grna sequence 2 (Synthego Inc)
90
Structured Review
Synthego Inc
grna sequence 2
![]()
Grna Sequence 2, supplied by Synthego Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/grna-2+sequence/grna+sequences/pmc10694670-100-0-5
Average 90 stars, based on 1 article reviews
Grna Sequence 2, supplied by Synthego Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/grna-2+sequence/grna+sequences/pmc10694670-100-0-5
Average 90 stars, based on 1 article reviews
grna sequence 2 - by Bioz Stars,
2026-09
90/100 stars
Images
1) Product Images from "TIGIT contributes to the regulation of 4-1BB and does not define NK cell dysfunction in glioblastoma"
Article Title: TIGIT contributes to the regulation of 4-1BB and does not define NK cell dysfunction in glioblastoma
Journal: iScience
doi: 10.1016/j.isci.2023.108353
Figure Legend Snippet:
Techniques Used: Recombinant, Lactate Dehydrogenase Assay, Cell Based Assay, Gene Knockout, Enzyme-linked Immunosorbent Assay, shRNA, Sequencing, Software, Gene Expression
Related Articles
Sequencing:Article Title: The reaction mechanism for glycolysis side product degradation by Parkinson’s disease–linked DJ-1 Article Snippet: .. The Article Title: TIGIT contributes to the regulation of 4-1BB and does not define NK cell dysfunction in glioblastoma Article Snippet: gRNA sequence 2: AUGUCACCUCUCCUCCACCA , Synthego , N/A. .. Article Title: The reaction mechanism for glycolysis side product degradation by Parkinson's disease-linked DJ-1. Article Snippet: .. The Article Title: AAA+ ATPase chaperone p97/VCP FAF2 governs basal pexophagy Article Snippet: .. To establish FIP200 knockout HCT116 cells and PEX19/FIP200, FAF2/FIP200 double knockout HCT116 cells, the Article Title: TIGIT contributes to the regulation of 4-1BB and does not define NK cell dysfunction in glioblastoma Article Snippet: gRNA sequence 1: UCUUCCCUAGGAAUGAUGAC , Synthego , N/A. .. Retroviral:Article Title: The transcription regulator ID3 maintains tumor-specific memory CD8 + T cells in draining lymph nodes during tumorigenesis. Article Snippet: .. Retroviral construction, transfection and transduction To construct the pSL21-VEX-Id3-gRNA retroviral recombinant plasmid, four Transfection:Article Title: The transcription regulator ID3 maintains tumor-specific memory CD8 + T cells in draining lymph nodes during tumorigenesis. Article Snippet: .. Retroviral construction, transfection and transduction To construct the pSL21-VEX-Id3-gRNA retroviral recombinant plasmid, four Transduction:Article Title: The transcription regulator ID3 maintains tumor-specific memory CD8 + T cells in draining lymph nodes during tumorigenesis. Article Snippet: .. Retroviral construction, transfection and transduction To construct the pSL21-VEX-Id3-gRNA retroviral recombinant plasmid, four Construct:Article Title: The transcription regulator ID3 maintains tumor-specific memory CD8 + T cells in draining lymph nodes during tumorigenesis. Article Snippet: .. Retroviral construction, transfection and transduction To construct the pSL21-VEX-Id3-gRNA retroviral recombinant plasmid, four Recombinant:Article Title: The transcription regulator ID3 maintains tumor-specific memory CD8 + T cells in draining lymph nodes during tumorigenesis. Article Snippet: .. Retroviral construction, transfection and transduction To construct the pSL21-VEX-Id3-gRNA retroviral recombinant plasmid, four Plasmid Preparation:Article Title: The transcription regulator ID3 maintains tumor-specific memory CD8 + T cells in draining lymph nodes during tumorigenesis. Article Snippet: .. Retroviral construction, transfection and transduction To construct the pSL21-VEX-Id3-gRNA retroviral recombinant plasmid, four Generated:Article Title: Genomic studies controvert the existence of the CUX1 p75 isoform Article Snippet: Nitrocellulose membrane (Thermo Scientific, Catalog number: 88018) was used for protein transfer and ECL substrate (Thermo Scientific, Catalog number: 34579) was used for visualizing the proteins of interest. .. All gRNAs were designed using the Broad Institute’s sgRNA designer tool, and generated Knock-Out:Article Title: AAA+ ATPase chaperone p97/VCP FAF2 governs basal pexophagy Article Snippet: .. To establish FIP200 knockout HCT116 cells and PEX19/FIP200, FAF2/FIP200 double knockout HCT116 cells, the Double Knockout:Article Title: AAA+ ATPase chaperone p97/VCP FAF2 governs basal pexophagy Article Snippet: .. To establish FIP200 knockout HCT116 cells and PEX19/FIP200, FAF2/FIP200 double knockout HCT116 cells, the CRISPR:Article Title: AAA+ ATPase chaperone p97/VCP FAF2 governs basal pexophagy Article Snippet: .. To establish FIP200 knockout HCT116 cells and PEX19/FIP200, FAF2/FIP200 double knockout HCT116 cells, the |
