cells direct one step qrt pcr kit (Thermo Fisher)

Thermo Fisher is a verified supplier

Thermo Fisher manufactures this product

About

News

Press Release

Team

Advisors

Partners

Contact

Bioz Stars

Bioz vStars

Buy from Supplier

Structured Review

Thermo Fisher cells direct one step qrt pcr kit

Loss of Shh-Brain-Enhancer Proximity during Neuronal Differentiation (A) Map of the Shh regulatory domain showing the genes (black boxes), enhancers (green bars), and fosmid FISH probes (gray boxes). Probe and enhancer coordinates are listed in . (B) Violin plots showing the distribution of inter-probe distances (μm) between Shh and SBE6, SBE4, SBE2/3, ZRS, and CTRL probes in the nuclei of ESCs and D7 NPCs. Distances below the dotted horizontal line at 0.2 μm are considered co-localized. The asterisks on the FISH data represent Mann-Whitney U test significance between ESC and NPC populations. ∗∗ p < 0.01. Each violin plot represents one biological replicate; for other replicates and statistics, see <xref ref-type=

cells direct one step qrt pcr kit - by Bioz Stars, 2026-09

96/100 stars

Images

1) Product Images from "Decreased Enhancer-Promoter Proximity Accompanying Enhancer Activation"

Article Title: Decreased Enhancer-Promoter Proximity Accompanying Enhancer Activation

Journal: Molecular Cell

doi: 10.1016/j.molcel.2019.07.038

Figure S1 and . (C) 3D-SIM images illustrating Shh -SBE6 separation in ESCs or in D7 NPCs. Scales bars are 5 μm (top two rows) and 1 μm (bottom, inset from center row). (D) Shh , Oct4 , and Nestin expression assayed by qRT-PCR during a time course of NPC differentiation. The graph shows mean (±SEM) log2 mRNA levels relative to Gapdh and normalized to the level in ESC (three technical replicates). (E) Violin plots showing Shh -SBE6 inter-probe distances in cell populations corresponding to the expression data in (D). (F) Kernel density plots showing Shh mRNA expression in single NPCs relative to Gapdh and normalized to the expression in ESC. Density is an arbitrary unit based on the frequency of the occurrence and the total counts and the size of the population (i.e., the binning of the data). Data from a biological replicate are shown in Figure S1 B. " title="... , Oct4 , and Nestin expression assayed by qRT-PCR during a time course of NPC differentiation. The ..." property="contentUrl" width="100%" height="100%"/>
Figure Legend Snippet: Loss of Shh-Brain-Enhancer Proximity during Neuronal Differentiation (A) Map of the Shh regulatory domain showing the genes (black boxes), enhancers (green bars), and fosmid FISH probes (gray boxes). Probe and enhancer coordinates are listed in . (B) Violin plots showing the distribution of inter-probe distances (μm) between Shh and SBE6, SBE4, SBE2/3, ZRS, and CTRL probes in the nuclei of ESCs and D7 NPCs. Distances below the dotted horizontal line at 0.2 μm are considered co-localized. The asterisks on the FISH data represent Mann-Whitney U test significance between ESC and NPC populations. ∗∗ p < 0.01. Each violin plot represents one biological replicate; for other replicates and statistics, see Figure S1 and . (C) 3D-SIM images illustrating Shh -SBE6 separation in ESCs or in D7 NPCs. Scales bars are 5 μm (top two rows) and 1 μm (bottom, inset from center row). (D) Shh , Oct4 , and Nestin expression assayed by qRT-PCR during a time course of NPC differentiation. The graph shows mean (±SEM) log2 mRNA levels relative to Gapdh and normalized to the level in ESC (three technical replicates). (E) Violin plots showing Shh -SBE6 inter-probe distances in cell populations corresponding to the expression data in (D). (F) Kernel density plots showing Shh mRNA expression in single NPCs relative to Gapdh and normalized to the expression in ESC. Density is an arbitrary unit based on the frequency of the occurrence and the total counts and the size of the population (i.e., the binning of the data). Data from a biological replicate are shown in Figure S1 B.

Techniques Used: MANN-WHITNEY, Expressing, Quantitative RT-PCR

Synthetic Activation of Shh and Increased Enhancer-Promoter Separation Using TALE-VP16 (A) Schematic of TALE-VP64 and TALE-VP128 constructs targeting the Shh promoter (tShh), SBE6, or SBE2. Repeat variable diresidue (RVD) code is displayed with one-letter abbreviations for amino acids. Self-cleaving (2A) peptide allows the expression of eGFP and cell isolation by fluorescence-activated cell sorting (FACS). A map of the targeting sites is shown at right. (B) Log2 mRNA levels of Shh, relative to Gapdh, assayed by qRT-PCR after TALE-VP64/128 expression in ESCs. Data show means (±SEMs) of three biological replicates normalized to ESCs expressing a control eGFP. (C) Violin plots representing one biological replicate of Shh-SBE6 inter-probe distances (μm) in ESCs expressing control eGFP, TALE-VP128 fusions targeting Shh promoter (tShh), SBE6, or SBE2. ∗∗ p < 0.01. Statistical data and replicate experiments are in . Distances below the dotted horizontal line at 0.2 μm are considered co-localized. (D) As in (C), but for VP64 recruitment to both SBE6 and SBE2 simultaneously (tSBE6+2), or a TALE with no fusion protein (tSBE6+2)-Δ. ∗∗ p < 0.01. Representative FISH images with probes for Shh (green) and SBE6 (red) in mESCs expressing tSBE(6+2)-VP64 and tSBE(6+2)-Δ are shown at right. (E) 5C heatmaps of the Shh regulatory region (chr5:28604000-29780000) with 16 kb binning and smoothing for ESCs and for ESCs expressing TALE-VP64 fusions targeting both SBE6 and SBE2. Difference 5C plots are shown above the main 5C plots. (F) Schematic representing TALE-LDB1 targeting sequences. (G) Three-color FISH with probes for Shh (green), SBE6 (magenta), and SBE2 (red) in mESCs expressing tShh-LDB1+tSBE2-LDB1. (H) Violin plots displaying Shh and SBE6 inter-probe distances (μm) in ESCs expressing eGFP or tShh-LDB1+tSBE6-LDB1. ∗∗ p < 0.01. (I) As in (H), but in cells expressing tShh-LDB1+tSBE2-LDB1. Shh-SBE6 distances are shown in the left-hand panel, and Shh-SBE2 distances are in the right-hand panel. ∗∗ p < 0.01. Statistical data relating to this figure are included in .

Figure Legend Snippet: Synthetic Activation of Shh and Increased Enhancer-Promoter Separation Using TALE-VP16 (A) Schematic of TALE-VP64 and TALE-VP128 constructs targeting the Shh promoter (tShh), SBE6, or SBE2. Repeat variable diresidue (RVD) code is displayed with one-letter abbreviations for amino acids. Self-cleaving (2A) peptide allows the expression of eGFP and cell isolation by fluorescence-activated cell sorting (FACS). A map of the targeting sites is shown at right. (B) Log2 mRNA levels of Shh, relative to Gapdh, assayed by qRT-PCR after TALE-VP64/128 expression in ESCs. Data show means (±SEMs) of three biological replicates normalized to ESCs expressing a control eGFP. (C) Violin plots representing one biological replicate of Shh-SBE6 inter-probe distances (μm) in ESCs expressing control eGFP, TALE-VP128 fusions targeting Shh promoter (tShh), SBE6, or SBE2. ∗∗ p < 0.01. Statistical data and replicate experiments are in . Distances below the dotted horizontal line at 0.2 μm are considered co-localized. (D) As in (C), but for VP64 recruitment to both SBE6 and SBE2 simultaneously (tSBE6+2), or a TALE with no fusion protein (tSBE6+2)-Δ. ∗∗ p < 0.01. Representative FISH images with probes for Shh (green) and SBE6 (red) in mESCs expressing tSBE(6+2)-VP64 and tSBE(6+2)-Δ are shown at right. (E) 5C heatmaps of the Shh regulatory region (chr5:28604000-29780000) with 16 kb binning and smoothing for ESCs and for ESCs expressing TALE-VP64 fusions targeting both SBE6 and SBE2. Difference 5C plots are shown above the main 5C plots. (F) Schematic representing TALE-LDB1 targeting sequences. (G) Three-color FISH with probes for Shh (green), SBE6 (magenta), and SBE2 (red) in mESCs expressing tShh-LDB1+tSBE2-LDB1. (H) Violin plots displaying Shh and SBE6 inter-probe distances (μm) in ESCs expressing eGFP or tShh-LDB1+tSBE6-LDB1. ∗∗ p < 0.01. (I) As in (H), but in cells expressing tShh-LDB1+tSBE2-LDB1. Shh-SBE6 distances are shown in the left-hand panel, and Shh-SBE2 distances are in the right-hand panel. ∗∗ p < 0.01. Statistical data relating to this figure are included in .

Techniques Used: Activation Assay, Construct, Expressing, Cell Isolation, Fluorescence, FACS, Quantitative RT-PCR

Figure Legend Snippet:

Techniques Used: Modification, Recombinant, Protease Inhibitor, Transfection, SYBR Green Assay, Staining, Whole Genome Amplification, Purification, Sequencing, Derivative Assay, Multiplex Assay, Software, Imaging, Microarray, Transformation Assay, RNA Sequencing Assay

cDNA Synthesis:

Article Title: Sulfated GAG mimetic peptide nanofibers enhance chondrogenic differentiation of mesenchymal stem cells in 3D in vitro models
Article Snippet: After washing, the pellets were left in a laminar flow cabinet for 20 min to evaporate ethanol and dissolved in 30 μl of distilled water, after which their concentrations were measured using Nanodrop 2000 spectrophotometer (Thermo Scientific). .. RNA samples were stored at −80°C until qRT–PCR analyses. cDNA synthesis and qRT–PCR reaction from RNA samples were performed using ‘Super Script III Platinum SYBR Green One-Step qRT–PCR Kit’ (Invitrogen). ..

SYBR Green Assay:

Article Title: Sensing of SARS-CoV-2 by pDCs and their subsequent production of IFN-I contribute to macrophage-induced cytokine storm during COVID-19
Article Snippet: Total RNA samples were prepared from cells using TRIzol and the Direct-zol RNA Miniprep Plus Kit (Zymo Research) according to the manufacturer’s instructions. .. To quantify viral replication, measured by the accumulation of subgenomic N transcripts, we performed one-step quantitative real-time PCR using the SuperScript III Platinum SYBR Green One-Step qRT-PCR Kit (Invitrogen) with primers specific for the TRS-L and TRS-B sites for the N gene and 18 S and ACTB as an internal reference as previously described ( ). .. Quantitative real-time PCRs were performed on the Bio-Rad CFX384 Touch Real-Time PCR Detection System.

Article Title: Protective Role of Short-Chain Fatty Acids against Ang- II-Induced Mitochondrial Dysfunction in Brain Endothelial Cells: A Potential Role of Heme Oxygenase 2
Article Snippet: Total RNA from cultured cells was extracted using the RNeasy kit (Qiagen) following the manufacturer’s instructions. .. Quantitative real-time PCR was performed using a ViiA 7 Real-Time PCR System (Applied Biosystems, Foster City, CA, USA) with the SuperScript III Platinum SYBR Green One-Step qRT-PCR Kit (Invitrogen). .. The following primers purchased from Integrated DNA Technologies were used: vascular cell adhesion molecule 1 (VCAM1) (NM_001078.4) forward 5′- TGA CGA TGA CGT GTG CCA GT-3′, reverse 5′- GCT GTC GGT TCC CAT TGT CT-3′; nuclear factor-κB (NFκB) subunit p50 (NM_001382626.1) forward 5′- TGGACAGCAAATCCGCCCTG-3′, reverse 5′-TGTTGTAATGAGTCGTCATCCT-3′; NFκB subunit p65 (NM_001382626.1) forward 5′-AGGCAAGGAATAATGCTGTCCTG -3′, reverse 5′- ATCATTCTCTAGTGTCTGGTTGG -3′; ribosomal RNA 18S (NR_003278.3) forward 5′- CCCTATCAACTTTCGATGGTAGTCG -3′, reverse 5′-CCAATGGATCCTCGTTAAAGGATTT -3′, tumor necrosis factor-alpha (TNFα) (NM_000594.4) forward 5′-CACTAAGAATTCAAACTGGGGC-3′, TNFα reverse 5′- GAGGAAGGCCTAAGGTCCAC -3′.

Modification:

Article Title: Prolonged persistence of canine distemper virus RNA, and virus isolation in naturally infected shelter dogs
Article Snippet: .. A modification to the RT-PCR assay was made where the hydrolysis probe was labeled with fluorescein amidites (FAM) and a black hole quencher and the Path ID Multiplex One-Step RT-PCR kit (Applied Biosystems, Foster City, CA) was used. .. The 25 μL of RT-PCR master mix consisted of 1x Multiplex RT-PCR buffer, 1x Multiplex enzyme mix provided in the kit, 160 nM each of CDV forward and reverse primer (Integrated DNA Technologies, Coralville, IA), 80 nM of CDV hydrolysis probe (Biosearch Technologies, Novato, CA), 16 nM each of forward and reverse primer (Integrated DNA Technologies, Coralville, IA) and 8 nM of hydrolysis probe (Biosearch Technologies, Novato, CA) for in-house internal control, and 8 μL of the extracted nucleic acids.

Reverse Transcription Polymerase Chain Reaction:

Labeling:

Multiplex Assay:

One Step RT-PCR:

other:

Article Title: Starting from scratch: Step-by-step development of diagnostic tests for SARS-CoV-2 detection by RT-LAMP
Article Snippet: SuperScriptTM III PlatinumTM One-Step qRT-PCR Kit (Thermo Scientific, Waltham, MA, USA) was used following the manufacturer’s instructions.

Article Title: Genomic Characterization of Dengue Virus Outbreak in 2022 from Pakistan
Article Snippet: A total of 25 μL multiplex reaction mixture was run for each DENV serotype (DENV-1 to DENV-4) on ABI-7500 real-time thermocycler using the Invitrogen one-step qRT-PCR kit (Thermo Fisher Scientific, Waltham, MA, USA).

Article Title: Circular RNA SMARCA5 Modulates Epithelial-Mesenchymal Transformation, Proliferation, and Metastasis of Nasopharyngeal Carcinoma Cells via microRNA-582-3p/Phosphatase and Tensin Homolog Axis
Article Snippet: Co-transfection of the luciferase reporter plasmids with miR-582-3p-mimic and mimic-NC was into cells adopting LipofectamineTM 2000 kit (Invitrogen).

Real-time Polymerase Chain Reaction:

Quantitative RT-PCR:

Article Title: Using Zoos as Sentinels for Re-Emerging Arboviruses: Vector Surveillance during an Outbreak of Epizootic Hemorrhagic Disease at the Minnesota Zoo
Article Snippet: .. The reactions were performed in technical triplicates using the Superscript III/ Platinum Taq One-Step qRT-PCR Kit (Invitrogen, Waltham, MA, USA). .. The primers and probes (LGC Biosearch Technologies, Petaluma, CA, USA) were specific to the VP2, seg-2 region of each virus serotype [ ] ( ).

Review