Review



human fc blocking solution  (Miltenyi Biotec)


Bioz Verified Symbol Miltenyi Biotec is a verified supplier
Bioz Manufacturer Symbol Miltenyi Biotec manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 97

    Structured Review

    Miltenyi Biotec human fc blocking solution
    Human Fc Blocking Solution, supplied by Miltenyi Biotec, used in various techniques. Bioz Stars score: 97/100, based on 3312 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/fc+blocking+solution/FcR+Blocking+Reagent%2C+human/pmc12675173-115-17-22
    Average 97 stars, based on 3312 article reviews
    human fc blocking solution - by Bioz Stars, 2026-09
    97/100 stars

    Images

    Related Articles

    Blocking Assay:

    Article Title: Genomic profiling identifies actionable DNA-repair defects in a new cervical cancer model
    Article Snippet: .. Cells were treated with an FcR blocking reagent (130-059-901, Miltenyi Biotec) for 10 min at 4 °C prior to antibody staining. ..

    Article Title: Human lungs maintain tissue-resident memory T cells against a broad spectrum of pathogens.
    Article Snippet: .. The resulting cell suspensions (across all sample types) were centrifuged, and the pellet was resuspended in MACS buffer containing human FcR Blocking Reagent (Miltenyi, 130059901), followed by addition of Cell-hashtag TotalSeq-C antibody (1 μg per condition) to enable hashtag-oligonucleotide-based sample deconvolution at the analysis stage. ..

    Article Title: A novel Vδ1 engager targeting CD19 enhances human Vδ1 γδ T cell responses against CLL and CD19+ hematological malignancies.
    Article Snippet: γδ T cells are associated with favorable outcomes in many cancers likely through a mechanism of stress-directed cytotoxicity and antitumor cytokine production.. Vδ1 γδ T cells are especially promising for immunotherapy due to their broad stress recognition and resistance to activation-induced cell death.. Here, we generate a CD19 engager incorporating a novel Vδ1 binding moiety as proof-of-concept for treating CD19 cancers, including Chronic Lymphocytic Leukemia (CLL).

    Article Title: Carboxyamidotriazole treatment correlates with dynamic changes in macrophage metabolism and function in models of colitis and colitis-associated carcinogenesis.
    Article Snippet: Carboxyamidotriazole (CAI), an inhibitor of mitochondrial complex I, demonstrates anti-inflammatory and antitumor properties.. While effective against colitis, its potential link to macrophage metabolism in colitis and colitis-associated colorectal cancer (CAC) remained unexplored.. This study investigates the role of CAI and its association with macrophage metabolic states in these conditions.

    Article Title: Distinct systemic and gut IgA responses to bacteria of the human upper gastrointestinal tract.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies FITC-mouse anti-human CD38 Thermo Fisher Cat# 11-0388-42, RRID:AB_10547895 APC-mouse anti-human IgA Miltenyi Cat# 130-113-472, RRID:AB_2733422 PerCP/Cy5.5-mouse anti-human IgD BioLegend Cat# 348208, RRID:AB_10641706 BV510-mouse anti-human CD3 BioLegend Cat# 317331, RRID:AB_2561376 BV510-mouse anti-human CD14 BioLegend Cat# 301842, RRID:AB_2561946 AF647-goat F(ab’)2 anti-human IgA SouthernBiotech Cat# 2052-31, RRID:AB_2795711 Goat anti-human Ig SouthernBiotech Cat# 2010-01, RRID:AB_2687525 AP-goat anti-human IgA Sigma Cat# A9669, RRID:AB_258467 AP-goat anti-human IgG SouthernBiotech Cat# 2040-04, RRID:AB_2795643 AP-goat anti-human IgM SouthernBiotech Cat# 2020-04, RRID:AB_2795602 Rabbit anti-human IgA Agilent Cat# A0262, RRID:AB_3094763 HRP-goat anti-rabbit Ig SouthernBiotech Cat# 4010-05, RRID:AB_2632593 Barcoded mouse anti-human CD27, TotalSeq-C0154 BioLegend Cat# 302853, RRID:AB_2800747 Barcoded mouse anti-human hashtag 1, TotalSeq-C0251 BioLegend Cat# 394661, RRID:AB_2801031 Barcoded mouse anti-human hashtag 2, TotalSeq-C0252 BioLegend Cat# 394663, RRID:AB_2801032 Biological samples Blood samples of patients with celiac disease and controls This paper N/A Duodenal biopsies This paper N/A Bone marrow aspirates This paper N/A Chemicals, peptides, and recombinant proteins Streptavidin-PE Thermo Fisher Cat# S866 Streptavidin-PE/Cy7 Thermo Fisher Cat# SA1012 Barcoded streptavidin-PE, TotalSeq-C0951 BioLegend Cat# 405261 FcR Blocking Reagent Miltenyi Cat# 130-059-901 LIVE/DEAD fixable Aqua Thermo Fisher Cat# L34957 LIVE/DEAD fixable Near-IR Thermo Fisher Cat# L10119 4% formaldehyde fixative solution Thermo Fisher Cat# FB002 Calf thymus DNA Thermo Fisher Cat# 15633019 Keyhole limpet hemocyanin Sigma Cat# H8283 Human insulin Sigma Cat# I9278 LPS from E. coli O55:B5 Sigma Cat# L2637 LPS from E. coli O111:B4 Sigma Cat# L3012 LPS from K. pneumoniae Sigma Cat# L4268 Ultrapure LPS from E. coli O55:B5 InvivoGen Cat# tlrl-pb5lps Recombinant Lpp from E. coli TargetMol Cat# TMPH-00651 Mutanolysin Sigma Cat# M9901 Proteinase K Qiagen Cat# 69504 Biotin-TG2 Lindeman et al.29 N/A Biotin-GST Lindeman et al.29 N/A (Continued on next page) 16 Cell Reports 45, 117721, August 25, 2026 .. REAGENT or RESOURCE SOURCE IDENTIFIER Recombinant anti-TG2 IgA1 mAb Iversen et al.89 N/A Recombinant polyreactive IgG1 mAb Das et al.90 N/A Recombinant IgA1 mAbs cloned from human plasma cells This paper N/A Critical commercial assays AnaeroGen sachets Thermo Fisher Cat# AN0025A Peptide M-agarose InvivoGen Cat# gel-pdm-2 HiTrap protein G columns Cytiva Cat# 29048581 MultiScreen 96 well plates Sigma Cat# MSIPS4510 4-20% Tris-glycine gels Thermo Fisher Cat# XP04200BOX West Pico PLUS substrate Thermo Fisher Cat# 34580 BCIP/NBT substrate Bio-Rad Cat# 1706432 PageBlue protein staining solution Thermo Fisher Cat# 24620 Chromium Single Cell 5′ Library & Gel Bead Kit 10x Genomics Cat# 1000014 Chromium Single Cell 5′ Library Construction Kit 10x Genomics Cat# 1000020 Chromium Chip A Single Cell Kit 10x Genomics Cat# 1000009 Chromium i7 Multiplex Kit 10x Genomics Cat# 120262 Chromium i7 Multiplex Kit N, Set A 10x Genomics Cat# 1000084 Chromium Single Cell 5′ Feature Barcode Library Kit 10x Genomics Cat# 1000080 Chromium Single Cell V(D)J Enrichment Kit, Human B cells 10x Genomics Cat# 1000016 Deposited data scRNA-seq and V(D)J sequences of gut and BM plasma cells This study Federated European Genome-Phenome Archive: EGAS50000001912 Experimental models: strains Bacterial isolates from duodenal biopsies This paper N/A Control strains See Table S3 See Table S3 Oligonucleotides Immunoglobulin primers Tiller et al.88 N/A BlpI-IGHA reverse primer CAGAGGCTCAGCGGGAAGACCTTG Eurogentec N/A Recombinant DNA Heavy chain V regions in AbVec-hIgA1 This study N/A Kappa light chain V regions in AbVechIgKappa This study N/A Lambda light chain V regions in AbVechIgLambda This study N/A Software and algorithms FlowJo v10 BD https://www.flowjo.com/ GraphPad Prism v10 Dotmatrics https://www.graphpad.com/ R v.4.4.3 The R Foundation https://www.r-project.org ggpubr v0.6.0 N/A https://cran.r-project.org/web/packages/ ggpubr/index.html Cell Ranger v6.0.2 10x Genomics https://www.10xgenomics.com/support/ software/cell-ranger/latest Seurat v5.2.1 Hao et al. 2021 https://satijalab.org/seurat/ EnhancedVolcano v1.18.0 N/A https://github.com/kevinblighe/ EnhancedVolcano (Continued on next page) Cell Reports 45, 117721, August 25, 2026 17

    Staining:

    Article Title: Genomic profiling identifies actionable DNA-repair defects in a new cervical cancer model
    Article Snippet: .. Cells were treated with an FcR blocking reagent (130-059-901, Miltenyi Biotec) for 10 min at 4 °C prior to antibody staining. ..

    Article Title: A novel Vδ1 engager targeting CD19 enhances human Vδ1 γδ T cell responses against CLL and CD19+ hematological malignancies.
    Article Snippet: γδ T cells are associated with favorable outcomes in many cancers likely through a mechanism of stress-directed cytotoxicity and antitumor cytokine production.. Vδ1 γδ T cells are especially promising for immunotherapy due to their broad stress recognition and resistance to activation-induced cell death.. Here, we generate a CD19 engager incorporating a novel Vδ1 binding moiety as proof-of-concept for treating CD19 cancers, including Chronic Lymphocytic Leukemia (CLL).

    Magnetic Cell Separation:

    Article Title: Human lungs maintain tissue-resident memory T cells against a broad spectrum of pathogens.
    Article Snippet: .. The resulting cell suspensions (across all sample types) were centrifuged, and the pellet was resuspended in MACS buffer containing human FcR Blocking Reagent (Miltenyi, 130059901), followed by addition of Cell-hashtag TotalSeq-C antibody (1 μg per condition) to enable hashtag-oligonucleotide-based sample deconvolution at the analysis stage. ..

    Marker:

    Article Title: A novel Vδ1 engager targeting CD19 enhances human Vδ1 γδ T cell responses against CLL and CD19+ hematological malignancies.
    Article Snippet: γδ T cells are associated with favorable outcomes in many cancers likely through a mechanism of stress-directed cytotoxicity and antitumor cytokine production.. Vδ1 γδ T cells are especially promising for immunotherapy due to their broad stress recognition and resistance to activation-induced cell death.. Here, we generate a CD19 engager incorporating a novel Vδ1 binding moiety as proof-of-concept for treating CD19 cancers, including Chronic Lymphocytic Leukemia (CLL).

    Incubation:

    Article Title: Carboxyamidotriazole treatment correlates with dynamic changes in macrophage metabolism and function in models of colitis and colitis-associated carcinogenesis.
    Article Snippet: Carboxyamidotriazole (CAI), an inhibitor of mitochondrial complex I, demonstrates anti-inflammatory and antitumor properties.. While effective against colitis, its potential link to macrophage metabolism in colitis and colitis-associated colorectal cancer (CAC) remained unexplored.. This study investigates the role of CAI and its association with macrophage metabolic states in these conditions.

    Sedimentation:

    Article Title: Carboxyamidotriazole treatment correlates with dynamic changes in macrophage metabolism and function in models of colitis and colitis-associated carcinogenesis.
    Article Snippet: Carboxyamidotriazole (CAI), an inhibitor of mitochondrial complex I, demonstrates anti-inflammatory and antitumor properties.. While effective against colitis, its potential link to macrophage metabolism in colitis and colitis-associated colorectal cancer (CAC) remained unexplored.. This study investigates the role of CAI and its association with macrophage metabolic states in these conditions.

    Recombinant:

    Article Title: Distinct systemic and gut IgA responses to bacteria of the human upper gastrointestinal tract.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies FITC-mouse anti-human CD38 Thermo Fisher Cat# 11-0388-42, RRID:AB_10547895 APC-mouse anti-human IgA Miltenyi Cat# 130-113-472, RRID:AB_2733422 PerCP/Cy5.5-mouse anti-human IgD BioLegend Cat# 348208, RRID:AB_10641706 BV510-mouse anti-human CD3 BioLegend Cat# 317331, RRID:AB_2561376 BV510-mouse anti-human CD14 BioLegend Cat# 301842, RRID:AB_2561946 AF647-goat F(ab’)2 anti-human IgA SouthernBiotech Cat# 2052-31, RRID:AB_2795711 Goat anti-human Ig SouthernBiotech Cat# 2010-01, RRID:AB_2687525 AP-goat anti-human IgA Sigma Cat# A9669, RRID:AB_258467 AP-goat anti-human IgG SouthernBiotech Cat# 2040-04, RRID:AB_2795643 AP-goat anti-human IgM SouthernBiotech Cat# 2020-04, RRID:AB_2795602 Rabbit anti-human IgA Agilent Cat# A0262, RRID:AB_3094763 HRP-goat anti-rabbit Ig SouthernBiotech Cat# 4010-05, RRID:AB_2632593 Barcoded mouse anti-human CD27, TotalSeq-C0154 BioLegend Cat# 302853, RRID:AB_2800747 Barcoded mouse anti-human hashtag 1, TotalSeq-C0251 BioLegend Cat# 394661, RRID:AB_2801031 Barcoded mouse anti-human hashtag 2, TotalSeq-C0252 BioLegend Cat# 394663, RRID:AB_2801032 Biological samples Blood samples of patients with celiac disease and controls This paper N/A Duodenal biopsies This paper N/A Bone marrow aspirates This paper N/A Chemicals, peptides, and recombinant proteins Streptavidin-PE Thermo Fisher Cat# S866 Streptavidin-PE/Cy7 Thermo Fisher Cat# SA1012 Barcoded streptavidin-PE, TotalSeq-C0951 BioLegend Cat# 405261 FcR Blocking Reagent Miltenyi Cat# 130-059-901 LIVE/DEAD fixable Aqua Thermo Fisher Cat# L34957 LIVE/DEAD fixable Near-IR Thermo Fisher Cat# L10119 4% formaldehyde fixative solution Thermo Fisher Cat# FB002 Calf thymus DNA Thermo Fisher Cat# 15633019 Keyhole limpet hemocyanin Sigma Cat# H8283 Human insulin Sigma Cat# I9278 LPS from E. coli O55:B5 Sigma Cat# L2637 LPS from E. coli O111:B4 Sigma Cat# L3012 LPS from K. pneumoniae Sigma Cat# L4268 Ultrapure LPS from E. coli O55:B5 InvivoGen Cat# tlrl-pb5lps Recombinant Lpp from E. coli TargetMol Cat# TMPH-00651 Mutanolysin Sigma Cat# M9901 Proteinase K Qiagen Cat# 69504 Biotin-TG2 Lindeman et al.29 N/A Biotin-GST Lindeman et al.29 N/A (Continued on next page) 16 Cell Reports 45, 117721, August 25, 2026 .. REAGENT or RESOURCE SOURCE IDENTIFIER Recombinant anti-TG2 IgA1 mAb Iversen et al.89 N/A Recombinant polyreactive IgG1 mAb Das et al.90 N/A Recombinant IgA1 mAbs cloned from human plasma cells This paper N/A Critical commercial assays AnaeroGen sachets Thermo Fisher Cat# AN0025A Peptide M-agarose InvivoGen Cat# gel-pdm-2 HiTrap protein G columns Cytiva Cat# 29048581 MultiScreen 96 well plates Sigma Cat# MSIPS4510 4-20% Tris-glycine gels Thermo Fisher Cat# XP04200BOX West Pico PLUS substrate Thermo Fisher Cat# 34580 BCIP/NBT substrate Bio-Rad Cat# 1706432 PageBlue protein staining solution Thermo Fisher Cat# 24620 Chromium Single Cell 5′ Library & Gel Bead Kit 10x Genomics Cat# 1000014 Chromium Single Cell 5′ Library Construction Kit 10x Genomics Cat# 1000020 Chromium Chip A Single Cell Kit 10x Genomics Cat# 1000009 Chromium i7 Multiplex Kit 10x Genomics Cat# 120262 Chromium i7 Multiplex Kit N, Set A 10x Genomics Cat# 1000084 Chromium Single Cell 5′ Feature Barcode Library Kit 10x Genomics Cat# 1000080 Chromium Single Cell V(D)J Enrichment Kit, Human B cells 10x Genomics Cat# 1000016 Deposited data scRNA-seq and V(D)J sequences of gut and BM plasma cells This study Federated European Genome-Phenome Archive: EGAS50000001912 Experimental models: strains Bacterial isolates from duodenal biopsies This paper N/A Control strains See Table S3 See Table S3 Oligonucleotides Immunoglobulin primers Tiller et al.88 N/A BlpI-IGHA reverse primer CAGAGGCTCAGCGGGAAGACCTTG Eurogentec N/A Recombinant DNA Heavy chain V regions in AbVec-hIgA1 This study N/A Kappa light chain V regions in AbVechIgKappa This study N/A Lambda light chain V regions in AbVechIgLambda This study N/A Software and algorithms FlowJo v10 BD https://www.flowjo.com/ GraphPad Prism v10 Dotmatrics https://www.graphpad.com/ R v.4.4.3 The R Foundation https://www.r-project.org ggpubr v0.6.0 N/A https://cran.r-project.org/web/packages/ ggpubr/index.html Cell Ranger v6.0.2 10x Genomics https://www.10xgenomics.com/support/ software/cell-ranger/latest Seurat v5.2.1 Hao et al. 2021 https://satijalab.org/seurat/ EnhancedVolcano v1.18.0 N/A https://github.com/kevinblighe/ EnhancedVolcano (Continued on next page) Cell Reports 45, 117721, August 25, 2026 17



    Similar Products

    97
    Miltenyi Biotec fc blocking solution
    Fc Blocking Solution, supplied by Miltenyi Biotec, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/fc+blocking+solution/FcR+Blocking+Reagent%2C+mouse/bio_rxiv__64898__2026__03__12__710459-152-12-16
    Average 97 stars, based on 1 article reviews
    fc blocking solution - by Bioz Stars, 2026-09
    97/100 stars
      Buy from Supplier

    96
    Cytek Biosciences fc block solution
    Fc Block Solution, supplied by Cytek Biosciences, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/fc+blocking+solution/Purified+Anti-Mouse+CD16+%2F+CD32/bio_rxiv__64898__2026__02__23__707565-40-7-10
    Average 96 stars, based on 1 article reviews
    fc block solution - by Bioz Stars, 2026-09
    96/100 stars
      Buy from Supplier

    86
    Cell Signaling Technology Inc human fc receptor blocking solution
    Human Fc Receptor Blocking Solution, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/fc+blocking+solution/pm41621689-96-15-21
    Average 86 stars, based on 1 article reviews
    human fc receptor blocking solution - by Bioz Stars, 2026-09
    86/100 stars
      Buy from Supplier

    96
    Miltenyi Biotec premium grade 130 095 362 miltenyi human fc receptor blocking solution 422301 biolegend hydrocortisone h0396
    Premium Grade 130 095 362 Miltenyi Human Fc Receptor Blocking Solution 422301 Biolegend Hydrocortisone H0396, supplied by Miltenyi Biotec, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/fc+blocking+solution/Human+IL-7%2C+premium+grade/pmc12689812__41467_2025_67328_MOESM1_ESM-509-16-19
    Average 96 stars, based on 1 article reviews
    premium grade 130 095 362 miltenyi human fc receptor blocking solution 422301 biolegend hydrocortisone h0396 - by Bioz Stars, 2026-09
    96/100 stars
      Buy from Supplier

    97
    Miltenyi Biotec human fc block solution
    Human Fc Block Solution, supplied by Miltenyi Biotec, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/fc+blocking+solution/FcR+Blocking+Reagent%2C+human/pm41343277-289-14-22
    Average 97 stars, based on 1 article reviews
    human fc block solution - by Bioz Stars, 2026-09
    97/100 stars
      Buy from Supplier

    96
    Cytek Biosciences human fc block solution
    Human Fc Block Solution, supplied by Cytek Biosciences, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/fc+blocking+solution/Purified+Anti-Mouse+CD16+%2F+CD32/pm41343277-289-14-19
    Average 96 stars, based on 1 article reviews
    human fc block solution - by Bioz Stars, 2026-09
    96/100 stars
      Buy from Supplier

    97
    Miltenyi Biotec human fc receptor blocking solution
    Human Fc Receptor Blocking Solution, supplied by Miltenyi Biotec, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/fc+blocking+solution/FcR+Blocking+Reagent%2C+human/pmc12663188-313-24-29
    Average 97 stars, based on 1 article reviews
    human fc receptor blocking solution - by Bioz Stars, 2026-09
    97/100 stars
      Buy from Supplier

    97
    Miltenyi Biotec human fc blocking solution
    Human Fc Blocking Solution, supplied by Miltenyi Biotec, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/fc+blocking+solution/FcR+Blocking+Reagent%2C+human/pmc12675173-115-17-22
    Average 97 stars, based on 1 article reviews
    human fc blocking solution - by Bioz Stars, 2026-09
    97/100 stars
      Buy from Supplier

    97
    Miltenyi Biotec fc receptor blocking solution
    Fc Receptor Blocking Solution, supplied by Miltenyi Biotec, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/fc+blocking+solution/FcR+Blocking+Reagent%2C+human/pm41270364-69-13-21
    Average 97 stars, based on 1 article reviews
    fc receptor blocking solution - by Bioz Stars, 2026-09
    97/100 stars
      Buy from Supplier

    98
    Bio X Cell fc receptor blocking solution
    Fc Receptor Blocking Solution, supplied by Bio X Cell, used in various techniques. Bioz Stars score: 98/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/fc+blocking+solution/Anti-Dopamine+Receptor+D3+Rabbit+Monoclonal+Antibody/pmc12582536-63-9-13
    Average 98 stars, based on 1 article reviews
    fc receptor blocking solution - by Bioz Stars, 2026-09
    98/100 stars
      Buy from Supplier

    Image Search Results