firefly luciferase gene sequence gl3 (Promega)
90
Structured Review
Promega
firefly luciferase gene sequence gl3
Firefly Luciferase Gene Sequence Gl3, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/gl3+sequence/firefly+luciferase+coding+sequence/pm24854846-67-1-5
Average 90 stars, based on 1 article reviews
Firefly Luciferase Gene Sequence Gl3, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/gl3+sequence/firefly+luciferase+coding+sequence/pm24854846-67-1-5
Average 90 stars, based on 1 article reviews
firefly luciferase gene sequence gl3 - by Bioz Stars,
2026-11
90/100 stars
Images
Related Articles
Produced:Article Title: Argonaute 2 targets viral transcripts but not genomes of RNA viruses during antiviral RNA interference in Drosophila. Article Snippet: Primer sequences are provided in S1 Table. dsRNA constructions and treatments In vitro transcription was done using T7/SP6 MEGAscript Kits (Ambion), following the manufacturer’s instructions. .. Briefly, dsRNAs targeting viral sequences were produced from a T7 promoter sequences obtained by PCR amplification from TOPO plasmid (Thermo PLOS Pathogens | https://doi.org/10.1371/journal.ppat.1012184 February 3, 2025 9 / 14 #K4575J10) containing purified PCR product corresponding to N region of VSV gene (region: 427–962) or to nsP4 region of SINV gene (region: 5,920–6,424). dsFluc and dsGFP were produced from a T7 and SP6 promoters sequences containing the Polymerase Chain Reaction:Article Title: Argonaute 2 targets viral transcripts but not genomes of RNA viruses during antiviral RNA interference in Drosophila. Article Snippet: Primer sequences are provided in S1 Table. dsRNA constructions and treatments In vitro transcription was done using T7/SP6 MEGAscript Kits (Ambion), following the manufacturer’s instructions. .. Briefly, dsRNAs targeting viral sequences were produced from a T7 promoter sequences obtained by PCR amplification from TOPO plasmid (Thermo PLOS Pathogens | https://doi.org/10.1371/journal.ppat.1012184 February 3, 2025 9 / 14 #K4575J10) containing purified PCR product corresponding to N region of VSV gene (region: 427–962) or to nsP4 region of SINV gene (region: 5,920–6,424). dsFluc and dsGFP were produced from a T7 and SP6 promoters sequences containing the Amplification:Article Title: Argonaute 2 targets viral transcripts but not genomes of RNA viruses during antiviral RNA interference in Drosophila. Article Snippet: Primer sequences are provided in S1 Table. dsRNA constructions and treatments In vitro transcription was done using T7/SP6 MEGAscript Kits (Ambion), following the manufacturer’s instructions. .. Briefly, dsRNAs targeting viral sequences were produced from a T7 promoter sequences obtained by PCR amplification from TOPO plasmid (Thermo PLOS Pathogens | https://doi.org/10.1371/journal.ppat.1012184 February 3, 2025 9 / 14 #K4575J10) containing purified PCR product corresponding to N region of VSV gene (region: 427–962) or to nsP4 region of SINV gene (region: 5,920–6,424). dsFluc and dsGFP were produced from a T7 and SP6 promoters sequences containing the Article Title: High-Throughput Screening to Identify Novel Compounds Affecting the Genome Editing Efficiency of CRISPR System. Article Snippet: The CMV promoter was amplified with primers (the F primer was CMV-SSA-1F and the R primer was CMV-SSA-1R) from lentiCRISPR v2 (Addgene, Watertown, MA, USA, cat. no. 52961). .. The first part of the firefly Article Title: High-Throughput Screening to Identify Novel Compounds Affecting the Genome Editing Efficiency of CRISPR System. Article Snippet: These three fragments were linked together using overlap PCR with primers (CMV-SSA-1F and B3R) and inserted into pEASY®-T5 Zero, named vector-21. .. The second part of the firefly Article Title: High-Throughput Screening to Identify Novel Compounds Affecting the Genome Editing Efficiency of CRISPR System Article Snippet: .. The second part of the firefly Plasmid Preparation:Article Title: Argonaute 2 targets viral transcripts but not genomes of RNA viruses during antiviral RNA interference in Drosophila. Article Snippet: Primer sequences are provided in S1 Table. dsRNA constructions and treatments In vitro transcription was done using T7/SP6 MEGAscript Kits (Ambion), following the manufacturer’s instructions. .. Briefly, dsRNAs targeting viral sequences were produced from a T7 promoter sequences obtained by PCR amplification from TOPO plasmid (Thermo PLOS Pathogens | https://doi.org/10.1371/journal.ppat.1012184 February 3, 2025 9 / 14 #K4575J10) containing purified PCR product corresponding to N region of VSV gene (region: 427–962) or to nsP4 region of SINV gene (region: 5,920–6,424). dsFluc and dsGFP were produced from a T7 and SP6 promoters sequences containing the Article Title: Regulatory nucleic acid molecules for enhancing constitutive gene expression in plants Article Snippet: .. 6.1 Vector Construction For analyzing NEENA sequences with SEQ ID NO 1 and 2 in monocotyledonous plants quantitatively, a pUC-based expression vector harboring an expression cassette composed of the NEENA-less, constitutive monocotyledonous promoter p-Ubi from Z. mais was combined with a Article Title: Regulatory nucleic acid molecules for enhancing constitutive gene expression in plants Article Snippet: .. TABLE 3 Primer sequences (p-AtNit1) SEQ ID Primer name Sequence NO. p-AtNit1-for ggggacaactttgtatagaaaagttg 58 tcgagaccagatgttttacacttga p-AtNit1-rev ggggactgcttttttgtacaaacttg 59 gacactcagagacttgagagaagca An ENTR/B vector containing the firefly Purification:Article Title: Argonaute 2 targets viral transcripts but not genomes of RNA viruses during antiviral RNA interference in Drosophila. Article Snippet: Primer sequences are provided in S1 Table. dsRNA constructions and treatments In vitro transcription was done using T7/SP6 MEGAscript Kits (Ambion), following the manufacturer’s instructions. .. Briefly, dsRNAs targeting viral sequences were produced from a T7 promoter sequences obtained by PCR amplification from TOPO plasmid (Thermo PLOS Pathogens | https://doi.org/10.1371/journal.ppat.1012184 February 3, 2025 9 / 14 #K4575J10) containing purified PCR product corresponding to N region of VSV gene (region: 427–962) or to nsP4 region of SINV gene (region: 5,920–6,424). dsFluc and dsGFP were produced from a T7 and SP6 promoters sequences containing the Luciferase:Article Title: Argonaute 2 targets viral transcripts but not genomes of RNA viruses during antiviral RNA interference in Drosophila. Article Snippet: Primer sequences are provided in S1 Table. dsRNA constructions and treatments In vitro transcription was done using T7/SP6 MEGAscript Kits (Ambion), following the manufacturer’s instructions. .. Briefly, dsRNAs targeting viral sequences were produced from a T7 promoter sequences obtained by PCR amplification from TOPO plasmid (Thermo PLOS Pathogens | https://doi.org/10.1371/journal.ppat.1012184 February 3, 2025 9 / 14 #K4575J10) containing purified PCR product corresponding to N region of VSV gene (region: 427–962) or to nsP4 region of SINV gene (region: 5,920–6,424). dsFluc and dsGFP were produced from a T7 and SP6 promoters sequences containing the Article Title: High-Throughput Screening to Identify Novel Compounds Affecting the Genome Editing Efficiency of CRISPR System. Article Snippet: The CMV promoter was amplified with primers (the F primer was CMV-SSA-1F and the R primer was CMV-SSA-1R) from lentiCRISPR v2 (Addgene, Watertown, MA, USA, cat. no. 52961). .. The first part of the firefly Article Title: High-Throughput Screening to Identify Novel Compounds Affecting the Genome Editing Efficiency of CRISPR System. Article Snippet: These three fragments were linked together using overlap PCR with primers (CMV-SSA-1F and B3R) and inserted into pEASY®-T5 Zero, named vector-21. .. The second part of the firefly Article Title: High-Throughput Screening to Identify Novel Compounds Affecting the Genome Editing Efficiency of CRISPR System Article Snippet: .. The second part of the firefly Article Title: Short internal open reading frames repress the translation of N-terminally truncated proteoforms Article Snippet: The PCR products were then subcloned into pcDNA3.1-TRIP6-HA. pcDNA3.1-TRIP6-weak iuAUG-HA was obtained by introducing a double-stranded oligonucleotide (GGGGGCCTACTTGGGTGGctttttATGtaACACCCcagcgcctgca) into pcDNA3.1-TRIP6-HA linearized with BamHI using In-Fusion cloning (Takara Bio Europe, Saint-Germain-en-Laye, France). pcDNA3.1-weak AUG1-TRIP6-weak iuAUG -HA was obtained by subcloning the NheI/KpnI fragment of pcDNA3.1-weak AUG1-TRIP6-HA into pcDNA3.1-TRIP6-weak iuAUG-HA. pcDNA3.1-TRIP6-iuORF-5nt-AUG2-HA and pcDNA3.1-TRIP6-iuORF-50nt-AUG2-HA, in which the intercistronic distance between the iuORF stop and AUG2 has been decreased to 5 nucleotides and increased to 50 nucleotides, respectively, were obtained by subcloning the respective string DNA fragment between the BamHI and SacII sites of pcDNA3.1-TRIP6-HA. .. The reporter construct to assess the effectiveness of the PNA targeting AUG2 in Trip6 mRNA, pcDNA3.1-PNA-target-Luciferase was cloned as follows: the firefly Article Title: Regulatory nucleic acid molecules for enhancing constitutive gene expression in plants Article Snippet: .. 6.1 Vector Construction For analyzing NEENA sequences with SEQ ID NO 1 and 2 in monocotyledonous plants quantitatively, a pUC-based expression vector harboring an expression cassette composed of the NEENA-less, constitutive monocotyledonous promoter p-Ubi from Z. mais was combined with a Article Title: Regulatory nucleic acid molecules for enhancing constitutive gene expression in plants Article Snippet: .. TABLE 3 Primer sequences (p-AtNit1) SEQ ID Primer name Sequence NO. p-AtNit1-for ggggacaactttgtatagaaaagttg 58 tcgagaccagatgttttacacttga p-AtNit1-rev ggggactgcttttttgtacaaacttg 59 gacactcagagacttgagagaagca An ENTR/B vector containing the firefly Sequencing:Article Title: Argonaute 2 targets viral transcripts but not genomes of RNA viruses during antiviral RNA interference in Drosophila. Article Snippet: Primer sequences are provided in S1 Table. dsRNA constructions and treatments In vitro transcription was done using T7/SP6 MEGAscript Kits (Ambion), following the manufacturer’s instructions. .. Briefly, dsRNAs targeting viral sequences were produced from a T7 promoter sequences obtained by PCR amplification from TOPO plasmid (Thermo PLOS Pathogens | https://doi.org/10.1371/journal.ppat.1012184 February 3, 2025 9 / 14 #K4575J10) containing purified PCR product corresponding to N region of VSV gene (region: 427–962) or to nsP4 region of SINV gene (region: 5,920–6,424). dsFluc and dsGFP were produced from a T7 and SP6 promoters sequences containing the Article Title: Short internal open reading frames repress the translation of N-terminally truncated proteoforms Article Snippet: The PCR products were then subcloned into pcDNA3.1-TRIP6-HA. pcDNA3.1-TRIP6-weak iuAUG-HA was obtained by introducing a double-stranded oligonucleotide (GGGGGCCTACTTGGGTGGctttttATGtaACACCCcagcgcctgca) into pcDNA3.1-TRIP6-HA linearized with BamHI using In-Fusion cloning (Takara Bio Europe, Saint-Germain-en-Laye, France). pcDNA3.1-weak AUG1-TRIP6-weak iuAUG -HA was obtained by subcloning the NheI/KpnI fragment of pcDNA3.1-weak AUG1-TRIP6-HA into pcDNA3.1-TRIP6-weak iuAUG-HA. pcDNA3.1-TRIP6-iuORF-5nt-AUG2-HA and pcDNA3.1-TRIP6-iuORF-50nt-AUG2-HA, in which the intercistronic distance between the iuORF stop and AUG2 has been decreased to 5 nucleotides and increased to 50 nucleotides, respectively, were obtained by subcloning the respective string DNA fragment between the BamHI and SacII sites of pcDNA3.1-TRIP6-HA. .. The reporter construct to assess the effectiveness of the PNA targeting AUG2 in Trip6 mRNA, pcDNA3.1-PNA-target-Luciferase was cloned as follows: the firefly Article Title: Regulatory nucleic acid molecules for enhancing constitutive gene expression in plants Article Snippet: .. 6.1 Vector Construction For analyzing NEENA sequences with SEQ ID NO 1 and 2 in monocotyledonous plants quantitatively, a pUC-based expression vector harboring an expression cassette composed of the NEENA-less, constitutive monocotyledonous promoter p-Ubi from Z. mais was combined with a Article Title: Regulatory nucleic acid molecules for enhancing constitutive gene expression in plants Article Snippet: .. TABLE 3 Primer sequences (p-AtNit1) SEQ ID Primer name Sequence NO. p-AtNit1-for ggggacaactttgtatagaaaagttg 58 tcgagaccagatgttttacacttga p-AtNit1-rev ggggactgcttttttgtacaaacttg 59 gacactcagagacttgagagaagca An ENTR/B vector containing the firefly Construct:Article Title: Short internal open reading frames repress the translation of N-terminally truncated proteoforms Article Snippet: The PCR products were then subcloned into pcDNA3.1-TRIP6-HA. pcDNA3.1-TRIP6-weak iuAUG-HA was obtained by introducing a double-stranded oligonucleotide (GGGGGCCTACTTGGGTGGctttttATGtaACACCCcagcgcctgca) into pcDNA3.1-TRIP6-HA linearized with BamHI using In-Fusion cloning (Takara Bio Europe, Saint-Germain-en-Laye, France). pcDNA3.1-weak AUG1-TRIP6-weak iuAUG -HA was obtained by subcloning the NheI/KpnI fragment of pcDNA3.1-weak AUG1-TRIP6-HA into pcDNA3.1-TRIP6-weak iuAUG-HA. pcDNA3.1-TRIP6-iuORF-5nt-AUG2-HA and pcDNA3.1-TRIP6-iuORF-50nt-AUG2-HA, in which the intercistronic distance between the iuORF stop and AUG2 has been decreased to 5 nucleotides and increased to 50 nucleotides, respectively, were obtained by subcloning the respective string DNA fragment between the BamHI and SacII sites of pcDNA3.1-TRIP6-HA. .. The reporter construct to assess the effectiveness of the PNA targeting AUG2 in Trip6 mRNA, pcDNA3.1-PNA-target-Luciferase was cloned as follows: the firefly Clone Assay:Article Title: Short internal open reading frames repress the translation of N-terminally truncated proteoforms Article Snippet: The PCR products were then subcloned into pcDNA3.1-TRIP6-HA. pcDNA3.1-TRIP6-weak iuAUG-HA was obtained by introducing a double-stranded oligonucleotide (GGGGGCCTACTTGGGTGGctttttATGtaACACCCcagcgcctgca) into pcDNA3.1-TRIP6-HA linearized with BamHI using In-Fusion cloning (Takara Bio Europe, Saint-Germain-en-Laye, France). pcDNA3.1-weak AUG1-TRIP6-weak iuAUG -HA was obtained by subcloning the NheI/KpnI fragment of pcDNA3.1-weak AUG1-TRIP6-HA into pcDNA3.1-TRIP6-weak iuAUG-HA. pcDNA3.1-TRIP6-iuORF-5nt-AUG2-HA and pcDNA3.1-TRIP6-iuORF-50nt-AUG2-HA, in which the intercistronic distance between the iuORF stop and AUG2 has been decreased to 5 nucleotides and increased to 50 nucleotides, respectively, were obtained by subcloning the respective string DNA fragment between the BamHI and SacII sites of pcDNA3.1-TRIP6-HA. .. The reporter construct to assess the effectiveness of the PNA targeting AUG2 in Trip6 mRNA, pcDNA3.1-PNA-target-Luciferase was cloned as follows: the firefly Expressing:Article Title: Regulatory nucleic acid molecules for enhancing constitutive gene expression in plants Article Snippet: .. 6.1 Vector Construction For analyzing NEENA sequences with SEQ ID NO 1 and 2 in monocotyledonous plants quantitatively, a pUC-based expression vector harboring an expression cassette composed of the NEENA-less, constitutive monocotyledonous promoter p-Ubi from Z. mais was combined with a other:Article Title: Short internal open reading frames repress the translation of N-terminally truncated proteoforms. Article Snippet: In pcDNA3.1-TRIP6-HA the mouse Trip6 CDS with a C-terminal HA epitope was cloned by PCR between the NheI and EcoRI sites of pcDNA3.1 (Invitrogen, Karlsruhe, Germany). Generated:Article Title: Regulatory nucleic acid molecules for enhancing constitutive gene expression in plants Article Snippet: .. TABLE 3 Primer sequences (p-AtNit1) SEQ ID Primer name Sequence NO. p-AtNit1-for ggggacaactttgtatagaaaagttg 58 tcgagaccagatgttttacacttga p-AtNit1-rev ggggactgcttttttgtacaaacttg 59 gacactcagagacttgagagaagca An ENTR/B vector containing the firefly |
