Review




Structured Review

Dotmatics Limited graph pad prism 8 0 software
Graph Pad Prism 8 0 Software, supplied by Dotmatics Limited, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/graphing+software/05+7+graph+pad+prism+software+version/pm41376264-97-6-11
Average 86 stars, based on 1 article reviews
graph pad prism 8 0 software - by Bioz Stars, 2026-09
86/100 stars

Images

Related Articles

Software:

Article Title: Tapioca starch nanoparticles loaded with astaxanthin extend the lifespan of Caenorhabditis elegans by activating DAF-16.
Article Snippet: BACKGROUND: Astaxanthin (ASTA) has anti-aging properties but is limited by poor oral bioavailability.. Nanostarch has emerged as a promising carrier to enhance the delivery of bioactive compounds, attracting growing interest in functional food research.. This study prepared ASTA-loaded tapioca starch nanoparticles and characterized their structure.

Article Title: Neuronal toxicity and recovery from early bortezomib-induced neuropathy: blood-nerve barrier dysfunction without dorsal root ganglion damage
Article Snippet: .. All statistical analyses were done using Graph Pad version 9 software (Dotmatics.225 Franklin Street, 26th Floor, Boston, MA 02110, USA.). ..

Article Title: First-line Nivolumab plus FOLFOXIRI/Bevacizumab in advanced RAS/BRAF-mutated colorectal cancer: efficacy, safety and biomarker discovery from the phase II NIVACOR trial
Article Snippet: .. The statistical analyses were made using R Statistical software, version 4.2.2 (R Foundation for Statistical Computing, Vienna, Austria) and Graph Pad Prism v.10 (Dotmatics). ..

other:

Article Title: Metabolic reshaping drives novel melanin production from tryptophan in a cystic fibrosis Pseudomonas aeruginosa clinical isolate
Article Snippet: All the analyses were performed using GRAPH-PAD PRISM version 8.0.2 (Dotmatics, Boston, MA, USA) for Windows.

Article Title: NAT10 promotes cancer metastasis by modulating p300/CBP activity through chromatin-associated tRNA.
Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER tDNA template for in vitro transcription of tRNA-Leu-CAG; Forward:TAATACGAC TCACTATAGTCAGGATGGCCGAGCGG TCTAAGGCGCTGCGTTCAGGTCGC; Reverse:TGGTGTCAGGAGTGGGATTCG AACCCACGCCTCCAGGGGAGACTGCG ACCTGAACGCAGC This paper N/A qRT-PCR primer for U6: Forward: CTCGCTTCGGCAGCACA; Reverse: AACGCTTCACGAATTTGCGT This paper N/A qRT-PCR primer for 5S rRNA: Forward: TCTCGTCTGATCTCGGAAGC; Reverse: AGCCTACAGCACCCGGTATT This paper N/A qRT-PCR primer for Gapdh: Forward: AGGTCGGTGTGAACGGATTTG; Reverse: TGTAGACCATGTAGTTGAGGTCA This paper N/A qRT-PCR primer for Rn7SK: Forward: TCCCCGAATAGAGGAGGACC; Reverse: CAGCGCCTCATTTGGATGTG This paper N/A qRT-PCR primer for tRNA-Ser-TGA: Forward: CGAGTGGTTAAGGCGATGGA; Reverse: CGTAGTCGGCAGGATTCGA This paper N/A qRT-PCR primer for tRNA-Leu-CAG: Forward: AGGATGGCCGAGCGGTCTA; Reverse: GGGATTCGAACCCACGCC This paper N/A 5 ′ -Cy3-labeled RNA FISH probe for tRNASer-TGA: AAACCCCAATGGATTTCAA GTCCATCGCCTTAA This paper N/A 5 ′ -Cy3-labeled RNA FISH probe for tRNA-Leu-CAG: AGGGGAGACTGCG ACCTGAACGCAGCGCCTTAG This paper N/A ChIRP probe for tRNA-Ser-TGA: TTAACCACTCGGCCACGACTAC3’-Biotin-TEG This paper N/A ChIRP probe for tRNA-Leu-CAG: TTAACCACTCGGCCACGACTAC3’-Biotin-TEG This paper N/A ChIRP probe for LacZ_Ctrl: GTAGCCAGCTTTCATCAACA3’-Biotin-TEG This paper N/A Deposited Data Total RNA-seq This paper GEO: GSE250284 ChIP-seq and RNA-ChIP This paper GEO: GSE250428, GSE280504 Mass Spectrometry This paper MassIVE: MSV000093657 caRNA-seq This paper SRA: PRJNA1327242 p300 and H3K9me3 ChIP-seq This paper SRA: PRJNA1327242 ATAC-seq This paper SRA: PRJNA1327242 ChIRP-seq This paper SRA: PRJNA1327242 Raw unprocessed data This paper Mendeley https://doi.org/10.17632/ yds5xys2j3.1 Software and algorithms Graph Pad Prism Version 8 Dotmatics https://www.graphpad.com/features CellPose Python package https://pypi.org/project/cellpose/ N/A ZEN Blue Version 2 Carl Zeiss N/A (Continued on next page) ll OPEN ACCESS Article e7 Molecular Cell 85, 1–19.e1–e18, December 18, 2025



Similar Products

86
Kaleida Health Laboratories kaleida graph software
Kaleida Graph Software, supplied by Kaleida Health Laboratories, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/graphing+software/graph+kaleida/pm42171036-157-26-26
Average 86 stars, based on 1 article reviews
kaleida graph software - by Bioz Stars, 2026-09
86/100 stars
  Buy from Supplier

86
Dotmatics Limited graph pad version 9 software
Graph Pad Version 9 Software, supplied by Dotmatics Limited, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/graphing+software/05+7+graph+pad+prism+software+version/pmc13014509-36-6-11
Average 86 stars, based on 1 article reviews
graph pad version 9 software - by Bioz Stars, 2026-09
86/100 stars
  Buy from Supplier

99
SYSTAT statistical graphing software
Statistical Graphing Software, supplied by SYSTAT, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/graphing+software/SigmaPlot+v14%2E0/pm41618063-31-5-10
Average 99 stars, based on 1 article reviews
statistical graphing software - by Bioz Stars, 2026-09
99/100 stars
  Buy from Supplier

86
Dotmatics Limited graph pad prism 8 0 software
Graph Pad Prism 8 0 Software, supplied by Dotmatics Limited, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/graphing+software/05+7+graph+pad+prism+software+version/pm41376264-97-6-11
Average 86 stars, based on 1 article reviews
graph pad prism 8 0 software - by Bioz Stars, 2026-09
86/100 stars
  Buy from Supplier

86
Dotmatics Limited graph pad prism software version 7 05
Graph Pad Prism Software Version 7 05, supplied by Dotmatics Limited, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/graphing+software/05+7+graph+pad+prism+software+version/pmc12425356-108-0-5
Average 86 stars, based on 1 article reviews
graph pad prism software version 7 05 - by Bioz Stars, 2026-09
86/100 stars
  Buy from Supplier

86
Dotmatics Limited graph pad prism version 10 0 software
Graph Pad Prism Version 10 0 Software, supplied by Dotmatics Limited, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/graphing+software/05+7+graph+pad+prism+software+version/bio_rxiv__2025__10__19__683316-89-23-29
Average 86 stars, based on 1 article reviews
graph pad prism version 10 0 software - by Bioz Stars, 2026-09
86/100 stars
  Buy from Supplier

Image Search Results