Review



plarry empty vector  (Addgene inc)


Bioz Verified Symbol Addgene inc is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 93
      Buy from Supplier

    Structured Review

    Addgene inc plarry empty vector
    Plarry Empty Vector, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 15 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/empty+vector/pLARRY-EGFP+(Plasmid+%23140025)/pm41882356-559-1-4
    Average 93 stars, based on 15 article reviews
    plarry empty vector - by Bioz Stars, 2026-10
    93/100 stars

    Images

    Related Articles

    Plasmid Preparation:

    Article Title: PU.1 inhibition sensitizes stem-monocytic AML to BCL2 blockade
    Article Snippet: .. Lentiviral barcoding was performed using the pLARRY-EGFP-BCv1 plasmid as previously described . pLARRY-EGFP-BCv1 was a gift from Fernando Camargo (Addgene plasmid #140025). .. The pLARRY plasmid was retransformed into STBL4 ElectroMAX competent cells (ThermoFisher #11635018) and plated onto large LB-agar plates supplemented with 100 μg/mL ampicillin.

    Article Title: Integrating natural and engineered genetic variations to decode regulatory influence on blood traits.
    Article Snippet: In the same nucleofection we isolated three clone lines homozygous wild type reference for the SNP rs35592432 (G/G clones), and three homozygous alternative clone lines rs35592432 (C/C clones). .. 22 Cell Reports 45, 116937, February 24, 2026 Generation of clone lines: Lentiviral barcoding Plasmids carrying single unique barcodes were isolated from the Larry Barcode Library V1 80 (Addgene, #140025) characterised by whole plasmid sequencing (Eurofins) to identify the different barcodes and used to transfect Phoenix Ampho (ATCC, CRL-3213) cells, together with the pMD2.G 81 (Addgene, #12259) and psPAX2 81 (Addgene, #12260) lentiviral packaging vectors. ..

    Article Title: Epigenetic memory of colitis promotes tumour growth.
    Article Snippet: .. The pLARRY empty vector (Addgene no. 140025) was first modified to insert a TruSeq sequencing adaptor (ACACTCTTTCCCTACACGACGCTCTTCCG ATCT) upstream of the barcode insertion site to allow for direct amplification. ..

    Article Title: Integrating natural and engineered genetic variations to decode regulatory influence on blood traits
    Article Snippet: In the same nucleofection we isolated three clone lines homozygous wild type reference for the SNP rs35592432 (G/G clones), and three homozygous alternative clone lines rs35592432 (C/C clones). .. Plasmids carrying single unique barcodes were isolated from the Larry Barcode Library V1 (Addgene, #140025) characterised by whole plasmid sequencing (Eurofins) to identify the different barcodes and used to transfect Phoenix Ampho (ATCC, CRL-3213) cells, together with the pMD2.G (Addgene, #12259) and psPAX2 (Addgene, #12260) lentiviral packaging vectors. ..

    Article Title: Protocol to track single-cell-derived clones using DNA barcoding combined with single-cell RNA sequencing
    Article Snippet: .. Prepare the pLARRY-EGFP vector (Addgene) for ligation with annealed barcode oligonucleotides as follows: a. Double-digest the pLARRY-EGFP vector using SalI and XbaI restriction endonuclease sites in the 3′ UTR of EGFP as indicated in . b. Incubate the reaction at 37°C for 20 min followed by heat inactivation of enzymes at 65°C for 20 min. ..

    other:

    Article Title: Integrating natural and engineered genetic variations to decode regulatory influence on blood traits
    Article Snippet: Larry Barcode Library V1 , Addgene , Addgene#140025; RRID: Addgene_140025.

    Article Title: Leukemia stem cell expansion cultures reveal clonal drivers of leukemogenesis and therapy response
    Article Snippet: Male C57BL6/J mice (wild-type) and Ptprca (CD45.1) mice were obtained through Charles River Laboratories, France, and conditioned using sub-lethal X-ray irradiation (900 cGy, split dose) in the morning before transplantation in the afternoon of the same day.

    Isolation:

    Article Title: Integrating natural and engineered genetic variations to decode regulatory influence on blood traits.
    Article Snippet: In the same nucleofection we isolated three clone lines homozygous wild type reference for the SNP rs35592432 (G/G clones), and three homozygous alternative clone lines rs35592432 (C/C clones). .. 22 Cell Reports 45, 116937, February 24, 2026 Generation of clone lines: Lentiviral barcoding Plasmids carrying single unique barcodes were isolated from the Larry Barcode Library V1 80 (Addgene, #140025) characterised by whole plasmid sequencing (Eurofins) to identify the different barcodes and used to transfect Phoenix Ampho (ATCC, CRL-3213) cells, together with the pMD2.G 81 (Addgene, #12259) and psPAX2 81 (Addgene, #12260) lentiviral packaging vectors. ..

    Article Title: Integrating natural and engineered genetic variations to decode regulatory influence on blood traits
    Article Snippet: In the same nucleofection we isolated three clone lines homozygous wild type reference for the SNP rs35592432 (G/G clones), and three homozygous alternative clone lines rs35592432 (C/C clones). .. Plasmids carrying single unique barcodes were isolated from the Larry Barcode Library V1 (Addgene, #140025) characterised by whole plasmid sequencing (Eurofins) to identify the different barcodes and used to transfect Phoenix Ampho (ATCC, CRL-3213) cells, together with the pMD2.G (Addgene, #12259) and psPAX2 (Addgene, #12260) lentiviral packaging vectors. ..

    Sequencing:

    Article Title: Integrating natural and engineered genetic variations to decode regulatory influence on blood traits.
    Article Snippet: In the same nucleofection we isolated three clone lines homozygous wild type reference for the SNP rs35592432 (G/G clones), and three homozygous alternative clone lines rs35592432 (C/C clones). .. 22 Cell Reports 45, 116937, February 24, 2026 Generation of clone lines: Lentiviral barcoding Plasmids carrying single unique barcodes were isolated from the Larry Barcode Library V1 80 (Addgene, #140025) characterised by whole plasmid sequencing (Eurofins) to identify the different barcodes and used to transfect Phoenix Ampho (ATCC, CRL-3213) cells, together with the pMD2.G 81 (Addgene, #12259) and psPAX2 81 (Addgene, #12260) lentiviral packaging vectors. ..

    Article Title: Epigenetic memory of colitis promotes tumour growth.
    Article Snippet: .. The pLARRY empty vector (Addgene no. 140025) was first modified to insert a TruSeq sequencing adaptor (ACACTCTTTCCCTACACGACGCTCTTCCG ATCT) upstream of the barcode insertion site to allow for direct amplification. ..

    Article Title: Integrating natural and engineered genetic variations to decode regulatory influence on blood traits
    Article Snippet: In the same nucleofection we isolated three clone lines homozygous wild type reference for the SNP rs35592432 (G/G clones), and three homozygous alternative clone lines rs35592432 (C/C clones). .. Plasmids carrying single unique barcodes were isolated from the Larry Barcode Library V1 (Addgene, #140025) characterised by whole plasmid sequencing (Eurofins) to identify the different barcodes and used to transfect Phoenix Ampho (ATCC, CRL-3213) cells, together with the pMD2.G (Addgene, #12259) and psPAX2 (Addgene, #12260) lentiviral packaging vectors. ..

    Modification:

    Article Title: Epigenetic memory of colitis promotes tumour growth.
    Article Snippet: .. The pLARRY empty vector (Addgene no. 140025) was first modified to insert a TruSeq sequencing adaptor (ACACTCTTTCCCTACACGACGCTCTTCCG ATCT) upstream of the barcode insertion site to allow for direct amplification. ..

    Amplification:

    Article Title: Epigenetic memory of colitis promotes tumour growth.
    Article Snippet: .. The pLARRY empty vector (Addgene no. 140025) was first modified to insert a TruSeq sequencing adaptor (ACACTCTTTCCCTACACGACGCTCTTCCG ATCT) upstream of the barcode insertion site to allow for direct amplification. ..

    Ligation:

    Article Title: Protocol to track single-cell-derived clones using DNA barcoding combined with single-cell RNA sequencing
    Article Snippet: .. Prepare the pLARRY-EGFP vector (Addgene) for ligation with annealed barcode oligonucleotides as follows: a. Double-digest the pLARRY-EGFP vector using SalI and XbaI restriction endonuclease sites in the 3′ UTR of EGFP as indicated in . b. Incubate the reaction at 37°C for 20 min followed by heat inactivation of enzymes at 65°C for 20 min. ..



    Similar Products

    crispr cas9 sgrna vector pdd162  (Addgene inc)
    95
    Addgene inc crispr cas9 sgrna vector pdd162
    Crispr Cas9 Sgrna Vector Pdd162, supplied by Addgene inc, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/empty+vector/pDD162+(Peft-3%3A%3ACas9+%2B+Empty+sgRNA)+(Plasmid+%2347549)/pm42771683-522-13-16
    Average 95 stars, based on 1 article reviews
    crispr cas9 sgrna vector pdd162 - by Bioz Stars, 2026-10
    95/100 stars
    		  Buy from Supplier
    empty adenoviral vectors  (Obio Technology Corp Ltd)
    86
    Obio Technology Corp Ltd empty adenoviral vectors
    Empty Adenoviral Vectors, supplied by Obio Technology Corp Ltd, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/empty+vector/adenoviral+stard7+targeting+vectors/pm42320265-85-17-25
    Average 86 stars, based on 1 article reviews
    empty adenoviral vectors - by Bioz Stars, 2026-10
    86/100 stars
    		  Buy from Supplier
    empty vector control  (OriGene)
    94
    OriGene empty vector control
    Empty Vector Control, supplied by OriGene, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/empty+vector/Parp11+(NM_181402)+Mouse+Tagged+ORF+Clone/bio_rxiv__64898__2026__06__01__729331-208-6-12
    Average 94 stars, based on 1 article reviews
    empty vector control - by Bioz Stars, 2026-10
    94/100 stars
    		  Buy from Supplier
    empty vector lentiviruses  (Obio Technology Corp Ltd)
    86
    Obio Technology Corp Ltd empty vector lentiviruses
    Empty Vector Lentiviruses, supplied by Obio Technology Corp Ltd, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/empty+vector/empty+lentiviruses+vector/pm42122124-84-5-11
    Average 86 stars, based on 1 article reviews
    empty vector lentiviruses - by Bioz Stars, 2026-10
    86/100 stars
    		  Buy from Supplier
    empty pgadt7 vector  (TaKaRa)
    99
    TaKaRa empty pgadt7 vector
    Empty Pgadt7 Vector, supplied by TaKaRa, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/empty+vector/pGADT7+AD+Vector/pmc13161086-261-5-36
    Average 99 stars, based on 1 article reviews
    empty pgadt7 vector - by Bioz Stars, 2026-10
    99/100 stars
    		  Buy from Supplier
    empty vector plasmid  (OriGene)
    96
    OriGene empty vector plasmid
    Empty Vector Plasmid, supplied by OriGene, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/empty+vector/pCMV6-Entry+Mammalian+Expression+Vector/pmc13191034-111-4-13
    Average 96 stars, based on 1 article reviews
    empty vector plasmid - by Bioz Stars, 2026-10
    96/100 stars
    		  Buy from Supplier
    pcmv6 xl5 empty plasmid  (OriGene)
    96
    OriGene pcmv6 xl5 empty plasmid
    Pcmv6 Xl5 Empty Plasmid, supplied by OriGene, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/empty+vector/pCMV6-XL5+Mammalian+Expression+Vector/pm41776401-44-5-11
    Average 96 stars, based on 1 article reviews
    pcmv6 xl5 empty plasmid - by Bioz Stars, 2026-10
    96/100 stars
    		  Buy from Supplier
    plenti cmv puro dest empty vector  (Addgene inc)
    96
    Addgene inc plenti cmv puro dest empty vector
    Plenti Cmv Puro Dest Empty Vector, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/empty+vector/pLenti+CMV+Puro+DEST+(w118-1)+(Plasmid+%2317452)/bio_rxiv__64898__2026__03__28__714855-261-8-23
    Average 96 stars, based on 1 article reviews
    plenti cmv puro dest empty vector - by Bioz Stars, 2026-10
    96/100 stars
    		  Buy from Supplier
    egfp empty vector control  (TaKaRa)
    95
    TaKaRa egfp empty vector control
    a, HCT116 cells stably expressing BRIP1 R162Q were <t>transiently</t> <t>transfected</t> using PEI with empty vector <t>(EV-EGFP)</t> or RNaseH1-WT-eGFP. Transfection efficiency was assessed via EGFP fluorescence. b, immunoblot analysis confirming expression of GFP-tagged constructs in transfected cells. c, Immunofluorescence detection of R-loops using the S9.6 antibody in cells transfected with EGFP or EGFP-RNaseH1. d, Quantification of S9.6 mean fluorescence intensity (MFI) per nucleus. Data represent mean ± SEM of three independent experiments. e, Immunofluorescence detection of G-quadruplex (G4) structures using the BG4 antibody in cells transfected with EGFP or EGFP-RNaseH1. f, Quantification of BG4 fluorescence intensity per nucleus. Data represent mean ± SEM of three independent experiments. g, Representative DNA fiber assay images from HCT116 cells harboring BRIP1 R162Q transfected with empty vector (EV-eGFP) or RNaseH1-WT. DNA replication tracts were sequentially labeled with CldU (red) and IdU (green). h, Quantification of DNA fiber types. RNaseH1-WT expression reduced the proportion of stalled replication forks in cells harboring BRIP1 R162Q. i, While the overall fork speed was not significantly increased upon RNaseH1-WT expression, tracts displayed a more balanced distribution of CldU and IdU incorporation. j, Fork asymmetry analysis. RNaseH1-WT expression reduced fork asymmetry, indicating that left- and right-moving sister forks progressed at more similar speeds. Labeled tracks were visualized by confocal microscopy, and tract lengths were measured on raw LSM images. Lengths (µm) were converted to replication speed (kb/min) using a factor of 2.59 kb/µm. All data represent mean ± SEM from three independent experiments. At least 150 fibers per condition were analyzed in each replicate. Statistical significance was determined using paired two-tailed Student’s t-test (*p < 0.05, **p < 0.01, ***p < 0.001, ns = not significant). c, e, Representative confocal images are shown.
    Egfp Empty Vector Control, supplied by TaKaRa, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/empty+vector/pAcGFP1-C1+Vector/bio_rxiv__64898__2026__03__24__714005-201-9-14
    Average 95 stars, based on 1 article reviews
    egfp empty vector control - by Bioz Stars, 2026-10
    95/100 stars
    		  Buy from Supplier
    plarry empty vector  (Addgene inc)
    93
    Addgene inc plarry empty vector
    a, HCT116 cells stably expressing BRIP1 R162Q were <t>transiently</t> <t>transfected</t> using PEI with empty vector <t>(EV-EGFP)</t> or RNaseH1-WT-eGFP. Transfection efficiency was assessed via EGFP fluorescence. b, immunoblot analysis confirming expression of GFP-tagged constructs in transfected cells. c, Immunofluorescence detection of R-loops using the S9.6 antibody in cells transfected with EGFP or EGFP-RNaseH1. d, Quantification of S9.6 mean fluorescence intensity (MFI) per nucleus. Data represent mean ± SEM of three independent experiments. e, Immunofluorescence detection of G-quadruplex (G4) structures using the BG4 antibody in cells transfected with EGFP or EGFP-RNaseH1. f, Quantification of BG4 fluorescence intensity per nucleus. Data represent mean ± SEM of three independent experiments. g, Representative DNA fiber assay images from HCT116 cells harboring BRIP1 R162Q transfected with empty vector (EV-eGFP) or RNaseH1-WT. DNA replication tracts were sequentially labeled with CldU (red) and IdU (green). h, Quantification of DNA fiber types. RNaseH1-WT expression reduced the proportion of stalled replication forks in cells harboring BRIP1 R162Q. i, While the overall fork speed was not significantly increased upon RNaseH1-WT expression, tracts displayed a more balanced distribution of CldU and IdU incorporation. j, Fork asymmetry analysis. RNaseH1-WT expression reduced fork asymmetry, indicating that left- and right-moving sister forks progressed at more similar speeds. Labeled tracks were visualized by confocal microscopy, and tract lengths were measured on raw LSM images. Lengths (µm) were converted to replication speed (kb/min) using a factor of 2.59 kb/µm. All data represent mean ± SEM from three independent experiments. At least 150 fibers per condition were analyzed in each replicate. Statistical significance was determined using paired two-tailed Student’s t-test (*p < 0.05, **p < 0.01, ***p < 0.001, ns = not significant). c, e, Representative confocal images are shown.
    Plarry Empty Vector, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/empty+vector/pLARRY-EGFP+(Plasmid+%23140025)/pm41882356-559-1-4
    Average 93 stars, based on 1 article reviews
    plarry empty vector - by Bioz Stars, 2026-10
    93/100 stars
    		  Buy from Supplier

    Image Search Results


    a, HCT116 cells stably expressing BRIP1 R162Q were transiently transfected using PEI with empty vector (EV-EGFP) or RNaseH1-WT-eGFP. Transfection efficiency was assessed via EGFP fluorescence. b, immunoblot analysis confirming expression of GFP-tagged constructs in transfected cells. c, Immunofluorescence detection of R-loops using the S9.6 antibody in cells transfected with EGFP or EGFP-RNaseH1. d, Quantification of S9.6 mean fluorescence intensity (MFI) per nucleus. Data represent mean ± SEM of three independent experiments. e, Immunofluorescence detection of G-quadruplex (G4) structures using the BG4 antibody in cells transfected with EGFP or EGFP-RNaseH1. f, Quantification of BG4 fluorescence intensity per nucleus. Data represent mean ± SEM of three independent experiments. g, Representative DNA fiber assay images from HCT116 cells harboring BRIP1 R162Q transfected with empty vector (EV-eGFP) or RNaseH1-WT. DNA replication tracts were sequentially labeled with CldU (red) and IdU (green). h, Quantification of DNA fiber types. RNaseH1-WT expression reduced the proportion of stalled replication forks in cells harboring BRIP1 R162Q. i, While the overall fork speed was not significantly increased upon RNaseH1-WT expression, tracts displayed a more balanced distribution of CldU and IdU incorporation. j, Fork asymmetry analysis. RNaseH1-WT expression reduced fork asymmetry, indicating that left- and right-moving sister forks progressed at more similar speeds. Labeled tracks were visualized by confocal microscopy, and tract lengths were measured on raw LSM images. Lengths (µm) were converted to replication speed (kb/min) using a factor of 2.59 kb/µm. All data represent mean ± SEM from three independent experiments. At least 150 fibers per condition were analyzed in each replicate. Statistical significance was determined using paired two-tailed Student’s t-test (*p < 0.05, **p < 0.01, ***p < 0.001, ns = not significant). c, e, Representative confocal images are shown.

    Journal: bioRxiv

    Article Title: Role of a childhood cancer-linked BRIP1/FANCJ germline variant in genomic instability and cancer cell vulnerability

    doi: 10.64898/2026.03.24.714005

    Figure Lengend Snippet: a, HCT116 cells stably expressing BRIP1 R162Q were transiently transfected using PEI with empty vector (EV-EGFP) or RNaseH1-WT-eGFP. Transfection efficiency was assessed via EGFP fluorescence. b, immunoblot analysis confirming expression of GFP-tagged constructs in transfected cells. c, Immunofluorescence detection of R-loops using the S9.6 antibody in cells transfected with EGFP or EGFP-RNaseH1. d, Quantification of S9.6 mean fluorescence intensity (MFI) per nucleus. Data represent mean ± SEM of three independent experiments. e, Immunofluorescence detection of G-quadruplex (G4) structures using the BG4 antibody in cells transfected with EGFP or EGFP-RNaseH1. f, Quantification of BG4 fluorescence intensity per nucleus. Data represent mean ± SEM of three independent experiments. g, Representative DNA fiber assay images from HCT116 cells harboring BRIP1 R162Q transfected with empty vector (EV-eGFP) or RNaseH1-WT. DNA replication tracts were sequentially labeled with CldU (red) and IdU (green). h, Quantification of DNA fiber types. RNaseH1-WT expression reduced the proportion of stalled replication forks in cells harboring BRIP1 R162Q. i, While the overall fork speed was not significantly increased upon RNaseH1-WT expression, tracts displayed a more balanced distribution of CldU and IdU incorporation. j, Fork asymmetry analysis. RNaseH1-WT expression reduced fork asymmetry, indicating that left- and right-moving sister forks progressed at more similar speeds. Labeled tracks were visualized by confocal microscopy, and tract lengths were measured on raw LSM images. Lengths (µm) were converted to replication speed (kb/min) using a factor of 2.59 kb/µm. All data represent mean ± SEM from three independent experiments. At least 150 fibers per condition were analyzed in each replicate. Statistical significance was determined using paired two-tailed Student’s t-test (*p < 0.05, **p < 0.01, ***p < 0.001, ns = not significant). c, e, Representative confocal images are shown.

    Article Snippet: For R-loop removal, cells were transiently transfected with an EGFP empty vector control (pEGFP-C1, Takara Bio, #632470), EGFP-tagged RNaseH1 wild-type (WT), or the catalytically inactive RNaseH1 D145N mutant as indicated.

    Techniques: Stable Transfection, Expressing, Transfection, Plasmid Preparation, Fluorescence, Western Blot, Construct, Immunofluorescence, Labeling, Confocal Microscopy, Two Tailed Test