High-quality genome and transcriptome analyses under temperature stress reveal heat shock protein-centric adaptive enhancement mechanisms in Taiwanese loach. Article Snippet: .. Short read libraries were constructed following the provided instructions for the Article Title: Pomegranate peel‑derived exosome‑like nanoparticles: A discarded treasure trove for colorectal cancer treatment Article Snippet: Library circular‐ ization was performed using the MGIEasy Dual Barcode Circularization Module (cat. no. A0508; MGI Tech Co., Ltd.) prior to sequencing. .. Finally, the libraries were sequenced on the DNBSEQ‐T7 platform (MGI Tech Co., Ltd.) using the Article Title: Hippocampus undergoes transcriptomic changes and synaptic alterations in a Slc17a5 heterozygous mouse model with working memory deficit. Article Snippet: Sialin, a sialic acid transporter encoded by the Slc17a5 gene, plays a critical role in lysosomal function, with complete loss resulting in severe sialic acid storage diseases with profound neurological impairment.. However, the consequences of SLC17A5 haploinsufficiency on adult brain function remain largely unknown.. Here, we systematically investigated the impact of heterozygous Slc17a5 deletion in adult mice. Article Title: Pomegranate peel-derived exosome-like nanoparticles: A discarded treasure trove for colorectal cancer treatment Article Snippet: Library circularization was performed using the MGIEasy Dual Barcode Circularization Module (cat. no. A0508; MGI Tech Co., Ltd.) prior to sequencing. .. Finally, the libraries were sequenced on the DNBSEQ-T7 platform (MGI Tech Co., Ltd.) using the Article Title: The elongation of Mest transcript into MestXL sustains, but does not initiate, the maternal allele bias of its convergent gene Copg2 during neurogenesis Article Snippet: The adapter-ligated DNA was amplified by 13 cycles of PCR using primers with unique dual indexes to generate Illumina-compatible libraries. .. The libraries were sequenced using MGIEasy Universal Library Conversion Kit (App A) (MGI, 1000004155) and Concentration Assay:Article Title: METTL5-mediated m6A modification of 18S rRNA drives oral squamous cell carcinoma progression by enhancing CCND3 translation Article Snippet: RNAs in total cell lysates and RNC-mRNAs were extracted with TRIzol reagent (cat. no. 15596018; Thermo Fisher Scientific, Inc.) and subjected to RNA-sequencing (RNA-seq). .. For RNA-seq experiments, the following details were followed: i) RNA sample preparation kit: TRIzol reagent (cat. no. 15596018; Thermo Fisher Scientific, Inc.); ii) sample quality/integrity verification: RNA quality was assessed by Q20 (>90%), Q30 (>85%) values, and RNA integrity number (RIN) ≥7.0 using a Microplate Reader (Molecular Devices, Gemini XPS) and Qubit 4 Fluorometer (cat. no. Q33216 , Thermo Fisher Scientific, Inc.); iii) sequencing type: Paired-end sequencing (PE150) on the DNBSEQ platform; iv) sequencing kit: Polymerase Chain Reaction:Article Title: METTL5-mediated m6A modification of 18S rRNA drives oral squamous cell carcinoma progression by enhancing CCND3 translation Article Snippet: RNAs in total cell lysates and RNC-mRNAs were extracted with TRIzol reagent (cat. no. 15596018; Thermo Fisher Scientific, Inc.) and subjected to RNA-sequencing (RNA-seq). .. For RNA-seq experiments, the following details were followed: i) RNA sample preparation kit: TRIzol reagent (cat. no. 15596018; Thermo Fisher Scientific, Inc.); ii) sample quality/integrity verification: RNA quality was assessed by Q20 (>90%), Q30 (>85%) values, and RNA integrity number (RIN) ≥7.0 using a Microplate Reader (Molecular Devices, Gemini XPS) and Qubit 4 Fluorometer (cat. no. Q33216 , Thermo Fisher Scientific, Inc.); iii) sequencing type: Paired-end sequencing (PE150) on the DNBSEQ platform; iv) sequencing kit: Real-time Polymerase Chain Reaction:Article Title: METTL5-mediated m6A modification of 18S rRNA drives oral squamous cell carcinoma progression by enhancing CCND3 translation Article Snippet: RNAs in total cell lysates and RNC-mRNAs were extracted with TRIzol reagent (cat. no. 15596018; Thermo Fisher Scientific, Inc.) and subjected to RNA-sequencing (RNA-seq). .. For RNA-seq experiments, the following details were followed: i) RNA sample preparation kit: TRIzol reagent (cat. no. 15596018; Thermo Fisher Scientific, Inc.); ii) sample quality/integrity verification: RNA quality was assessed by Q20 (>90%), Q30 (>85%) values, and RNA integrity number (RIN) ≥7.0 using a Microplate Reader (Molecular Devices, Gemini XPS) and Qubit 4 Fluorometer (cat. no. Q33216 , Thermo Fisher Scientific, Inc.); iii) sequencing type: Paired-end sequencing (PE150) on the DNBSEQ platform; iv) sequencing kit: Analysis:Article Title: METTL5-mediated m6A modification of 18S rRNA drives oral squamous cell carcinoma progression by enhancing CCND3 translation Article Snippet: RNAs in total cell lysates and RNC-mRNAs were extracted with TRIzol reagent (cat. no. 15596018; Thermo Fisher Scientific, Inc.) and subjected to RNA-sequencing (RNA-seq). .. For RNA-seq experiments, the following details were followed: i) RNA sample preparation kit: TRIzol reagent (cat. no. 15596018; Thermo Fisher Scientific, Inc.); ii) sample quality/integrity verification: RNA quality was assessed by Q20 (>90%), Q30 (>85%) values, and RNA integrity number (RIN) ≥7.0 using a Microplate Reader (Molecular Devices, Gemini XPS) and Qubit 4 Fluorometer (cat. no. Q33216 , Thermo Fisher Scientific, Inc.); iii) sequencing type: Paired-end sequencing (PE150) on the DNBSEQ platform; iv) sequencing kit: Software:Article Title: METTL5-mediated m6A modification of 18S rRNA drives oral squamous cell carcinoma progression by enhancing CCND3 translation Article Snippet: RNAs in total cell lysates and RNC-mRNAs were extracted with TRIzol reagent (cat. no. 15596018; Thermo Fisher Scientific, Inc.) and subjected to RNA-sequencing (RNA-seq). .. For RNA-seq experiments, the following details were followed: i) RNA sample preparation kit: TRIzol reagent (cat. no. 15596018; Thermo Fisher Scientific, Inc.); ii) sample quality/integrity verification: RNA quality was assessed by Q20 (>90%), Q30 (>85%) values, and RNA integrity number (RIN) ≥7.0 using a Microplate Reader (Molecular Devices, Gemini XPS) and Qubit 4 Fluorometer (cat. no. Q33216 , Thermo Fisher Scientific, Inc.); iii) sequencing type: Paired-end sequencing (PE150) on the DNBSEQ platform; iv) sequencing kit: Gene Expression:Article Title: METTL5-mediated m6A modification of 18S rRNA drives oral squamous cell carcinoma progression by enhancing CCND3 translation Article Snippet: RNAs in total cell lysates and RNC-mRNAs were extracted with TRIzol reagent (cat. no. 15596018; Thermo Fisher Scientific, Inc.) and subjected to RNA-sequencing (RNA-seq). .. For RNA-seq experiments, the following details were followed: i) RNA sample preparation kit: TRIzol reagent (cat. no. 15596018; Thermo Fisher Scientific, Inc.); ii) sample quality/integrity verification: RNA quality was assessed by Q20 (>90%), Q30 (>85%) values, and RNA integrity number (RIN) ≥7.0 using a Microplate Reader (Molecular Devices, Gemini XPS) and Qubit 4 Fluorometer (cat. no. Q33216 , Thermo Fisher Scientific, Inc.); iii) sequencing type: Paired-end sequencing (PE150) on the DNBSEQ platform; iv) sequencing kit: Quantitative Proteomics:Article Title: METTL5-mediated m6A modification of 18S rRNA drives oral squamous cell carcinoma progression by enhancing CCND3 translation Article Snippet: RNAs in total cell lysates and RNC-mRNAs were extracted with TRIzol reagent (cat. no. 15596018; Thermo Fisher Scientific, Inc.) and subjected to RNA-sequencing (RNA-seq). .. For RNA-seq experiments, the following details were followed: i) RNA sample preparation kit: TRIzol reagent (cat. no. 15596018; Thermo Fisher Scientific, Inc.); ii) sample quality/integrity verification: RNA quality was assessed by Q20 (>90%), Q30 (>85%) values, and RNA integrity number (RIN) ≥7.0 using a Microplate Reader (Molecular Devices, Gemini XPS) and Qubit 4 Fluorometer (cat. no. Q33216 , Thermo Fisher Scientific, Inc.); iii) sequencing type: Paired-end sequencing (PE150) on the DNBSEQ platform; iv) sequencing kit: Construct:Article Title: High-quality genome and transcriptome analyses under temperature stress reveal heat shock protein-centric adaptive enhancement mechanisms in Taiwanese loach. Article Snippet: .. Short read libraries were constructed following the provided instructions for the other:Article Title: Distinct pathophysiological mechanisms of CEP152 variants in microcephaly and brain abnormalities. Article Snippet: Rabbit anti-CEP152-N GeneTex Cat# GTX128027 Rabbit anti-CEP152-C Homemade Rabbit anti-Calbindin-D Homemade Rabbit anti-Myc Homemade © The Author(s) EMBO Molecular Medicine 19 Reagent/resource Reference or Source Identifier or Catalog Number Rabbit anti-Parvalbumin Homemade Rabbit anti-Tbr2 Abcam Cat# ab23345 Rabbit anti-activated Cell Signaling Cat# 9664 Caspase3 Rabbit anti-Cux1 Gene Tex Cat# GTX56275 Rabbit anti-GFP Medical & Biological Laboratories Cat# 598 Rabbit anti-phospho-Histone H3 Cell Signaling Cat# 9701 Rabbit anti-Olig2 Proteintech Cat#13999-1-AP Rabbit anti-Pax6 COVANCE Cat# PRB-278P Mouse anti-Myc Cell Signaling Cat# 2276 Mouse anti-γ-tubulin Sigma-Aldrich Cat# T6557 Mouse anti-Arl13b Neuromab Cat# 75-287 Mouse anti-α-Tubulin Sigma-Aldrich Cat# T6199 Mouse anti-Nestin R&D SYSTEMS Cat# MAB2736 Mouse anti-β-Catenin BD Biosciences Cat# 610153 Mouse anti-α-actin Cell Signaling Cat# 3700 Rat anti-Ctip2 Abcam Cat# ab18465 Rat anti-Centrin2 BioLegend Cat# 698601 Oligonucleotides and other sequence-based reagents ssODN for Q32P-KI (CCGTGTGACACTGATGTGACTGCCCTTACTCAGTTGCAGC AGCTACTCACAGACCTCCCTCACGACATGCTGGACGATGA) Integrated DNA Technologies Chemicals, enzymes and other reagents 4′,6-Diamidino-2-phenylindole dihydrochloride Sigma-Aldrich Cat# D9542 Ethynyl-2’-deoxyuridine FUJIFILM Wako Cat# 050-08844 Click-iT TM Plus EdU Alexa Fluor TM 555 imaging kit Invitrogen Cat# C10638 Paraformaldehyde Nacalai Tesque Cat# 26126-25 PERMAFLUOR: anti-fading mounting medium Thermo Scientific Cat# TA-030-FM FD Rapid GolgiStain kit FD NeuroTechnologies Cat# PK401A Permount: mounting medium Fisher Scientific Cat# SP15-100 Sepasol®-RNA I Super Nacalai Tesque Cat# G09379-97 MGIEasy |