Review




Structured Review

Volume Graphics GmbH visualization software vgstudio
Visualization Software Vgstudio, supplied by Volume Graphics GmbH, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/graphical+visualisations/vg+studio+max+2+2/pm15536833-92-17-20
Average 90 stars, based on 1 article reviews
visualization software vgstudio - by Bioz Stars, 2026-09
90/100 stars

Images

Related Articles

other:

Article Title: Differing nodal structure in oat and wheat
Article Snippet: Structural measurements of four oat and four wheat samples were extracted from their micro-CT images using VG Studio MAX 3.2 (Volume Graphics GmbH, Heidelberg, Germany).

Article Title: Adjusting Aspergillus niger pellet diameter, population heterogeneity, and core architecture during shake flask cultivation
Article Snippet: The images were created using VGSTUDIO MAX (version 3.2; Volume Graphics GmbH)

Article Title: Stress–Strain State Investigation and Ultimate Load on Femoral Implants Based on S-Type Ti6Al4V Titanium Alloy
Article Snippet: VGstudio MAX 3.5 (Volume Graphics GmbH, Heidelberg, Germany) software was used for post-processing of the virtual slice sets of samples, resulting in 3D virtual models of each sample.

Article Title: Alveolar type I cells can give rise to KRAS-induced lung adenocarcinoma
Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Experimental models: Organisms/strains Mouse: Gramd2:CreERT2 Applied Stem Cell, Inc. N/A Mouse: Sftpc:CreERT2 Harold Chapman, University of California, San Francisco N/A Mouse: B6.129S4-Krastm4Tyj/J Jackson Laboratories Strain #:008179 Mouse: Gt(ROSA)26Sortm4(ACTBtdTomato,-EGFP)Luo/J Jackson Laboratories Strain #:007576 Oligonucleotides Gramd2-CreERT2 common forward: 50- CTAGTCCTGTCCTCGTCCTATC-30 This paper N/A Gramd2-CreERT2 mutant allele reverse: 50- GGGAAACCATTTCCGGTTATTC-30 This paper N/A Gramd2-CreERT2 WT allele reverse: 50- CACATCCCAGCCTTCTCAAA-30 This paper N/A Sftpc-CreERT2 WT allele forward: 50- TGGTTCCGAGTCCGATTCTTC-30 This paper N/A Sftpc-CreERT2 WT allele reverse: 50- CCTTTTGCTCTGTTCCCCATTA-30 This paper N/A Sftpc-CreERT2 mutant allele forward: 50- TGAGGTTCGCAAGAACCTGATGGA-30 This paper N/A Sftpc-CreERT2 mutant allele reverse: 50- ACCAGCTTGCATGATCTCCGGTAT-30 This paper N/A KRAS-LSL-G12D common reverse: 50- CTGCATAGTACGCTATACCCTGT-30 This paper N/A KRAS-LSL-G12D mutant forward: 50- GCAGGTCGAGGGACCTAATA-30 This paper N/A KRAS-LSL-G12D WT forward: 50-TGTCTTTCCCCAGCACAGT-30 This paper N/A mTmG common reverse: 50-CTTTAAGCCTGCCCAGAA GA -30 This paper N/A mTmG mutant allele forward: 50- TAGAGCTTGCGGAACCCTTC -30 This paper N/A mTmG WT allele forward: 50- AGGGAGCTGCAGTGGAGTAG -30 This paper N/A Software and algorithms VGSTUDIO MAX 3.3.2.170119 (64 bit) Volume Graphics GmbH https://www.volumegraphics.com/en/ products/vgsm/ whats-new-in-vgstudio-max-3-3-x.html Space Ranger pipeline (10x Genomics) 10X GENOMICS https://support.10xgenomics.com/ spatial-gene-expression/software R 4.0.5 R https://www.r-project.org/ R Studio (v 1.4.1717) RStudio https://www.rstudio.com/ Seurat (v4.1.1) Hafemeister et al.53 https://satijalab.org/seurat/ ESTIMATE (v1.0.13) Yoshihara et al.34 https://bioinformatics.mdanderson.org/ estimate/rpackage.html IPA (v 01-20-04) QIAGEN https://digitalinsights.qiagen.com/ products-overview/ discovery-insights-portfolio/ analysis-and-visualization/qiagen-ipa/ Other Zeiss LSM 800 Confocal Laser Scanning Microscope ZEISS N/A (Continued on next page) Cell Reports 42, 113286, December 26, 2023 19 Article ll OPEN ACCESS

Article Title: Apical negative pressure-enhanced sealer infiltration for obturating long oval-shaped root canals with the single-cone technique.
Article Snippet: Objectives: This study evaluated the effect of apical negative pressure sealer infiltration on void percentage, void types, porosity size distribution, and coronal microleakage in root canal fillings using different hydraulic calcium silicate sealers with the single-cone technique.. Methods: Forty-eight extracted premolars with long oval-shaped canals were selected and divided into four groups based on the filling technique and sealer (n = 12): apical negative pressure-assisted NeoSEALER Flo (NPNF), apical negative pressure-assisted iRoot SP (NPS), syringe-assisted NeoSEALER Flo (SNF), and syringe-assisted iRoot SP (SS), all using the single-cone technique.. Micro-computed tomography (10 μm resolution) was used to scan the obturated canals.

Article Title: Differing nodal structure in oat and wheat
Article Snippet: The images were reconstructed using 3D CT Pro 3.3 (Nikon Metrology, Inc., Brighton, MI, USA) and visualized using VG Studio MAX 3.2 (Volume Graphics GmbH, Heidelberg, Germany).

Article Title: Specialist Savvy Versus Generalist Grit: Elucidating the Trade‐Offs in Adaptive Dietary Ecomorphology Amongst African Green and Bush Snakes
Article Snippet: Three‐dimensional surface models of skulls were reconstructed in VGSTUDIO MAX v3.2 (Volume Graphics GmbH, Germany), using a 30–40 μm resolution.

Software:

Article Title: Solid food, compression-molded food powder product, solid milk, and compression-molded powdered milk product having reduced fracture stress
Article Snippet: .. Examples of software can count the number of voxel at the interface include ImageJ (National Institutes of Health (NIH)), DRISHTI (National Computational Infrastructure), VGStudio MAX (Volume Graphics GmbH), and Dragonfly (Object Research Systems). ..



Similar Products

90
RStudio ggplot2: create elegant data visualisations using the grammar of graphics.
Ggplot2: Create Elegant Data Visualisations Using The Grammar Of Graphics., supplied by RStudio, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/graphical+visualisations/ggplot2/pm39833728-274-2-4
Average 90 stars, based on 1 article reviews
ggplot2: create elegant data visualisations using the grammar of graphics. - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

90
RStudio ggplot2: create elegant data visualisations using the grammar of graphics
Ggplot2: Create Elegant Data Visualisations Using The Grammar Of Graphics, supplied by RStudio, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/graphical+visualisations/ggplot2/ppr0576702-316-30-28
Average 90 stars, based on 1 article reviews
ggplot2: create elegant data visualisations using the grammar of graphics - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

90
GraphPad Software Inc graphical visualisations
Graphical Visualisations, supplied by GraphPad Software Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/graphical+visualisations/graphical+visualisations/pmc09637142-184-15-26
Average 90 stars, based on 1 article reviews
graphical visualisations - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

90
SourceForge net molecular graphics visualisation programs rasmol
Molecular Graphics Visualisation Programs Rasmol, supplied by SourceForge net, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/graphical+visualisations/molecular+graphics/10__1530_slash_jme___16___0169-65-11-16
Average 90 stars, based on 1 article reviews
molecular graphics visualisation programs rasmol - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

90
Routledge Ltd visualisation in popular fiction 1860–1960: graphic narratives, fictional images
Visualisation In Popular Fiction 1860–1960: Graphic Narratives, Fictional Images, supplied by Routledge Ltd, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/graphical+visualisations/visualisation+in+popular+fiction+1860+1960++graphic+narratives++fictional+images/10__1017_slash_pli__2016__31-62-91-106
Average 90 stars, based on 1 article reviews
visualisation in popular fiction 1860–1960: graphic narratives, fictional images - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

90
SYSTAT graphical visualisation software sigmaplot 11.0
Graphical Visualisation Software Sigmaplot 11.0, supplied by SYSTAT, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/graphical+visualisations/graphical+visualisation+software+sigmaplot+11+0/pmc05324622-93-5-8
Average 90 stars, based on 1 article reviews
graphical visualisation software sigmaplot 11.0 - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

90
Glaxo Smith rasmol molecular graphics visualisation tool
Rasmol Molecular Graphics Visualisation Tool, supplied by Glaxo Smith, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/graphical+visualisations/rasmol+program/pm21986542-294-1-12
Average 90 stars, based on 1 article reviews
rasmol molecular graphics visualisation tool - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

90
Glaxo Smith rasmol 2.6 molecular graphics visualisation tool
Active site of K69A T. brucei ODC in complex with DFMO. The figure was drawn based on the data of reference 7 using the RasMol 2.6 Molecular Graphics Visualisation tool (Glaxo Wellcome Research & Development Co., Stevenage, Herts., United Kingdom). In reference 7, the N terminus of recombinant T. brucei ODC corresponds to the 21st residue of intact ODC (Fig. ​(Fig.3).3). Residues (V62, T63, P64, D72, and T359) which correspond to the residues mutated in this study and were identified as functionally important for substrate specificity in S. ruminantium LDC are purple and violet. The atoms of PLP are yellow, the atoms of DFMO are green, A69 and C360 are orange, and Y389 and F397, which cradle the aliphatic portion of DFMO, are brown. R277, D332, and D361 are also shown, and nitrogen and oxygen atoms of these residues are blue and red, respectively. The asterisked residues belong to the other subunit of the dimer.
Rasmol 2.6 Molecular Graphics Visualisation Tool, supplied by Glaxo Smith, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/graphical+visualisations/rasmol+version+2+6/pmc00111417-318-13-19
Average 90 stars, based on 1 article reviews
rasmol 2.6 molecular graphics visualisation tool - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

Image Search Results


Active site of K69A T. brucei ODC in complex with DFMO. The figure was drawn based on the data of reference 7 using the RasMol 2.6 Molecular Graphics Visualisation tool (Glaxo Wellcome Research & Development Co., Stevenage, Herts., United Kingdom). In reference 7, the N terminus of recombinant T. brucei ODC corresponds to the 21st residue of intact ODC (Fig. ​(Fig.3).3). Residues (V62, T63, P64, D72, and T359) which correspond to the residues mutated in this study and were identified as functionally important for substrate specificity in S. ruminantium LDC are purple and violet. The atoms of PLP are yellow, the atoms of DFMO are green, A69 and C360 are orange, and Y389 and F397, which cradle the aliphatic portion of DFMO, are brown. R277, D332, and D361 are also shown, and nitrogen and oxygen atoms of these residues are blue and red, respectively. The asterisked residues belong to the other subunit of the dimer.

Journal:

Article Title: Gene Cloning and Molecular Characterization of Lysine Decarboxylase from Selenomonas ruminantium Delineate Its Evolutionary Relationship to Ornithine Decarboxylases from Eukaryotes

doi:

Figure Lengend Snippet: Active site of K69A T. brucei ODC in complex with DFMO. The figure was drawn based on the data of reference 7 using the RasMol 2.6 Molecular Graphics Visualisation tool (Glaxo Wellcome Research & Development Co., Stevenage, Herts., United Kingdom). In reference 7, the N terminus of recombinant T. brucei ODC corresponds to the 21st residue of intact ODC (Fig. ​(Fig.3).3). Residues (V62, T63, P64, D72, and T359) which correspond to the residues mutated in this study and were identified as functionally important for substrate specificity in S. ruminantium LDC are purple and violet. The atoms of PLP are yellow, the atoms of DFMO are green, A69 and C360 are orange, and Y389 and F397, which cradle the aliphatic portion of DFMO, are brown. R277, D332, and D361 are also shown, and nitrogen and oxygen atoms of these residues are blue and red, respectively. The asterisked residues belong to the other subunit of the dimer.

Article Snippet: The figure was drawn based on the data of reference 7 using the RasMol 2.6 Molecular Graphics Visualisation tool (Glaxo Wellcome Research & Development Co., Stevenage, Herts., United Kingdom).

Techniques: Recombinant