graph pad prism 8 0 software (Dotmatics Limited)
86
Structured Review
Dotmatics Limited
graph pad prism 8 0 software
Graph Pad Prism 8 0 Software, supplied by Dotmatics Limited, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/graphing+software/05+7+graph+pad+prism+software+version/pm41376264-97-6-11
Average 86 stars, based on 1 article reviews
Graph Pad Prism 8 0 Software, supplied by Dotmatics Limited, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/graphing+software/05+7+graph+pad+prism+software+version/pm41376264-97-6-11
Average 86 stars, based on 1 article reviews
graph pad prism 8 0 software - by Bioz Stars,
2026-09
86/100 stars
Images
Related Articles
Software:Article Title: Tapioca starch nanoparticles loaded with astaxanthin extend the lifespan of Caenorhabditis elegans by activating DAF-16. Article Snippet: BACKGROUND: Astaxanthin (ASTA) has anti-aging properties but is limited by poor oral bioavailability.. Nanostarch has emerged as a promising carrier to enhance the delivery of bioactive compounds, attracting growing interest in functional food research.. This study prepared ASTA-loaded tapioca starch nanoparticles and characterized their structure. Article Title: Neuronal toxicity and recovery from early bortezomib-induced neuropathy: blood-nerve barrier dysfunction without dorsal root ganglion damage Article Snippet: .. All statistical analyses were done using Article Title: First-line Nivolumab plus FOLFOXIRI/Bevacizumab in advanced RAS/BRAF-mutated colorectal cancer: efficacy, safety and biomarker discovery from the phase II NIVACOR trial Article Snippet: .. The statistical analyses were made using R Statistical software, version 4.2.2 (R Foundation for Statistical Computing, Vienna, Austria) and other:Article Title: Metabolic reshaping drives novel melanin production from tryptophan in a cystic fibrosis Pseudomonas aeruginosa clinical isolate Article Snippet: All the analyses were performed using Article Title: NAT10 promotes cancer metastasis by modulating p300/CBP activity through chromatin-associated tRNA. Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER tDNA template for in vitro transcription of tRNA-Leu-CAG; Forward:TAATACGAC TCACTATAGTCAGGATGGCCGAGCGG TCTAAGGCGCTGCGTTCAGGTCGC; Reverse:TGGTGTCAGGAGTGGGATTCG AACCCACGCCTCCAGGGGAGACTGCG ACCTGAACGCAGC This paper N/A qRT-PCR primer for U6: Forward: CTCGCTTCGGCAGCACA; Reverse: AACGCTTCACGAATTTGCGT This paper N/A qRT-PCR primer for 5S rRNA: Forward: TCTCGTCTGATCTCGGAAGC; Reverse: AGCCTACAGCACCCGGTATT This paper N/A qRT-PCR primer for Gapdh: Forward: AGGTCGGTGTGAACGGATTTG; Reverse: TGTAGACCATGTAGTTGAGGTCA This paper N/A qRT-PCR primer for Rn7SK: Forward: TCCCCGAATAGAGGAGGACC; Reverse: CAGCGCCTCATTTGGATGTG This paper N/A qRT-PCR primer for tRNA-Ser-TGA: Forward: CGAGTGGTTAAGGCGATGGA; Reverse: CGTAGTCGGCAGGATTCGA This paper N/A qRT-PCR primer for tRNA-Leu-CAG: Forward: AGGATGGCCGAGCGGTCTA; Reverse: GGGATTCGAACCCACGCC This paper N/A 5 ′ -Cy3-labeled RNA FISH probe for tRNASer-TGA: AAACCCCAATGGATTTCAA GTCCATCGCCTTAA This paper N/A 5 ′ -Cy3-labeled RNA FISH probe for tRNA-Leu-CAG: AGGGGAGACTGCG ACCTGAACGCAGCGCCTTAG This paper N/A ChIRP probe for tRNA-Ser-TGA: TTAACCACTCGGCCACGACTAC3’-Biotin-TEG This paper N/A ChIRP probe for tRNA-Leu-CAG: TTAACCACTCGGCCACGACTAC3’-Biotin-TEG This paper N/A ChIRP probe for LacZ_Ctrl: GTAGCCAGCTTTCATCAACA3’-Biotin-TEG This paper N/A Deposited Data Total RNA-seq This paper GEO: GSE250284 ChIP-seq and RNA-ChIP This paper GEO: GSE250428, GSE280504 Mass Spectrometry This paper MassIVE: MSV000093657 caRNA-seq This paper SRA: PRJNA1327242 p300 and H3K9me3 ChIP-seq This paper SRA: PRJNA1327242 ATAC-seq This paper SRA: PRJNA1327242 ChIRP-seq This paper SRA: PRJNA1327242 Raw unprocessed data This paper Mendeley https://doi.org/10.17632/ yds5xys2j3.1 Software and algorithms Graph |