Review



grna sequence 2  (Synthego Inc)

 
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 90
      Buy from Supplier

    Structured Review

    Synthego Inc grna sequence 2

    Grna Sequence 2, supplied by Synthego Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/grna+sequence+2/pmc10694670-100-0-5?v=Synthego+Inc
    Average 90 stars, based on 1 article reviews
    grna sequence 2 - by Bioz Stars, 2026-08
    90/100 stars

    Images

    1) Product Images from "TIGIT contributes to the regulation of 4-1BB and does not define NK cell dysfunction in glioblastoma"

    Article Title: TIGIT contributes to the regulation of 4-1BB and does not define NK cell dysfunction in glioblastoma

    Journal: iScience

    doi: 10.1016/j.isci.2023.108353


    Figure Legend Snippet:

    Techniques Used: Recombinant, Lactate Dehydrogenase Assay, Cell Based Assay, Gene Knockout, Enzyme-linked Immunosorbent Assay, shRNA, Sequencing, Software, Gene Expression



    Similar Products

    grna sgrna sequences flanking ugp2 exon 2  (Synthego Inc)
    86
    Synthego Inc grna sgrna sequences flanking ugp2 exon 2
    Grna Sgrna Sequences Flanking Ugp2 Exon 2, supplied by Synthego Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/grna+sequence+2/pm40769148-755-20-30?v=Synthego+Inc
    Average 86 stars, based on 1 article reviews
    grna sgrna sequences flanking ugp2 exon 2 - by Bioz Stars, 2026-08
    86/100 stars
    		  Buy from Supplier
    single grna sgrna sequences flanking ugp2 exon 2  (Synthego Inc)
    86
    Synthego Inc single grna sgrna sequences flanking ugp2 exon 2
    Single Grna Sgrna Sequences Flanking Ugp2 Exon 2, supplied by Synthego Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/grna+sequence+2/pmc12393875-550-0-11?v=Synthego+Inc
    Average 86 stars, based on 1 article reviews
    single grna sgrna sequences flanking ugp2 exon 2 - by Bioz Stars, 2026-08
    86/100 stars
    		  Buy from Supplier
    illumina sequenced grna-2  (Illumina Inc)
    90
    Illumina Inc illumina sequenced grna-2
    Illumina Sequenced Grna 2, supplied by Illumina Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/grna+sequence+2/pmc11514453-331-17-17?v=Illumina+Inc
    Average 90 stars, based on 1 article reviews
    illumina sequenced grna-2 - by Bioz Stars, 2026-08
    90/100 stars
    		  Buy from Supplier
    cloning gene specific guide rna sequences  (Addgene inc)
    93
    Addgene inc cloning gene specific guide rna sequences
    Cloning Gene Specific Guide Rna Sequences, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/grna+sequence+2/pmc11494886-326-6-16?v=Addgene+inc
    Average 93 stars, based on 1 article reviews
    cloning gene specific guide rna sequences - by Bioz Stars, 2026-08
    93/100 stars
    		  Buy from Supplier
    guide rna grna sequences  (Santa Cruz Biotechnology)
    92
    Santa Cruz Biotechnology guide rna grna sequences
    Guide Rna Grna Sequences, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/grna+sequence+2/pm38582251-71-9-6?v=Santa+Cruz+Biotechnology
    Average 92 stars, based on 1 article reviews
    guide rna grna sequences - by Bioz Stars, 2026-08
    92/100 stars
    		  Buy from Supplier
    grna sequence 2  (Synthego Inc)
    90
    Synthego Inc grna sequence 2

    Grna Sequence 2, supplied by Synthego Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/grna+sequence+2/pmc10694670-100-0-5?v=Synthego+Inc
    Average 90 stars, based on 1 article reviews
    grna sequence 2 - by Bioz Stars, 2026-08
    90/100 stars
    		  Buy from Supplier
    grna-2 sequence  (GenScript corporation)
    90
    GenScript corporation grna-2 sequence

    Grna 2 Sequence, supplied by GenScript corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/grna+sequence+2/us11643672-456-2-22?v=GenScript+corporation
    Average 90 stars, based on 1 article reviews
    grna-2 sequence - by Bioz Stars, 2026-08
    90/100 stars
    		  Buy from Supplier
    nucleotide sequence of the omicron variant (b.1.1.529) of the sars-cov-2 grna  (Biotechnology Information)
    90
    Biotechnology Information nucleotide sequence of the omicron variant (b.1.1.529) of the sars-cov-2 grna

    Nucleotide Sequence Of The Omicron Variant (B.1.1.529) Of The Sars Cov 2 Grna, supplied by Biotechnology Information, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/grna+sequence+2/pm37185717-67-11-21?v=Biotechnology+Information
    Average 90 stars, based on 1 article reviews
    nucleotide sequence of the omicron variant (b.1.1.529) of the sars-cov-2 grna - by Bioz Stars, 2026-08
    90/100 stars
    		  Buy from Supplier
    p58 backbone with 2 grna targeting sequence for pdc1  (KU Leuven)
    90
    KU Leuven p58 backbone with 2 grna targeting sequence for pdc1
    Plasmids used in this work
    P58 Backbone With 2 Grna Targeting Sequence For Pdc1, supplied by KU Leuven, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/grna+sequence+2/pmc09520875-21-2-16?v=KU+Leuven
    Average 90 stars, based on 1 article reviews
    p58 backbone with 2 grna targeting sequence for pdc1 - by Bioz Stars, 2026-08
    90/100 stars
    		  Buy from Supplier
    p58 backbone with 2 grna targeting sequence for pdc5  (KU Leuven)
    90
    KU Leuven p58 backbone with 2 grna targeting sequence for pdc5
    Plasmids used in this work
    P58 Backbone With 2 Grna Targeting Sequence For Pdc5, supplied by KU Leuven, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/grna+sequence+2/pmc09520875-22-0-16?v=KU+Leuven
    Average 90 stars, based on 1 article reviews
    p58 backbone with 2 grna targeting sequence for pdc5 - by Bioz Stars, 2026-08
    90/100 stars
    		  Buy from Supplier

    Image Search Results


    Journal: iScience

    Article Title: TIGIT contributes to the regulation of 4-1BB and does not define NK cell dysfunction in glioblastoma

    doi: 10.1016/j.isci.2023.108353

    Figure Lengend Snippet:

    Article Snippet: gRNA sequence 2: AUGUCACCUCUCCUCCACCA , Synthego , N/A.

    Techniques: Recombinant, Lactate Dehydrogenase Assay, Cell Based Assay, Gene Knockout, Enzyme-linked Immunosorbent Assay, shRNA, Sequencing, Software, Gene Expression

    Plasmids used in this work

    Journal: Microbial Cell Factories

    Article Title: Development of an industrial yeast strain for efficient production of 2,3-butanediol

    doi: 10.1186/s12934-022-01924-z

    Figure Lengend Snippet: Plasmids used in this work

    Article Snippet: P58-PDC1 , P58 backbone with 2 gRNA targeting sequence for PDC1 (AGCATCCAACAATTTTTGCA and GATAAGCTTTATGAAGTCAA) , MCB, KU Leuven.

    Techniques: Marker, Plasmid Preparation, Sequencing, Expressing