guide rna (grna) sequences (Broad Institute Inc)
90
Structured Review
Broad Institute Inc
guide rna (grna) sequences
Guide Rna (Grna) Sequences, supplied by Broad Institute Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/guide+sequence/guide+rna++grna++sequences/pm39396119-44-2-23
Average 90 stars, based on 1 article reviews
Guide Rna (Grna) Sequences, supplied by Broad Institute Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/guide+sequence/guide+rna++grna++sequences/pm39396119-44-2-23
Average 90 stars, based on 1 article reviews
guide rna (grna) sequences - by Bioz Stars,
2026-10
90/100 stars
Images
Related Articles
CRISPR:Article Title: IL15RA-STAT3-GPX4/ACSL3 signaling leads to ferroptosis resistance in pancreatic cancer. Article Snippet: Construction of IL15RA-knockout SW1990 cell line Guide RNA (gRNA) sequences targeting the exon regions of the human IL15RA gene were designed by the Broad Institute GPP tool. Article Title: Alternative trafficking of Weibel‐Palade body proteins in CRISPR /Cas9‐engineered von Willebrand factor–deficient blood outgrowth endothelial cells Article Snippet: Guide RNA (gRNA) sequences targeting the first exon of VWF were designed using the MIT CRISPR design tool ( http://crispr.mit.edu ) and the BROAD Institute single guide RNA (sgRNA) designer ( http://www.broadinstitute.org/rnai/public/analysis-tools/sgrna-design ) by submitting the DNA sequence of VWF exon 1 flanked by 100 bp up‐ and downstream (chromosome 12, 6123020‐6123259 positive strand; Figure ). gRNA sequences were selected that have a high predicted efficiency (BROAD Institute score) and a high inverted off‐target score (MIT CRISPR design tool)., gRNAs used in this study were gRNA‐1: 5′‐TGGCCCTCATTTTGCCAGGT‐3′ and gRNA‐2: 5′‐AGCACCCCGGCAAATCTGGC‐3′. Sequencing:Article Title: IL15RA-STAT3-GPX4/ACSL3 signaling leads to ferroptosis resistance in pancreatic cancer. Article Snippet: Construction of IL15RA-knockout SW1990 cell line Guide RNA (gRNA) sequences targeting the exon regions of the human IL15RA gene were designed by the Broad Institute GPP tool. Article Title: Alternative trafficking of Weibel‐Palade body proteins in CRISPR /Cas9‐engineered von Willebrand factor–deficient blood outgrowth endothelial cells Article Snippet: Guide RNA (gRNA) sequences targeting the first exon of VWF were designed using the MIT CRISPR design tool ( http://crispr.mit.edu ) and the BROAD Institute single guide RNA (sgRNA) designer ( http://www.broadinstitute.org/rnai/public/analysis-tools/sgrna-design ) by submitting the DNA sequence of VWF exon 1 flanked by 100 bp up‐ and downstream (chromosome 12, 6123020‐6123259 positive strand; Figure ). gRNA sequences were selected that have a high predicted efficiency (BROAD Institute score) and a high inverted off‐target score (MIT CRISPR design tool)., gRNAs used in this study were gRNA‐1: 5′‐TGGCCCTCATTTTGCCAGGT‐3′ and gRNA‐2: 5′‐AGCACCCCGGCAAATCTGGC‐3′. Clone Assay:Article Title: IL15RA-STAT3-GPX4/ACSL3 signaling leads to ferroptosis resistance in pancreatic cancer. Article Snippet: Construction of IL15RA-knockout SW1990 cell line Guide RNA (gRNA) sequences targeting the exon regions of the human IL15RA gene were designed by the Broad Institute GPP tool. Article Title: Alternative trafficking of Weibel‐Palade body proteins in CRISPR /Cas9‐engineered von Willebrand factor–deficient blood outgrowth endothelial cells Article Snippet: Guide RNA (gRNA) sequences targeting the first exon of VWF were designed using the MIT CRISPR design tool ( http://crispr.mit.edu ) and the BROAD Institute single guide RNA (sgRNA) designer ( http://www.broadinstitute.org/rnai/public/analysis-tools/sgrna-design ) by submitting the DNA sequence of VWF exon 1 flanked by 100 bp up‐ and downstream (chromosome 12, 6123020‐6123259 positive strand; Figure ). gRNA sequences were selected that have a high predicted efficiency (BROAD Institute score) and a high inverted off‐target score (MIT CRISPR design tool)., gRNAs used in this study were gRNA‐1: 5′‐TGGCCCTCATTTTGCCAGGT‐3′ and gRNA‐2: 5′‐AGCACCCCGGCAAATCTGGC‐3′. Plasmid Preparation:Article Title: IL15RA-STAT3-GPX4/ACSL3 signaling leads to ferroptosis resistance in pancreatic cancer. Article Snippet: Construction of IL15RA-knockout SW1990 cell line Guide RNA (gRNA) sequences targeting the exon regions of the human IL15RA gene were designed by the Broad Institute GPP tool. Article Title: Alternative trafficking of Weibel‐Palade body proteins in CRISPR /Cas9‐engineered von Willebrand factor–deficient blood outgrowth endothelial cells Article Snippet: Guide RNA (gRNA) sequences targeting the first exon of VWF were designed using the MIT CRISPR design tool ( http://crispr.mit.edu ) and the BROAD Institute single guide RNA (sgRNA) designer ( http://www.broadinstitute.org/rnai/public/analysis-tools/sgrna-design ) by submitting the DNA sequence of VWF exon 1 flanked by 100 bp up‐ and downstream (chromosome 12, 6123020‐6123259 positive strand; Figure ). gRNA sequences were selected that have a high predicted efficiency (BROAD Institute score) and a high inverted off‐target score (MIT CRISPR design tool)., gRNAs used in this study were gRNA‐1: 5′‐TGGCCCTCATTTTGCCAGGT‐3′ and gRNA‐2: 5′‐AGCACCCCGGCAAATCTGGC‐3′. Transfection:Article Title: IL15RA-STAT3-GPX4/ACSL3 signaling leads to ferroptosis resistance in pancreatic cancer. Article Snippet: Construction of IL15RA-knockout SW1990 cell line Guide RNA (gRNA) sequences targeting the exon regions of the human IL15RA gene were designed by the Broad Institute GPP tool. Article Title: Alternative trafficking of Weibel‐Palade body proteins in CRISPR /Cas9‐engineered von Willebrand factor–deficient blood outgrowth endothelial cells Article Snippet: Guide RNA (gRNA) sequences targeting the first exon of VWF were designed using the MIT CRISPR design tool ( http://crispr.mit.edu ) and the BROAD Institute single guide RNA (sgRNA) designer ( http://www.broadinstitute.org/rnai/public/analysis-tools/sgrna-design ) by submitting the DNA sequence of VWF exon 1 flanked by 100 bp up‐ and downstream (chromosome 12, 6123020‐6123259 positive strand; Figure ). gRNA sequences were selected that have a high predicted efficiency (BROAD Institute score) and a high inverted off‐target score (MIT CRISPR design tool)., gRNAs used in this study were gRNA‐1: 5′‐TGGCCCTCATTTTGCCAGGT‐3′ and gRNA‐2: 5′‐AGCACCCCGGCAAATCTGGC‐3′. Control:Article Title: IL15RA-STAT3-GPX4/ACSL3 signaling leads to ferroptosis resistance in pancreatic cancer. Article Snippet: Construction of IL15RA-knockout SW1990 cell line Guide RNA (gRNA) sequences targeting the exon regions of the human IL15RA gene were designed by the Broad Institute GPP tool. Article Title: Alternative trafficking of Weibel‐Palade body proteins in CRISPR /Cas9‐engineered von Willebrand factor–deficient blood outgrowth endothelial cells Article Snippet: Guide RNA (gRNA) sequences targeting the first exon of VWF were designed using the MIT CRISPR design tool ( http://crispr.mit.edu ) and the BROAD Institute single guide RNA (sgRNA) designer ( http://www.broadinstitute.org/rnai/public/analysis-tools/sgrna-design ) by submitting the DNA sequence of VWF exon 1 flanked by 100 bp up‐ and downstream (chromosome 12, 6123020‐6123259 positive strand; Figure ). gRNA sequences were selected that have a high predicted efficiency (BROAD Institute score) and a high inverted off‐target score (MIT CRISPR design tool)., gRNAs used in this study were gRNA‐1: 5′‐TGGCCCTCATTTTGCCAGGT‐3′ and gRNA‐2: 5′‐AGCACCCCGGCAAATCTGGC‐3′. Produced:Article Title: IL15RA-STAT3-GPX4/ACSL3 signaling leads to ferroptosis resistance in pancreatic cancer. Article Snippet: Construction of IL15RA-knockout SW1990 cell line Guide RNA (gRNA) sequences targeting the exon regions of the human IL15RA gene were designed by the Broad Institute GPP tool. Article Title: Alternative trafficking of Weibel‐Palade body proteins in CRISPR /Cas9‐engineered von Willebrand factor–deficient blood outgrowth endothelial cells Article Snippet: Guide RNA (gRNA) sequences targeting the first exon of VWF were designed using the MIT CRISPR design tool ( http://crispr.mit.edu ) and the BROAD Institute single guide RNA (sgRNA) designer ( http://www.broadinstitute.org/rnai/public/analysis-tools/sgrna-design ) by submitting the DNA sequence of VWF exon 1 flanked by 100 bp up‐ and downstream (chromosome 12, 6123020‐6123259 positive strand; Figure ). gRNA sequences were selected that have a high predicted efficiency (BROAD Institute score) and a high inverted off‐target score (MIT CRISPR design tool)., gRNAs used in this study were gRNA‐1: 5′‐TGGCCCTCATTTTGCCAGGT‐3′ and gRNA‐2: 5′‐AGCACCCCGGCAAATCTGGC‐3′. Transduction:Article Title: IL15RA-STAT3-GPX4/ACSL3 signaling leads to ferroptosis resistance in pancreatic cancer. Article Snippet: Construction of IL15RA-knockout SW1990 cell line Guide RNA (gRNA) sequences targeting the exon regions of the human IL15RA gene were designed by the Broad Institute GPP tool. Article Title: Alternative trafficking of Weibel‐Palade body proteins in CRISPR /Cas9‐engineered von Willebrand factor–deficient blood outgrowth endothelial cells Article Snippet: Guide RNA (gRNA) sequences targeting the first exon of VWF were designed using the MIT CRISPR design tool ( http://crispr.mit.edu ) and the BROAD Institute single guide RNA (sgRNA) designer ( http://www.broadinstitute.org/rnai/public/analysis-tools/sgrna-design ) by submitting the DNA sequence of VWF exon 1 flanked by 100 bp up‐ and downstream (chromosome 12, 6123020‐6123259 positive strand; Figure ). gRNA sequences were selected that have a high predicted efficiency (BROAD Institute score) and a high inverted off‐target score (MIT CRISPR design tool)., gRNAs used in this study were gRNA‐1: 5′‐TGGCCCTCATTTTGCCAGGT‐3′ and gRNA‐2: 5′‐AGCACCCCGGCAAATCTGGC‐3′. Virus:Article Title: IL15RA-STAT3-GPX4/ACSL3 signaling leads to ferroptosis resistance in pancreatic cancer. Article Snippet: Construction of IL15RA-knockout SW1990 cell line Guide RNA (gRNA) sequences targeting the exon regions of the human IL15RA gene were designed by the Broad Institute GPP tool. Article Title: Alternative trafficking of Weibel‐Palade body proteins in CRISPR /Cas9‐engineered von Willebrand factor–deficient blood outgrowth endothelial cells Article Snippet: Guide RNA (gRNA) sequences targeting the first exon of VWF were designed using the MIT CRISPR design tool ( http://crispr.mit.edu ) and the BROAD Institute single guide RNA (sgRNA) designer ( http://www.broadinstitute.org/rnai/public/analysis-tools/sgrna-design ) by submitting the DNA sequence of VWF exon 1 flanked by 100 bp up‐ and downstream (chromosome 12, 6123020‐6123259 positive strand; Figure ). gRNA sequences were selected that have a high predicted efficiency (BROAD Institute score) and a high inverted off‐target score (MIT CRISPR design tool)., gRNAs used in this study were gRNA‐1: 5′‐TGGCCCTCATTTTGCCAGGT‐3′ and gRNA‐2: 5′‐AGCACCCCGGCAAATCTGGC‐3′. Marker:Article Title: IL15RA-STAT3-GPX4/ACSL3 signaling leads to ferroptosis resistance in pancreatic cancer. Article Snippet: Construction of IL15RA-knockout SW1990 cell line Guide RNA (gRNA) sequences targeting the exon regions of the human IL15RA gene were designed by the Broad Institute GPP tool. Article Title: Alternative trafficking of Weibel‐Palade body proteins in CRISPR /Cas9‐engineered von Willebrand factor–deficient blood outgrowth endothelial cells Article Snippet: Guide RNA (gRNA) sequences targeting the first exon of VWF were designed using the MIT CRISPR design tool ( http://crispr.mit.edu ) and the BROAD Institute single guide RNA (sgRNA) designer ( http://www.broadinstitute.org/rnai/public/analysis-tools/sgrna-design ) by submitting the DNA sequence of VWF exon 1 flanked by 100 bp up‐ and downstream (chromosome 12, 6123020‐6123259 positive strand; Figure ). gRNA sequences were selected that have a high predicted efficiency (BROAD Institute score) and a high inverted off‐target score (MIT CRISPR design tool)., gRNAs used in this study were gRNA‐1: 5′‐TGGCCCTCATTTTGCCAGGT‐3′ and gRNA‐2: 5′‐AGCACCCCGGCAAATCTGGC‐3′. Enzyme-linked Immunosorbent Assay:Article Title: IL15RA-STAT3-GPX4/ACSL3 signaling leads to ferroptosis resistance in pancreatic cancer. Article Snippet: Construction of IL15RA-knockout SW1990 cell line Guide RNA (gRNA) sequences targeting the exon regions of the human IL15RA gene were designed by the Broad Institute GPP tool. Article Title: Alternative trafficking of Weibel‐Palade body proteins in CRISPR /Cas9‐engineered von Willebrand factor–deficient blood outgrowth endothelial cells Article Snippet: Guide RNA (gRNA) sequences targeting the first exon of VWF were designed using the MIT CRISPR design tool ( http://crispr.mit.edu ) and the BROAD Institute single guide RNA (sgRNA) designer ( http://www.broadinstitute.org/rnai/public/analysis-tools/sgrna-design ) by submitting the DNA sequence of VWF exon 1 flanked by 100 bp up‐ and downstream (chromosome 12, 6123020‐6123259 positive strand; Figure ). gRNA sequences were selected that have a high predicted efficiency (BROAD Institute score) and a high inverted off‐target score (MIT CRISPR design tool)., gRNAs used in this study were gRNA‐1: 5′‐TGGCCCTCATTTTGCCAGGT‐3′ and gRNA‐2: 5′‐AGCACCCCGGCAAATCTGGC‐3′. High Throughput Screening Assay:Article Title: IL15RA-STAT3-GPX4/ACSL3 signaling leads to ferroptosis resistance in pancreatic cancer. Article Snippet: Construction of IL15RA-knockout SW1990 cell line Guide RNA (gRNA) sequences targeting the exon regions of the human IL15RA gene were designed by the Broad Institute GPP tool. Article Title: Alternative trafficking of Weibel‐Palade body proteins in CRISPR /Cas9‐engineered von Willebrand factor–deficient blood outgrowth endothelial cells Article Snippet: Guide RNA (gRNA) sequences targeting the first exon of VWF were designed using the MIT CRISPR design tool ( http://crispr.mit.edu ) and the BROAD Institute single guide RNA (sgRNA) designer ( http://www.broadinstitute.org/rnai/public/analysis-tools/sgrna-design ) by submitting the DNA sequence of VWF exon 1 flanked by 100 bp up‐ and downstream (chromosome 12, 6123020‐6123259 positive strand; Figure ). gRNA sequences were selected that have a high predicted efficiency (BROAD Institute score) and a high inverted off‐target score (MIT CRISPR design tool)., gRNAs used in this study were gRNA‐1: 5′‐TGGCCCTCATTTTGCCAGGT‐3′ and gRNA‐2: 5′‐AGCACCCCGGCAAATCTGGC‐3′. Knock-Out:Article Title: IL15RA-STAT3-GPX4/ACSL3 signaling leads to ferroptosis resistance in pancreatic cancer. Article Snippet: Construction of IL15RA-knockout SW1990 cell line Guide RNA (gRNA) sequences targeting the exon regions of the human IL15RA gene were designed by the Broad Institute GPP tool. Article Title: Alternative trafficking of Weibel‐Palade body proteins in CRISPR /Cas9‐engineered von Willebrand factor–deficient blood outgrowth endothelial cells Article Snippet: Guide RNA (gRNA) sequences targeting the first exon of VWF were designed using the MIT CRISPR design tool ( http://crispr.mit.edu ) and the BROAD Institute single guide RNA (sgRNA) designer ( http://www.broadinstitute.org/rnai/public/analysis-tools/sgrna-design ) by submitting the DNA sequence of VWF exon 1 flanked by 100 bp up‐ and downstream (chromosome 12, 6123020‐6123259 positive strand; Figure ). gRNA sequences were selected that have a high predicted efficiency (BROAD Institute score) and a high inverted off‐target score (MIT CRISPR design tool)., gRNAs used in this study were gRNA‐1: 5′‐TGGCCCTCATTTTGCCAGGT‐3′ and gRNA‐2: 5′‐AGCACCCCGGCAAATCTGGC‐3′. Western Blot:Article Title: IL15RA-STAT3-GPX4/ACSL3 signaling leads to ferroptosis resistance in pancreatic cancer. Article Snippet: Construction of IL15RA-knockout SW1990 cell line Guide RNA (gRNA) sequences targeting the exon regions of the human IL15RA gene were designed by the Broad Institute GPP tool. Article Title: Alternative trafficking of Weibel‐Palade body proteins in CRISPR /Cas9‐engineered von Willebrand factor–deficient blood outgrowth endothelial cells Article Snippet: Guide RNA (gRNA) sequences targeting the first exon of VWF were designed using the MIT CRISPR design tool ( http://crispr.mit.edu ) and the BROAD Institute single guide RNA (sgRNA) designer ( http://www.broadinstitute.org/rnai/public/analysis-tools/sgrna-design ) by submitting the DNA sequence of VWF exon 1 flanked by 100 bp up‐ and downstream (chromosome 12, 6123020‐6123259 positive strand; Figure ). gRNA sequences were selected that have a high predicted efficiency (BROAD Institute score) and a high inverted off‐target score (MIT CRISPR design tool)., gRNAs used in this study were gRNA‐1: 5′‐TGGCCCTCATTTTGCCAGGT‐3′ and gRNA‐2: 5′‐AGCACCCCGGCAAATCTGGC‐3′. Functional Assay:Article Title: IL15RA-STAT3-GPX4/ACSL3 signaling leads to ferroptosis resistance in pancreatic cancer. Article Snippet: Construction of IL15RA-knockout SW1990 cell line Guide RNA (gRNA) sequences targeting the exon regions of the human IL15RA gene were designed by the Broad Institute GPP tool. Article Title: Alternative trafficking of Weibel‐Palade body proteins in CRISPR /Cas9‐engineered von Willebrand factor–deficient blood outgrowth endothelial cells Article Snippet: Guide RNA (gRNA) sequences targeting the first exon of VWF were designed using the MIT CRISPR design tool ( http://crispr.mit.edu ) and the BROAD Institute single guide RNA (sgRNA) designer ( http://www.broadinstitute.org/rnai/public/analysis-tools/sgrna-design ) by submitting the DNA sequence of VWF exon 1 flanked by 100 bp up‐ and downstream (chromosome 12, 6123020‐6123259 positive strand; Figure ). gRNA sequences were selected that have a high predicted efficiency (BROAD Institute score) and a high inverted off‐target score (MIT CRISPR design tool)., gRNAs used in this study were gRNA‐1: 5′‐TGGCCCTCATTTTGCCAGGT‐3′ and gRNA‐2: 5′‐AGCACCCCGGCAAATCTGGC‐3′. Mutagenesis:Article Title: IL15RA-STAT3-GPX4/ACSL3 signaling leads to ferroptosis resistance in pancreatic cancer. Article Snippet: Construction of IL15RA-knockout SW1990 cell line Guide RNA (gRNA) sequences targeting the exon regions of the human IL15RA gene were designed by the Broad Institute GPP tool. Article Title: Alternative trafficking of Weibel‐Palade body proteins in CRISPR /Cas9‐engineered von Willebrand factor–deficient blood outgrowth endothelial cells Article Snippet: Guide RNA (gRNA) sequences targeting the first exon of VWF were designed using the MIT CRISPR design tool ( http://crispr.mit.edu ) and the BROAD Institute single guide RNA (sgRNA) designer ( http://www.broadinstitute.org/rnai/public/analysis-tools/sgrna-design ) by submitting the DNA sequence of VWF exon 1 flanked by 100 bp up‐ and downstream (chromosome 12, 6123020‐6123259 positive strand; Figure ). gRNA sequences were selected that have a high predicted efficiency (BROAD Institute score) and a high inverted off‐target score (MIT CRISPR design tool)., gRNAs used in this study were gRNA‐1: 5′‐TGGCCCTCATTTTGCCAGGT‐3′ and gRNA‐2: 5′‐AGCACCCCGGCAAATCTGGC‐3′. Next-Generation Sequencing:Article Title: IL15RA-STAT3-GPX4/ACSL3 signaling leads to ferroptosis resistance in pancreatic cancer. Article Snippet: Construction of IL15RA-knockout SW1990 cell line Guide RNA (gRNA) sequences targeting the exon regions of the human IL15RA gene were designed by the Broad Institute GPP tool. Article Title: Alternative trafficking of Weibel‐Palade body proteins in CRISPR /Cas9‐engineered von Willebrand factor–deficient blood outgrowth endothelial cells Article Snippet: Guide RNA (gRNA) sequences targeting the first exon of VWF were designed using the MIT CRISPR design tool ( http://crispr.mit.edu ) and the BROAD Institute single guide RNA (sgRNA) designer ( http://www.broadinstitute.org/rnai/public/analysis-tools/sgrna-design ) by submitting the DNA sequence of VWF exon 1 flanked by 100 bp up‐ and downstream (chromosome 12, 6123020‐6123259 positive strand; Figure ). gRNA sequences were selected that have a high predicted efficiency (BROAD Institute score) and a high inverted off‐target score (MIT CRISPR design tool)., gRNAs used in this study were gRNA‐1: 5′‐TGGCCCTCATTTTGCCAGGT‐3′ and gRNA‐2: 5′‐AGCACCCCGGCAAATCTGGC‐3′. |