rosa26 dta b6 129 s6 cg (Jackson Laboratory)

About

News

Press Release

Team

Advisors

Partners

Contact

Bioz Stars

Bioz vStars

Buy from Supplier

Structured Review

Jackson Laboratory rosa26 dta b6 129 s6 cg

A Schematic representation of the TAM-inducible Cre recombinase system. Cre recombinase, flanked by a tamoxifen-inducible modified estrogen receptor ( MerCreMer ), was inserted into the Postn locus, enabling temporal control over Cre activity in cells that activate the Postn promoter. In the presence of TAM, Cre translocates to the nucleus and catalyzes recombination between loxP sites flanking a transcriptional stop upstream of a tdTomato reporter gene inserted into the <t>rosa26</t> locus. Cre activity results in constitutive expression of tdTomato in Cre-expressing cells and their progeny, thereby fluorescently marking Postn Lin fibroblasts. B Schematic representation of the experimental approach used to study fibroblast activation in Postn Lin immunocompetent mice after OP inoculation with 3 × 10 7 A. fumigatus conidia. TAM was administered via gavage one day before the fungal challenge and maintained through a TAM-infused chewing diet for the duration of the experiment. C Representative fluorescent photomicrographs showing the induction of tdTomato-positive cells following exposure to the specified treatments. Arrows indicate sporadic Postn Lin cells in samples not treated with A. fumigatus . D , E Time course illustrating the appearance of tdTomato + cells on days 1, 3, 5, and 7 post-inoculation with A. fumigatus . Bars represent the means ± SD from 3 biological replicates, each shown as an individual dot (* p < 0.05; one-way ANOVA on ranks with Tukey’s post hoc test). F Flow cytometric analysis of fold-change in tdTomato expression following inoculation with 3 × 10 7 conidia relative to mock infection with saline. Values represent the means ± SD from 4 and 5 biological replicates in the control and A. fumigatus -treated groups, respectively. Dots indicate individual biological replicates (* p < 0.05; unpaired two-tailed t -test). Source data are provided as a Source Data file.

Rosa26 Dta B6 129 S6 Cg, supplied by Jackson Laboratory, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/dta/cre+teto/pmc13201633-317-8-13
Average 86 stars, based on 1 article reviews

rosa26 dta b6 129 s6 cg - by Bioz Stars, 2026-11

86/100 stars

Images

1) Product Images from "Pulmonary fibroblast activation during Aspergillus fumigatus infection enhances lung defense via immunomodulation and tissue remodeling"

Article Title: Pulmonary fibroblast activation during Aspergillus fumigatus infection enhances lung defense via immunomodulation and tissue remodeling

Journal: Nature Communications

doi: 10.1038/s41467-026-71027-5

Figure Legend Snippet: A Schematic representation of the TAM-inducible Cre recombinase system. Cre recombinase, flanked by a tamoxifen-inducible modified estrogen receptor ( MerCreMer ), was inserted into the Postn locus, enabling temporal control over Cre activity in cells that activate the Postn promoter. In the presence of TAM, Cre translocates to the nucleus and catalyzes recombination between loxP sites flanking a transcriptional stop upstream of a tdTomato reporter gene inserted into the rosa26 locus. Cre activity results in constitutive expression of tdTomato in Cre-expressing cells and their progeny, thereby fluorescently marking Postn Lin fibroblasts. B Schematic representation of the experimental approach used to study fibroblast activation in Postn Lin immunocompetent mice after OP inoculation with 3 × 10 7 A. fumigatus conidia. TAM was administered via gavage one day before the fungal challenge and maintained through a TAM-infused chewing diet for the duration of the experiment. C Representative fluorescent photomicrographs showing the induction of tdTomato-positive cells following exposure to the specified treatments. Arrows indicate sporadic Postn Lin cells in samples not treated with A. fumigatus . D , E Time course illustrating the appearance of tdTomato + cells on days 1, 3, 5, and 7 post-inoculation with A. fumigatus . Bars represent the means ± SD from 3 biological replicates, each shown as an individual dot (* p < 0.05; one-way ANOVA on ranks with Tukey’s post hoc test). F Flow cytometric analysis of fold-change in tdTomato expression following inoculation with 3 × 10 7 conidia relative to mock infection with saline. Values represent the means ± SD from 4 and 5 biological replicates in the control and A. fumigatus -treated groups, respectively. Dots indicate individual biological replicates (* p < 0.05; unpaired two-tailed t -test). Source data are provided as a Source Data file.

Techniques Used: Modification, Control, Activity Assay, Expressing, Activation Assay, Infection, Saline, Two Tailed Test

A Schematic of the TAM-inducible DTA ablation model. The Cre recombinase, inserted into the Postn locus, is controlled by a TAM-inducible estrogen receptor ( MerCreMer ). Upon Postn promoter activation, TAM-induced recombination of the DTA gene results in DTA toxin expression from the rosa26 locus, preventing fibroblast activation and expansion. B Schematic representation of the experimental approach: Mice were inoculated OP with 1 × 10 6 conidia, followed by immunosuppression with triamcinolone acetonide 5 h post-infection. TAM was administered via gavage one day before fungal inoculation and maintained through a TAM-infused chewing diet for the duration of the experiment. C Percent survival of immunosuppressed mice infected with A. fumigatus ( n = 24 for control group and n = 20 for DTA group; p = 3.8 × 10 −5 , log rank test). D Gross appearance of lungs from infected DTA and control mice on day 4 post-infection. E Representative histopathologic images showing focal alveolar hemorrhage and angioinvasion in the A. fumigatus -infected DTA mice by H&E and GMS staining, respectively. F Distribution of alveolar hemorrhage severity in control (white bars) and DTA mice (red bars). Alveolar hemorrhage was scored semi quantitatively as described in Fig. . Data are shown as box-and-whisker plots with individual biological replicates overlaid ( n = 10 for control group and n = 8 for DTA group). Boxes represent the interquartile range (IQR), horizontal lines indicate the median, and whiskers extend to 1.5 x IQR (two-tailed Mann–Whitney U test). G Quantification of angioinvasion in intrapulmonary arteries of control (white bars) and DTA (red bars) mice. The percentage of vessels ≥100 µm in diameter that contained A. fumigatus hyphae in each animal were quantified in GMS-stained lung sections. Values represent the mean ± SD from 10 and 8 biological replicates in the control and DTA groups, respectively, with individual replicates indicated by dots (unpaired two-tailed t -test). H Collagen deposition quantified from Picrosirius Red-stained sections of lung tissue. Values represent the mean ± SD from 10 and 8 biological replicates in the control (white bars) and DTA (red bars) groups, respectively, with individual replicates indicated by dots (ns, no significant; unpaired two-tailed t -test) ( I ) Schematic representation of the experimental approach: similar to the schematic shown in ( B ), but lung tissue was harvested at day 4 post-challenge for further analysis, coinciding with the highest mortality rate observed in ( C ). J Flow cytometric quantification of viable Pdgfrα + cells. Right panels show the cell gating strategy used to distinguish viable and dead cells within the Pdgfrα + population. Values represent the mean ± SD from 5 and 8 biological replicates in the control and DTA groups, respectively ( p = 3.5 × 10 −5 ; unpaired two-tailed t -test). K Fungal burden quantification by RT-qPCR from lung lobes of the indicated mouse models. Fungal burden is expressed as Genome Equivalents (GE) per mg of lung tissue. Values represent the mean ± SD from 5 and 8 biological replicates in the control (white bars) and DTA (red bars) groups, respectively, with individual replicates indicated by dots ( p < 0.05; unpaired two-tailed t -test). L Quantification of immune infiltration by flow cytometry. Total leukocytes and hematopoietic subsets were discriminated using the antibodies indicated on the y -axis. Values represent the mean ± SD from 5 and 8 biological replicates in the control and DTA groups, respectively, with individual replicates indicated by dots (ns, no significant, unpaired two-tailed t-test). Source data are provided as a Source Data file.

Figure Legend Snippet: A Schematic of the TAM-inducible DTA ablation model. The Cre recombinase, inserted into the Postn locus, is controlled by a TAM-inducible estrogen receptor ( MerCreMer ). Upon Postn promoter activation, TAM-induced recombination of the DTA gene results in DTA toxin expression from the rosa26 locus, preventing fibroblast activation and expansion. B Schematic representation of the experimental approach: Mice were inoculated OP with 1 × 10 6 conidia, followed by immunosuppression with triamcinolone acetonide 5 h post-infection. TAM was administered via gavage one day before fungal inoculation and maintained through a TAM-infused chewing diet for the duration of the experiment. C Percent survival of immunosuppressed mice infected with A. fumigatus ( n = 24 for control group and n = 20 for DTA group; p = 3.8 × 10 −5 , log rank test). D Gross appearance of lungs from infected DTA and control mice on day 4 post-infection. E Representative histopathologic images showing focal alveolar hemorrhage and angioinvasion in the A. fumigatus -infected DTA mice by H&E and GMS staining, respectively. F Distribution of alveolar hemorrhage severity in control (white bars) and DTA mice (red bars). Alveolar hemorrhage was scored semi quantitatively as described in Fig. . Data are shown as box-and-whisker plots with individual biological replicates overlaid ( n = 10 for control group and n = 8 for DTA group). Boxes represent the interquartile range (IQR), horizontal lines indicate the median, and whiskers extend to 1.5 x IQR (two-tailed Mann–Whitney U test). G Quantification of angioinvasion in intrapulmonary arteries of control (white bars) and DTA (red bars) mice. The percentage of vessels ≥100 µm in diameter that contained A. fumigatus hyphae in each animal were quantified in GMS-stained lung sections. Values represent the mean ± SD from 10 and 8 biological replicates in the control and DTA groups, respectively, with individual replicates indicated by dots (unpaired two-tailed t -test). H Collagen deposition quantified from Picrosirius Red-stained sections of lung tissue. Values represent the mean ± SD from 10 and 8 biological replicates in the control (white bars) and DTA (red bars) groups, respectively, with individual replicates indicated by dots (ns, no significant; unpaired two-tailed t -test) ( I ) Schematic representation of the experimental approach: similar to the schematic shown in ( B ), but lung tissue was harvested at day 4 post-challenge for further analysis, coinciding with the highest mortality rate observed in ( C ). J Flow cytometric quantification of viable Pdgfrα + cells. Right panels show the cell gating strategy used to distinguish viable and dead cells within the Pdgfrα + population. Values represent the mean ± SD from 5 and 8 biological replicates in the control and DTA groups, respectively ( p = 3.5 × 10 −5 ; unpaired two-tailed t -test). K Fungal burden quantification by RT-qPCR from lung lobes of the indicated mouse models. Fungal burden is expressed as Genome Equivalents (GE) per mg of lung tissue. Values represent the mean ± SD from 5 and 8 biological replicates in the control (white bars) and DTA (red bars) groups, respectively, with individual replicates indicated by dots ( p < 0.05; unpaired two-tailed t -test). L Quantification of immune infiltration by flow cytometry. Total leukocytes and hematopoietic subsets were discriminated using the antibodies indicated on the y -axis. Values represent the mean ± SD from 5 and 8 biological replicates in the control and DTA groups, respectively, with individual replicates indicated by dots (ns, no significant, unpaired two-tailed t-test). Source data are provided as a Source Data file.

Techniques Used: Activation Assay, Expressing, Infection, Control, Staining, Whisker Assay, Two Tailed Test, MANN-WHITNEY, Quantitative RT-PCR, Flow Cytometry

Generated:

Article Title: Lysine-specific histone demethylase 1a regulates nephron development and long-term transcriptional programming
Article Snippet: .. The targeted ablation in nephron progenitor cells was generated using Six2-TGC tg Tg(Six2-EGFP/cre)1Amc/J (hereafter Six2Cre) ( ) purchased from Jackson Laboratory (Bar Harbor, ME, USA). .. The reporter mouse strain Gt(ROSA)26Sor tm4(ACTB-tdTomato,-EGFP)Luo /J (hereafter tomato fl/fl ) ( ) purchased from Jackson Laboratory enabled linage tracing of KDM1A-deficient cells by membranous GFP expression. hNPHS2Cre mice were used for podocyte-specific deletion of Kdm1a and a gift of Lawrence Holzman (Renal, Electrolyte, and Hypertension Division, University of Pennsylvania School of Medicine, Philadelphia, PA) ( ).

Article Title: Rete ridges form via evolutionarily distinct mechanisms in mammalian skin
Article Snippet: .. K14-Cre;Lef1 fl/fl ( Lef1-eKO ) mice were generated by crossing Tg(KRT14-cre)1Amc/J (Jackson Laboratory, 004782) with B6.Cg-Lef1tm1Hhx/J (Jackson Laboratory, 030908) . ..

Article Title: Obesity inhibits hypothalamic activation and luteinizing hormone dynamics through Sox-2-dependent demyelination.
Article Snippet: Female C57BL/6 mice (strain NO. N000013, GemPharmatech, Nanjing, China) and female TetTag mice [23] were used in this study. .. TetTag mice were generated by crossing Tg(tetO-HIST1H2BJ/GFP) 47Efu/J mice (stock number 005104; Jackson Laboratory, USA) with Fos-tTA Fos-EGFP mice (stock number 018306; Jackson Laboratory, USA) and maintained on a C57BL/6J background. ..

Article Title: Rete ridges form via evolutionarily distinct mechanisms in mammalian skin.
Article Snippet: .. K14-Cre;Lef1fl/fl (Lef1-eKO) mice were generated by crossing Tg(KRT14-cre)1Amc/J ( Jackson Laboratory, 004782)61 with B6.Cg-Lef1tm1Hhx/J ( Jackson Laboratory, 030908)62. ..

Mouse Assay:

Article Title: Establishing a long-term versatile culture system for functional mouse mammary organoids from single cells.
Article Snippet: The mammary gland serves as a pivotal model for studying stem cell dynamics and breast cancer, the most prevalent malignancy worldwide.. Developing a long-term organoid culture system to study the normal physiology and pathophysiology of mammary glands in vitro is of paramount importance.. However, current organoid systems lack the morphological and functional fidelity required to model its complex physiology.

Transplantation Assay:

Recombinant:

Article Title: Hyperinnervation inhibits organ-level regeneration in mammalian skin.
Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Collagenase MilliporeSigma Cat#C2674 DAPI Sigma-Aldrich Cat#D9542 Donkey Serum MilliporeSigma Cat#D9663 DPBS without Calcium and Magnesium Thermo Fisher Scientific Cat#14-190-250 Eosin Thermo Fisher Scientific Cat#23-314631 Ethanol Sigma-Aldrich Cat#E7023 Ethyl cinnamate MilliporeSigma Cat#112372 Fetal Bovine Serum Atlanta Biologicals Cat#S12150 Fluoromount-G Mounting Medium SouthernBiotech Cat#0100-01 FluorSave Reagent MilliporeSigma Cat#345789 Gelatin from cold water fish skin Sigma-Aldrich Cat#G7765 Glycerol MilliporeSigma Cat#G7893 Glycine Sigma-Aldrich Cat#G8898 Hank’s Balanced Salt Solution, calcium, magnesium Thermo Fisher Scientific Cat#24020117 Harris Hematoxylin Solution Sigma-Aldrich Cat#HHS128 Henna ink Amazon Cat#B07PFBLVFG Histo-Clear II Electron Microscopy Sciences Cat#64111-04 Hydrochloric acid MilliporeSigma Cat#7647-01-0 Lipopolysaccharides from Escherichia coli O111:B4 Sigma-Aldrich Cat#L2630 Methanol Thermo Fisher Scientific Cat#A412SK-4 Power SYBR Green Thermo Fisher Scientific Cat#4367659 Scott’s Bluing Thermo Fisher Scientific Cat#6697-32 Sucrose Sigma-Aldrich Cat#S0389 Tissue-Tek OCT Sakura Cat#4583 Trichrome Stain (Masson) Kit Sigma-Aldrich Cat#HT15-1 Triton X-100 Electron Microscopy Sciences Cat#22140 TRIzol LS Reagent Thermo Fisher Scientific Cat#10296-028 Trypsin-EDTA (0.25%) Life Technologies Cat#25200-114 TWEEN 20 Sigma-Aldrich Cat#P9416 Veet Gel Hair Removal Cream Sensitive Amazon Cat#IU7 Xylene Thermo Fisher Scientific Cat#422680025 Critical commercial assays Qubit RNA HS Assay Kit Thermo Fisher Scientific Cat#Q32852 RNeasy Micro Kit Qiagen Cat#74004 RNAscope Multiplex Fluorescent Reagent Kit v2 ACD Bio Cat#323100 RNAscope Probe – Mm-Cxcl12 ACD Bio Cat#422711 SuperScript IV VILO Master Mix with ezDNase Enzyme Thermo Fisher Scientific Cat#11766050 ZymoPURE II Plasmid Purification Kit, Midiprep Zymo Research Cat#D4201 Experimental models: Organisms/strains Mouse: C57BL/6J The Jackson Laboratory JAX:000664 Mouse: CCR2 KO (B6.129S4-Ccr2tm1Ifc/J) The Jackson Laboratory JAX:004999 Mouse: CD1 IGS Charles River CRL:002 Mouse: CD64-Cre Zhang et al.102 N/A Mouse: Cxcl12 fl/fl (B6(FVB)Cxcl12tm1.1Link/J) The Jackson Laboratory JAX:021773 (Continued on next page) ll OPEN ACCESS Cell 189, 1–17.e1–e7, May 28, 2026 e2 Please cite this article in press as: Tam et al., Hyperinnervation inhibits organ-level regeneration in mammalian skin, Cell (2026), https:// doi.org/10.1016/j.cell.2026.02.027 Article .. REAGENT or RESOURCE SOURCE IDENTIFIER Mouse: Cxcr4 fl/fl (B6.129P2Cxcr4tm2Yzo/J) The Jackson Laboratory JAX:008767 Mouse: K14-Cre (B6N.Cg-Tg(KRT14cre)1Amc/J) The Jackson Laboratory JAX:018964 Mouse: Pdgfra-Cre (C57BL/6-Tg(Pdgfracre)1Clc/J) The Jackson Laboratory JAX:013148 Mouse: Pdgfra-H2BGFP (B6.129S4Pdgfratm11(EGFP)Sor/J) The Jackson Laboratory JAX:007669 Mouse: Timp1 fl/fl Sutter et al.103 N/A Mouse: Vglut2-Cre (Slc17a6tm2(cre)Lowl/ J) The Jackson Laboratory JAX:016963 Oligonucleotides Primer: β-actin forward (GGCTGTATTCCCCTCCATCG) This paper N/A Primer: β-actin reverse (CCAGTTGGTAACAATGCCATGT) This paper N/A Primer: Cxcr4 forward (GGGGTCATCAAGCAAGGATGT) This paper N/A Primer: Cxcr4 reverse (CATAGAGGATGGGGTTCAGGC) This paper N/A Primer: WPRE forward (CTGCTTTAATGCCTTTGTATCATGCTAT) This paper N/A Primer: WPRE reverse (CAACTCCTCATAAAGAGACAGCAACCA) This paper N/A Primer: β-actin forward (GGCTGTATTCCCCTCCATCG) This paper N/A Primer: β-actin reverse (CCAGTTGGTAACAATGCCATGT) This paper N/A Primer: Cxcr4 forward (GGGGTCATCAAGCAAGGATGT) This paper N/A Primer: Cxcr4 reverse (CATAGAGGATGGGGTTCAGGC) This paper N/A Primer: WPRE forward (CTGCTTTAATGCCTTTGTATCATGCTAT) This paper N/A Primer: WPRE reverse (CAACTCCTCATAAAGAGACAGCAACCA) This paper N/A Recombinant DNA pAAV-CAG-Ccl7-t2A-EGFP This paper N/A pAAV-CAG-Ccl8-t2A-EGFP This paper N/A pAAV-CAG-Clu-3xHA This paper N/A pAAV-CAG-Crispld2-3xHA This paper N/A pAAV-CAG-Cxcl12-t2A-EGFP This paper N/A pAAV-CAG-H2B-mCherry This paper N/A pAAV-CAG-Mmp19-3xHA This paper N/A pAAV-CAG-Ngf-t2A-EGFP This paper N/A pAAV-CAG-Sod3-t2A-EGFP This paper N/A pAAV-CAG-Spp1-t2A-EGFP This paper N/A pAAV-CAG-tdTomato Addgene Addgene:59462 pAAV-CAG-Timp1-t2A-mRFP This paper N/A pAAV-flex-taCasp3-TEVp Addgene Addgene:45580 pLV-GFP Addgene Addgene:25999 (Continued on next page) ll OPEN ACCESS e3 Cell 189, 1–17.e1–e7, May 28, 2026 Please cite this article in press as: Tam et al., Hyperinnervation inhibits organ-level regeneration in mammalian skin, Cell (2026), https:// doi.org/10.1016/j.cell.2026.02.027 Article .. CD1 mice were obtained from Charles River Laboratories.

Knock-Out:

Article Title: A cilia-dependent inflammatory programme links bacterial detection to kidney disease
Article Snippet: .. Kif3a flox/flox mice (Kif3a tm1Gsn , C57BL/6 background, kindly provided by Peter Igarashi, Stony Brook University) and Ift20 flox/flox mice (Ift20 tm1.1Gjp , kindly provided by Gregory Pazour, UMass Chan Medical School) were crossed with Pax.8rtTA (Tg[Pax8-rtTA2S*M2]1Koes, Jackson Laboratory) and TetO.Cre (Tg[tetO-cre]1Jaw, Jackson Laboratory) mice to generate inducible, tubule-specific Kif3a knockout ( Kif3a ΔTub ) and Ift20 knockout ( Ift20 ΔTub ) lines. .. Kif3a flox/flox mice (Kif3a tm1Gsn , C57BL/6 background, kindly provided by Peter Igarashi, Stony Brook University) and Ift20 flox/flox mice (Ift20 tm1.1Gjp , kindly provided by Gregory Pazour, UMass Chan Medical School) were crossed with Pax.8rtTA (Tg[Pax8-rtTA2S*M2]1Koes, Jackson Laboratory) and TetO.Cre (Tg[tetO-cre]1Jaw, Jackson Laboratory) mice to generate inducible, tubule-specific Kif3a knockout ( Kif3a ΔTub ) and Ift20 knockout ( Ift20 ΔTub ) lines.

Review