pcr mixture (Qiagen)

Qiagen is a verified supplier

Qiagen manufactures this product

About

News

Press Release

Team

Advisors

Partners

Contact

Bioz Stars

Bioz vStars

Buy from Supplier

Structured Review

Qiagen pcr mixture
Pcr Mixture, supplied by Qiagen, used in various techniques. Bioz Stars score: 95/100, based on 401 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/dntp/dNTP+Mix%2C+PCR+Grade/pm12446591-115-1-16
Average 95 stars, based on 401 article reviews

pcr mixture - by Bioz Stars, 2026-10

95/100 stars

Images

Amplification:

Article Title: First Molecular Characterization and Comprehensive Bioinformatic Analysis of Avian Infectious Bronchitis Virus from Uzbekistan Reveals GI-1, GI-13, and GI-23 Genotypes in Broilers.
Article Snippet: .. The first amplification round was performed in a final volume of 25 μL containing 0.5 μL each of primers SX1+ (CACCTAGAGGTTTGT/CTA/TGCAT) and SX2− (TCCACCTCTATAAACACCC/TTT), 2.5 μL of RNA template, 5 μL of OneStep RT-PCR Buffer (Qiagen, Hilden, Germany), 1 μL of OneStep RT-PCR Enzyme Mix (Qiagen), 1 μL of dNTP mix (Qiagen), and 14.5 μL of nuclease-free water. .. For the second nested PCR, a 20 μL reaction was prepared containing 0.4 μL each of primers SX3+ (TAATACTGGC/TAATTTTTCAGA) and SX4− (AATACAGATTGCTTACAACCACC), 10 μL of Taq PCR Master Mix (Qiagen), 7.2 μL of nuclease-free water, and 2 μL of the first-round amplicon as template.

Article Title: The neurexin1β histidine-rich domain is involved in excitatory presynaptic organization and short-term plasticity
Article Snippet: .. PCR 140 amplification was carried out using the following reaction mix: 2 μL of 10X Qiagen buffer 141 (Cat# 201223, Qiagen), 0.4 μL of dNTP mix (Cat# 201900, Qiagen), 1 μL of forward 142 primer at 10 μm (5’-TCTTCTCTTCTTGTGCCCCAAAC-3’), 1 μL of reverse primer at 10 143 μm (5’-GCCTTCACCCATCCCTTTCTATTG-3’), 0.05 μL of Taq DNA polymerase at 5 144 U/μL (Cat# 201223, Qiagen) and 0.5 μL of the previously extracted DNA. .. PCR was 145 performed using a Mastercycler® Nexus Gradient GSX1 Thermal Cycler (Cat# 8125-30-146 1027, Eppendorf) under the following conditions: 94 °C for 2 mins, (94 °C for 30s, 61 °C 147 for 30s, 72 °C for 90s) x35cycles and 72 °C for 7 mins.

Article Title: The Neurexin1β Histidine-Rich Domain Is Involved in Excitatory Presynaptic Organization and Short-Term Plasticity
Article Snippet: .. PCR amplification was carried out using the following reaction mix: 2 μl of 10× Qiagen buffer (catalog #201223, Qiagen), 0.4 μl of dNTP mix (catalog #201900, Qiagen), 1 μl of forward primer at 10 μM (5′-TCTTCTCTTCTTGTGCCCCAAAC-3′), 1 μl of reverse primer at 10 μM (5′-GCCTTCACCCATCCCTTTCTATTG-3′), 0.05 μl of Taq DNA polymerase at 5 U/μl (catalog #201223, Qiagen), and 0.5 μl of the previously extracted DNA. .. PCR was performed using a Mastercycler Nexus Gradient GSX1 Thermal Cycler (catalog #8125-30-1027, Eppendorf) under the following conditions: 94°C for 2 min, (94°C for 30 s, 61°C for 30 s, 72°C for 90 s) ×35cycles and 72°C for 7 min. After the PCR, 4 μl of 6× gel loading dye (catalog #B7024S, New England Biolabs) was added to the PCR product, and the samples were loaded onto a 2% agarose gel containing 0.004% ethidium bromide and run at 100 V for 40 min. DNA bands were visualized using a UVP BioDoc-It imaging system (catalog #17-1718, Taylor Scientific).

Article Title: Identifying Genetic Predisposition and Clinical Risk Factors for Breast Cancer-Related Lymphedema: Toward Personalized Prevention.
Article Snippet: Background: Breast cancer-related lymphedema (BCRL) remains a major chronic complication following axillary lymph node dissection (ALND), particularly in regions where locally advanced breast cancer is prevalent.. While several clinical factors have been identified, the role of genetic predisposition in BCRL development remains underexplored.. This study aimed to identify genetic and clinical factors associated with the development of BCRL, focusing on the Gap Junction Protein Alpha-4 (GJA4) rs705193 mutation as a potential biomarker.

Article Title: First Molecular Characterization and Comprehensive Bioinformatic Analysis of Avian Infectious Bronchitis Virus from Uzbekistan Reveals GI-1, GI-13, and GI-23 Genotypes in Broilers
Article Snippet: .. The first amplification round was performed in a final volume of 25 μL containing 0.5 μL each of primers SX1+ (CACCTAGAGGTTTGT/CTA/TGCAT) and SX2− (TCCACCTCTATAAACACCC/TTT), 2.5 μL of RNA template, 5 μL of OneStep RT-PCR Buffer (Qiagen, Hilden, Germany), 1 μL of OneStep RT-PCR Enzyme Mix (Qiagen), 1 μL of dNTP mix (Qiagen), and 14.5 μL of nuclease-free water. .. For the second nested PCR, a 20 μL reaction was prepared containing 0.4 μL each of primers SX3+ (TAATACTGGC/TAATTTTTCAGA) and SX4− (AATACAGATTGCTTACAACCACC), 10 μL of Taq PCR Master Mix (Qiagen), 7.2 μL of nuclease-free water, and 2 μL of the first-round amplicon as template.

Reverse Transcription Polymerase Chain Reaction:

Article Title: Retrospective analysis of possible associations between Pneumocystis spp. and five immunosuppressive viral pathogens in three wild carnivore species.
Article Snippet: .. The first round used a 20 μL reaction containing 4 μL of 5× Qiagen OneStep RT-PCR Buffer, 4 μL of QSolution, 0.8 μL dNTP mix, Qiagen enzyme mix (Qiagen, Les Ulis, France), ACCEPTED MANUSCRIPT AR TIC LE IN PR ES S ARTICLE IN PRESS ..

Article Title: Retrospective analysis of possible associations between Pneumocystis spp. and five immunosuppressive viral pathogens in three wild carnivore species
Article Snippet: .. The first round used a 20 μL reaction containing 4 μL of 5× Qiagen OneStep RT-PCR Buffer, 4 μL of QSolution, 0.8 μL dNTP mix, Qiagen enzyme mix (Qiagen, Les Ulis, France), 1.2 μL of each 10 mM primer (CCV1 fw: 5′-GGCGTAACTGATGGACCACG-3′, CCV2 rv: 5′-CTTGTACGGGCGGCAACATC-3′), 2 μL RNA template, and nuclease-free water. ..

Article Title: First Molecular Characterization and Comprehensive Bioinformatic Analysis of Avian Infectious Bronchitis Virus from Uzbekistan Reveals GI-1, GI-13, and GI-23 Genotypes in Broilers
Article Snippet: .. The first amplification round was performed in a final volume of 25 μL containing 0.5 μL each of primers SX1+ (CACCTAGAGGTTTGT/CTA/TGCAT) and SX2− (TCCACCTCTATAAACACCC/TTT), 2.5 μL of RNA template, 5 μL of OneStep RT-PCR Buffer (Qiagen, Hilden, Germany), 1 μL of OneStep RT-PCR Enzyme Mix (Qiagen), 1 μL of dNTP mix (Qiagen), and 14.5 μL of nuclease-free water. .. For the second nested PCR, a 20 μL reaction was prepared containing 0.4 μL each of primers SX3+ (TAATACTGGC/TAATTTTTCAGA) and SX4− (AATACAGATTGCTTACAACCACC), 10 μL of Taq PCR Master Mix (Qiagen), 7.2 μL of nuclease-free water, and 2 μL of the first-round amplicon as template.

Polymerase Chain Reaction:

Article Title: Feasibility of Patient-Derived 3D Gastrointestinal Stromal Tumour Models as Alternatives for In Vivo Mouse Models
Article Snippet: DNA from cell pellets or FFPE tissue was extracted using the AllPrep DNA/RNA FFPE Kit (Qiagen) according to the manufacturers protocol. .. The PCR master mix was prepared using 200 ng DNA, 10× PCR-Puffer (Qiagen), dNTPs (1,25 mM each), Hot Star Taq (5 U/μL, Qiagen), and forwards and reverse primers (10 pmol/μL each). ..

Review

pcr mixture (Qiagen)

Structured Review

Images

Related Articles

Amplification:

Reverse Transcription Polymerase Chain Reaction:

Polymerase Chain Reaction:

Mutagenesis:

Similar Products

Image Search Results