Review



goscripttm reverse transcriptase kit a5003  (Promega)

 
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 90

    Structured Review

    Promega goscripttm reverse transcriptase kit a5003
    Goscripttm Reverse Transcriptase Kit A5003, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/goscripttm+reverse+transcriptase+a5003/goscripttm+reverse+transcription+system/pmc09588060-414-13-17
    Average 90 stars, based on 1 article reviews
    goscripttm reverse transcriptase kit a5003 - by Bioz Stars, 2026-09
    90/100 stars

    Images

    Related Articles

    cDNA Synthesis:

    Article Title: Supporting Information for ETV5 promotes lupus pathogenesis and follicular helper T cell differentiation by inducing osteopontin expression
    Article Snippet: .. 200 ng to 2 g of total RNA was subjected to cDNA synthesis using a GoScriptTM Reverse Transcription System (Promega) according to the manufacturer’s instruction. .. SYBR Green real-time PCR master mix (Toyobo) was used for qPCR analysis.

    Article Title: A-to-I mRNA editing recodes hundreds of genes in dozens of species and produces endogenous protein isoforms in bacteria
    Article Snippet: RNA samples were treated with four units of DNase I (NEB, #M0303L) for 20 min at 37°C. .. Finally, following incubation of 15 min at 65°C, cDNA synthesis was done using GoScript Reverse Transcription Mix (Promega, #A2801). .. To synthesize cDNA, 500 ng of total RNA were primed with random hexamers and reverse-transcribed with the GoScript Reverse Transcription Mix Kit (Promega, #A2801) following the manufacturer’s protocol.

    Article Title: Characterization of small nucleolar RNA retaining transcripts in human normal and cancer cells
    Article Snippet: Human XpressRef Universal Total RNA (Qiagen) containing RNA from normal human tissues from various origin was used to provide a context of general physiological baseline of snoRTs expression in normal human tissue. .. Total RNA was extracted from cell lines and tissue samples by using the miRNeasy Mini kit (Qiagen) according to manufacturer's guidelines. cDNA was obtained by reverse transcribing 500 ng of RNA using GoScript cDNA synthesis kit (Promega) at 50 °C according to the standard instructions provided by the manufacturer. ..

    Reverse Transcription:

    Article Title: Supporting Information for ETV5 promotes lupus pathogenesis and follicular helper T cell differentiation by inducing osteopontin expression
    Article Snippet: .. 200 ng to 2 g of total RNA was subjected to cDNA synthesis using a GoScriptTM Reverse Transcription System (Promega) according to the manufacturer’s instruction. .. SYBR Green real-time PCR master mix (Toyobo) was used for qPCR analysis.

    Article Title: A-to-I mRNA editing recodes hundreds of genes in dozens of species and produces endogenous protein isoforms in bacteria
    Article Snippet: RNA samples were treated with four units of DNase I (NEB, #M0303L) for 20 min at 37°C. .. Finally, following incubation of 15 min at 65°C, cDNA synthesis was done using GoScript Reverse Transcription Mix (Promega, #A2801). .. To synthesize cDNA, 500 ng of total RNA were primed with random hexamers and reverse-transcribed with the GoScript Reverse Transcription Mix Kit (Promega, #A2801) following the manufacturer’s protocol.

    Article Title: Supporting Information for Liver cancer development driven by the AP-1/c-Jun~Fra-2 dimer through c- Myc
    Article Snippet: .. RNA isolation and quantitative reverse transcription-PCR (qRT-PCR) Total RNA was isolated using TRI Reagent (Sigma-Aldrich), complementary DNA was synthesized using Ready-To-Go-You-Prime-First-Strand Beads (GE Healthcare) or GoScriptTM Reverse Transcription Mix, Oligo(dT) (Promega) and quantitative PCR was performed using GoTaq qPCR Master Mix (Promega) and Eppendorf fluorescence thermocyclers with duplicate reactions and two housekeeping genes (Rpl4 and Rps29) per run. ..

    Article Title: Atractylenolide I inhibits the growth, proliferation and migration of B16 melanoma cells via the PI3K/AKT/mTOR pathway.
    Article Snippet: Total RNA was isolated from B16 cells and A875 using TRIzol reagent according to the manufacturer's instruc‐ tions (Invitrogen; Thermo Fisher Scientific, Inc.). .. Reverse Transcription was performed with the GoScriptTM Reverse Transcription kit (Promega Corporation) according to the manufacturer's instructions. ..

    Article Title: RNA activation of CEBPA improves leukemia treatment
    Article Snippet: Total RNA was extracted with Monarch Total RNA Miniprep Kit (New England BioLabs) from at least 500,000 cells and quantified using a BioSpectrometer Fluorescence (Eppendorf) according to manufacturer’s instruction. .. GoScript Reverse Transcription Mix, Oligo(dT) (Promega) was used for reverse transcription of 5–20 ng/mL of RNA to cDNA in a 20 μL reaction. .. 2x TaqMan Fast Advanced Master Mix (Thermo Fisher Scientific) and 60x TaqMan Gene Expression Assays (Thermo Fisher Scientific) were used for real-time quantitative PCR analysis to quantify expression levels of CEBPA (Hs00269972_s1), SPI1 (Hs02786711_m1), FLT3 (Hs00174690_m1), GAPDH (Hs02786624_g1), and HPRT1 (Hs02800695_m1). qPCR was conducted using CFX96 Real-Time System (Bio-Rad) and C1000 Touch Thermal Cycler (Bio-Rad).

    Incubation:

    Article Title: A-to-I mRNA editing recodes hundreds of genes in dozens of species and produces endogenous protein isoforms in bacteria
    Article Snippet: RNA samples were treated with four units of DNase I (NEB, #M0303L) for 20 min at 37°C. .. Finally, following incubation of 15 min at 65°C, cDNA synthesis was done using GoScript Reverse Transcription Mix (Promega, #A2801). .. To synthesize cDNA, 500 ng of total RNA were primed with random hexamers and reverse-transcribed with the GoScript Reverse Transcription Mix Kit (Promega, #A2801) following the manufacturer’s protocol.

    Isolation:

    Article Title: Supporting Information for Liver cancer development driven by the AP-1/c-Jun~Fra-2 dimer through c- Myc
    Article Snippet: .. RNA isolation and quantitative reverse transcription-PCR (qRT-PCR) Total RNA was isolated using TRI Reagent (Sigma-Aldrich), complementary DNA was synthesized using Ready-To-Go-You-Prime-First-Strand Beads (GE Healthcare) or GoScriptTM Reverse Transcription Mix, Oligo(dT) (Promega) and quantitative PCR was performed using GoTaq qPCR Master Mix (Promega) and Eppendorf fluorescence thermocyclers with duplicate reactions and two housekeeping genes (Rpl4 and Rps29) per run. ..

    Synthesized:

    Article Title: Supporting Information for Liver cancer development driven by the AP-1/c-Jun~Fra-2 dimer through c- Myc
    Article Snippet: .. RNA isolation and quantitative reverse transcription-PCR (qRT-PCR) Total RNA was isolated using TRI Reagent (Sigma-Aldrich), complementary DNA was synthesized using Ready-To-Go-You-Prime-First-Strand Beads (GE Healthcare) or GoScriptTM Reverse Transcription Mix, Oligo(dT) (Promega) and quantitative PCR was performed using GoTaq qPCR Master Mix (Promega) and Eppendorf fluorescence thermocyclers with duplicate reactions and two housekeeping genes (Rpl4 and Rps29) per run. ..

    Real-time Polymerase Chain Reaction:

    Article Title: Supporting Information for Liver cancer development driven by the AP-1/c-Jun~Fra-2 dimer through c- Myc
    Article Snippet: .. RNA isolation and quantitative reverse transcription-PCR (qRT-PCR) Total RNA was isolated using TRI Reagent (Sigma-Aldrich), complementary DNA was synthesized using Ready-To-Go-You-Prime-First-Strand Beads (GE Healthcare) or GoScriptTM Reverse Transcription Mix, Oligo(dT) (Promega) and quantitative PCR was performed using GoTaq qPCR Master Mix (Promega) and Eppendorf fluorescence thermocyclers with duplicate reactions and two housekeeping genes (Rpl4 and Rps29) per run. ..

    Fluorescence:

    Article Title: Supporting Information for Liver cancer development driven by the AP-1/c-Jun~Fra-2 dimer through c- Myc
    Article Snippet: .. RNA isolation and quantitative reverse transcription-PCR (qRT-PCR) Total RNA was isolated using TRI Reagent (Sigma-Aldrich), complementary DNA was synthesized using Ready-To-Go-You-Prime-First-Strand Beads (GE Healthcare) or GoScriptTM Reverse Transcription Mix, Oligo(dT) (Promega) and quantitative PCR was performed using GoTaq qPCR Master Mix (Promega) and Eppendorf fluorescence thermocyclers with duplicate reactions and two housekeeping genes (Rpl4 and Rps29) per run. ..

    Transfection:

    Article Title: Characterization of Variants of Uncertain Significance in ACADVL Gene From a Very–Long‐Chain Acyl‐ CoA Dehydrogenase Deficiency Patient
    Article Snippet: .. Total RNA was extracted from 293T and HeLa cells after transfection and was reverse transcribed to cDNA using the GoScript Reverse Transcription System kit (Promega). .. QPCR was performed on the ABI QuantStudio5 system using the SYBR Green Realtime PCR Master Mix kit ( ACADVL ‐qPCR‐F, AGATTACGCTGGATCCGCTA, ACADVL ‐qPCR‐R, AGGGGTGGGAATCTGACTTG, Thermo).

    other:

    Article Title: Supporting Information for PHGDH preserves one-carbon cycle to confer metabolic plasticity in chemo-resistant gastric cancer during nutrient stress
    Article Snippet: The amount of RNA was determined using a NanoDrop (Thermo and cDNA was synthesized from 2ug RNA with GoScriptTM Reverse Transcriptase (Promega, A5003).



    Similar Products

    90
    Promega goscripttm reverse transcriptase a5003
    Goscripttm Reverse Transcriptase A5003, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/goscripttm+reverse+transcriptase+a5003/goscripttm+reverse+transcription+system/pmc10214193__pnas__2217826120__sapp-118-3-21
    Average 90 stars, based on 1 article reviews
    goscripttm reverse transcriptase a5003 - by Bioz Stars, 2026-09
    90/100 stars
      Buy from Supplier

    90
    Promega goscripttm reverse transcriptase promega a5003
    Goscripttm Reverse Transcriptase Promega A5003, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/goscripttm+reverse+transcriptase+a5003/goscripttm+reverse+transcription+system/pm40258819-234-7-10
    Average 90 stars, based on 1 article reviews
    goscripttm reverse transcriptase promega a5003 - by Bioz Stars, 2026-09
    90/100 stars
      Buy from Supplier

    90
    Promega goscripttm reverse transcriptase cat. no. a5003
    Goscripttm Reverse Transcriptase Cat. No. A5003, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/goscripttm+reverse+transcriptase+a5003/goscripttm+reverse+transcription+system/10__3390_slash_horticulturae10040403-75-26-32
    Average 90 stars, based on 1 article reviews
    goscripttm reverse transcriptase cat. no. a5003 - by Bioz Stars, 2026-09
    90/100 stars
      Buy from Supplier

    90
    Promega goscripttm reverse transcriptase kit a5003
    Goscripttm Reverse Transcriptase Kit A5003, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/goscripttm+reverse+transcriptase+a5003/goscripttm+reverse+transcription+system/pmc09588060-414-13-17
    Average 90 stars, based on 1 article reviews
    goscripttm reverse transcriptase kit a5003 - by Bioz Stars, 2026-09
    90/100 stars
      Buy from Supplier

    Image Search Results