Review



si rna si dnmt1 target sequence 5 atctatggaaggtggtattaa  (Proteintech)


Bioz Verified Symbol Proteintech is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 94

    Structured Review

    Proteintech si rna si dnmt1 target sequence 5 atctatggaaggtggtattaa
    Si Rna Si Dnmt1 Target Sequence 5 Atctatggaaggtggtattaa, supplied by Proteintech, used in various techniques. Bioz Stars score: 94/100, based on 99 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/dnmt3a+sequence/DNMT3A+Antibody/ppr0631373-266-101-129
    Average 94 stars, based on 99 article reviews
    si rna si dnmt1 target sequence 5 atctatggaaggtggtattaa - by Bioz Stars, 2026-09
    94/100 stars

    Images



    Similar Products

    90
    Shanghai GenePharma cds sequence of dnmt3a
    Cds Sequence Of Dnmt3a, supplied by Shanghai GenePharma, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/dnmt3a+sequence/dnmt1+sirna/pm40456336-48-4-8
    Average 90 stars, based on 1 article reviews
    cds sequence of dnmt3a - by Bioz Stars, 2026-09
    90/100 stars
      Buy from Supplier

    90
    Genechem mutant-type sequences of dnmt3a
    Mutant Type Sequences Of Dnmt3a, supplied by Genechem, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/dnmt3a+sequence/sh+rna+against+dnmt3a/pm40227561-77-13-17
    Average 90 stars, based on 1 article reviews
    mutant-type sequences of dnmt3a - by Bioz Stars, 2026-09
    90/100 stars
      Buy from Supplier

    93
    Addgene inc dnmt3a sequence
    Schematic overview of the CRISPR/dCas9- <t>dnmt3a</t> editing system for the emx2 promoter region of Chinese tongue sole testis cells. ( A ) Edit system schematic diagram. ( B ) dCas9- dnmt3a plasmid structure diagram and sgRNA plasmid structure diagram. ( C ) The sequence of the sgRNAs. ( D ) Bisulfite sequencing positions and sgRNA sites of emx2 ; lollipop chart on the left represents bisulfite sequencing of the CpGs’ position. The arrows indicate the target sequence of the designed sgRNAs, with the direction of the arrows aligning with the target sequence.
    Dnmt3a Sequence, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/dnmt3a+sequence/Fuw-dCas9-Dnmt3a+(Plasmid+%2384476)/pmc11277268-135-1-7
    Average 93 stars, based on 1 article reviews
    dnmt3a sequence - by Bioz Stars, 2026-09
    93/100 stars
      Buy from Supplier

    90
    Ribobio co pcdna3.1 vectors sub-cloned with the whole sequence of dnmt3a
    Schematic overview of the CRISPR/dCas9- <t>dnmt3a</t> editing system for the emx2 promoter region of Chinese tongue sole testis cells. ( A ) Edit system schematic diagram. ( B ) dCas9- dnmt3a plasmid structure diagram and sgRNA plasmid structure diagram. ( C ) The sequence of the sgRNAs. ( D ) Bisulfite sequencing positions and sgRNA sites of emx2 ; lollipop chart on the left represents bisulfite sequencing of the CpGs’ position. The arrows indicate the target sequence of the designed sgRNAs, with the direction of the arrows aligning with the target sequence.
    Pcdna3.1 Vectors Sub Cloned With The Whole Sequence Of Dnmt3a, supplied by Ribobio co, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/dnmt3a+sequence/dnmt1+sirna/pm36376550-32-9-17
    Average 90 stars, based on 1 article reviews
    pcdna3.1 vectors sub-cloned with the whole sequence of dnmt3a - by Bioz Stars, 2026-09
    90/100 stars
      Buy from Supplier

    94
    Proteintech si rna si dnmt1 target sequence 5 atctatggaaggtggtattaa
    Schematic overview of the CRISPR/dCas9- <t>dnmt3a</t> editing system for the emx2 promoter region of Chinese tongue sole testis cells. ( A ) Edit system schematic diagram. ( B ) dCas9- dnmt3a plasmid structure diagram and sgRNA plasmid structure diagram. ( C ) The sequence of the sgRNAs. ( D ) Bisulfite sequencing positions and sgRNA sites of emx2 ; lollipop chart on the left represents bisulfite sequencing of the CpGs’ position. The arrows indicate the target sequence of the designed sgRNAs, with the direction of the arrows aligning with the target sequence.
    Si Rna Si Dnmt1 Target Sequence 5 Atctatggaaggtggtattaa, supplied by Proteintech, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/dnmt3a+sequence/DNMT3A+Antibody/ppr0631373-266-101-129
    Average 94 stars, based on 1 article reviews
    si rna si dnmt1 target sequence 5 atctatggaaggtggtattaa - by Bioz Stars, 2026-09
    94/100 stars
      Buy from Supplier

    95
    Addgene inc dcas9 dnmt3a puror sequence
    Schematic overview of the CRISPR/dCas9- <t>dnmt3a</t> editing system for the emx2 promoter region of Chinese tongue sole testis cells. ( A ) Edit system schematic diagram. ( B ) dCas9- dnmt3a plasmid structure diagram and sgRNA plasmid structure diagram. ( C ) The sequence of the sgRNAs. ( D ) Bisulfite sequencing positions and sgRNA sites of emx2 ; lollipop chart on the left represents bisulfite sequencing of the CpGs’ position. The arrows indicate the target sequence of the designed sgRNAs, with the direction of the arrows aligning with the target sequence.
    Dcas9 Dnmt3a Puror Sequence, supplied by Addgene inc, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/dnmt3a+sequence/DNMT3A-dCas9+(Plasmid+%23100090)/pm36318971-113-17-37
    Average 95 stars, based on 1 article reviews
    dcas9 dnmt3a puror sequence - by Bioz Stars, 2026-09
    95/100 stars
      Buy from Supplier

    93
    Addgene inc t2a egfp coding sequences downstream
    Schematic overview of the CRISPR/dCas9- <t>dnmt3a</t> editing system for the emx2 promoter region of Chinese tongue sole testis cells. ( A ) Edit system schematic diagram. ( B ) dCas9- dnmt3a plasmid structure diagram and sgRNA plasmid structure diagram. ( C ) The sequence of the sgRNAs. ( D ) Bisulfite sequencing positions and sgRNA sites of emx2 ; lollipop chart on the left represents bisulfite sequencing of the CpGs’ position. The arrows indicate the target sequence of the designed sgRNAs, with the direction of the arrows aligning with the target sequence.
    T2a Egfp Coding Sequences Downstream, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/dnmt3a+sequence/pdCas9-DNMT3A-EGFP+(Plasmid+%2371666)/pmc08378768-139-19-29
    Average 93 stars, based on 1 article reviews
    t2a egfp coding sequences downstream - by Bioz Stars, 2026-09
    93/100 stars
      Buy from Supplier

    94
    Addgene inc dnmt3a knockout ascs lines guide rna sequences
    Schematic overview of the CRISPR/dCas9- <t>dnmt3a</t> editing system for the emx2 promoter region of Chinese tongue sole testis cells. ( A ) Edit system schematic diagram. ( B ) dCas9- dnmt3a plasmid structure diagram and sgRNA plasmid structure diagram. ( C ) The sequence of the sgRNAs. ( D ) Bisulfite sequencing positions and sgRNA sites of emx2 ; lollipop chart on the left represents bisulfite sequencing of the CpGs’ position. The arrows indicate the target sequence of the designed sgRNAs, with the direction of the arrows aligning with the target sequence.
    Dnmt3a Knockout Ascs Lines Guide Rna Sequences, supplied by Addgene inc, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/dnmt3a+sequence/DNMT3A+(Plasmid+%2325328)/pmc07940253__mmc1-78-2-15
    Average 94 stars, based on 1 article reviews
    dnmt3a knockout ascs lines guide rna sequences - by Bioz Stars, 2026-09
    94/100 stars
      Buy from Supplier

    94
    Addgene inc dnmt3a knockout asc lines guide rna sequences
    Schematic overview of the CRISPR/dCas9- <t>dnmt3a</t> editing system for the emx2 promoter region of Chinese tongue sole testis cells. ( A ) Edit system schematic diagram. ( B ) dCas9- dnmt3a plasmid structure diagram and sgRNA plasmid structure diagram. ( C ) The sequence of the sgRNAs. ( D ) Bisulfite sequencing positions and sgRNA sites of emx2 ; lollipop chart on the left represents bisulfite sequencing of the CpGs’ position. The arrows indicate the target sequence of the designed sgRNAs, with the direction of the arrows aligning with the target sequence.
    Dnmt3a Knockout Asc Lines Guide Rna Sequences, supplied by Addgene inc, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/dnmt3a+sequence/DNMT3A+(Plasmid+%2325328)/pmc07940253__mmc2-230-2-15
    Average 94 stars, based on 1 article reviews
    dnmt3a knockout asc lines guide rna sequences - by Bioz Stars, 2026-09
    94/100 stars
      Buy from Supplier

    Image Search Results


    Schematic overview of the CRISPR/dCas9- dnmt3a editing system for the emx2 promoter region of Chinese tongue sole testis cells. ( A ) Edit system schematic diagram. ( B ) dCas9- dnmt3a plasmid structure diagram and sgRNA plasmid structure diagram. ( C ) The sequence of the sgRNAs. ( D ) Bisulfite sequencing positions and sgRNA sites of emx2 ; lollipop chart on the left represents bisulfite sequencing of the CpGs’ position. The arrows indicate the target sequence of the designed sgRNAs, with the direction of the arrows aligning with the target sequence.

    Journal: International Journal of Molecular Sciences

    Article Title: CRISPR/dCas9-Mediated DNA Methylation Editing on emx2 in Chinese Tongue Sole ( Cynoglossus semilaevis ) Testis Cells

    doi: 10.3390/ijms25147637

    Figure Lengend Snippet: Schematic overview of the CRISPR/dCas9- dnmt3a editing system for the emx2 promoter region of Chinese tongue sole testis cells. ( A ) Edit system schematic diagram. ( B ) dCas9- dnmt3a plasmid structure diagram and sgRNA plasmid structure diagram. ( C ) The sequence of the sgRNAs. ( D ) Bisulfite sequencing positions and sgRNA sites of emx2 ; lollipop chart on the left represents bisulfite sequencing of the CpGs’ position. The arrows indicate the target sequence of the designed sgRNAs, with the direction of the arrows aligning with the target sequence.

    Article Snippet: The dnmt3a sequence and the fuw-dCas9 plasmid (Addgene #84476, Watertown, MA, USA) were digested with HamI (NEB) and EcoRI (NEB) enzymes at 37 °C for 2 h, respectively.

    Techniques: CRISPR, Plasmid Preparation, Sequencing, Methylation Sequencing

    CRISPR/dCas9-mediated DNA methylation editing on emx2 gene. DNA methylation status of the emx2 promoter region with the ( A ) blank control; ( B ) dCas9- dnmt3a ; ( C ) dCas9- dnmt3a and sgRNA1; ( D ) dCas9- dnmt3a and sgRNA2; ( E ) dCas9- dnmt3a and sgRNA3; ( F ) dCas9- dnmt3a and sgRNA4; ( G ) dCas9- dnmt3a and sgRNA5; ( H ) dCas9- dnmt3a and sgRNA6; ( I ) dCas9- dnmt3a and sgRNA1+3; ( J ) Percentage of DNA methylation levels at emx2 promoter region with different treatments; ( K ) Relative expression of emx2 after transfection of dCas9- dnmt3a and different sgRNAs. Filled (black) circles correspond to methylated CpGs, unfilled (white) circles correspond to unmethylated CpGs. Upper black lines indicate statistical difference among blank control and sgRNA groups, while lines below the graph highlight that the sgRNAs were co-transfected with the CRISPR/dCas9- dnmt3a vector. The asterisks (*) are used to denote significant differences among groups using two-way ANOVA and Tukey’s multiple comparisons. *** p < 0.001, **** p < 0.0001.

    Journal: International Journal of Molecular Sciences

    Article Title: CRISPR/dCas9-Mediated DNA Methylation Editing on emx2 in Chinese Tongue Sole ( Cynoglossus semilaevis ) Testis Cells

    doi: 10.3390/ijms25147637

    Figure Lengend Snippet: CRISPR/dCas9-mediated DNA methylation editing on emx2 gene. DNA methylation status of the emx2 promoter region with the ( A ) blank control; ( B ) dCas9- dnmt3a ; ( C ) dCas9- dnmt3a and sgRNA1; ( D ) dCas9- dnmt3a and sgRNA2; ( E ) dCas9- dnmt3a and sgRNA3; ( F ) dCas9- dnmt3a and sgRNA4; ( G ) dCas9- dnmt3a and sgRNA5; ( H ) dCas9- dnmt3a and sgRNA6; ( I ) dCas9- dnmt3a and sgRNA1+3; ( J ) Percentage of DNA methylation levels at emx2 promoter region with different treatments; ( K ) Relative expression of emx2 after transfection of dCas9- dnmt3a and different sgRNAs. Filled (black) circles correspond to methylated CpGs, unfilled (white) circles correspond to unmethylated CpGs. Upper black lines indicate statistical difference among blank control and sgRNA groups, while lines below the graph highlight that the sgRNAs were co-transfected with the CRISPR/dCas9- dnmt3a vector. The asterisks (*) are used to denote significant differences among groups using two-way ANOVA and Tukey’s multiple comparisons. *** p < 0.001, **** p < 0.0001.

    Article Snippet: The dnmt3a sequence and the fuw-dCas9 plasmid (Addgene #84476, Watertown, MA, USA) were digested with HamI (NEB) and EcoRI (NEB) enzymes at 37 °C for 2 h, respectively.

    Techniques: CRISPR, DNA Methylation Assay, Control, Expressing, Transfection, Methylation, Plasmid Preparation

    Off-target effects of CRISPR/dCas9- dnmt3a system. DNA methylation of the promoter region of ( A ) slc20a2 ; ( B ) ddx17 ; ( C ) katb6 and ( D ) xpa and relative expression of potential off-target genes ( E ) slc20a2 ; ( F ) ddx17 ; ( G ) katb6 and ( H ) xpa . Upper black lines indicate statistical difference between the blank control and sgRNA3 groups, while lines below the graph highlight that the sgRNAs were co-transfected with the CRISPR/dCas9- dnmt3a vector. The asterisks (*) are used to denote significant differences between groups using two-way ANOVA and Tukey’s multiple comparisons. *** p < 0.001.

    Journal: International Journal of Molecular Sciences

    Article Title: CRISPR/dCas9-Mediated DNA Methylation Editing on emx2 in Chinese Tongue Sole ( Cynoglossus semilaevis ) Testis Cells

    doi: 10.3390/ijms25147637

    Figure Lengend Snippet: Off-target effects of CRISPR/dCas9- dnmt3a system. DNA methylation of the promoter region of ( A ) slc20a2 ; ( B ) ddx17 ; ( C ) katb6 and ( D ) xpa and relative expression of potential off-target genes ( E ) slc20a2 ; ( F ) ddx17 ; ( G ) katb6 and ( H ) xpa . Upper black lines indicate statistical difference between the blank control and sgRNA3 groups, while lines below the graph highlight that the sgRNAs were co-transfected with the CRISPR/dCas9- dnmt3a vector. The asterisks (*) are used to denote significant differences between groups using two-way ANOVA and Tukey’s multiple comparisons. *** p < 0.001.

    Article Snippet: The dnmt3a sequence and the fuw-dCas9 plasmid (Addgene #84476, Watertown, MA, USA) were digested with HamI (NEB) and EcoRI (NEB) enzymes at 37 °C for 2 h, respectively.

    Techniques: CRISPR, DNA Methylation Assay, Expressing, Control, Transfection, Plasmid Preparation

    Effects on downstream genes after the emx2 promoter region methylated. Relative expression of downstream genes ( A ) myc , ( B ) klf4 , and ( C ) wnt1 . Upper black lines indicate statistical difference among blank control and sgRNA groups for myc expression, while lines below the graph highlight that the sgRNAs were co-transfected with the CRISPR/dCas9- dnmt3a vector. The asterisks (*) are used to denote significant differences between groups using two-way ANOVA and Tukey’s multiple comparisons. *** p < 0.001.

    Journal: International Journal of Molecular Sciences

    Article Title: CRISPR/dCas9-Mediated DNA Methylation Editing on emx2 in Chinese Tongue Sole ( Cynoglossus semilaevis ) Testis Cells

    doi: 10.3390/ijms25147637

    Figure Lengend Snippet: Effects on downstream genes after the emx2 promoter region methylated. Relative expression of downstream genes ( A ) myc , ( B ) klf4 , and ( C ) wnt1 . Upper black lines indicate statistical difference among blank control and sgRNA groups for myc expression, while lines below the graph highlight that the sgRNAs were co-transfected with the CRISPR/dCas9- dnmt3a vector. The asterisks (*) are used to denote significant differences between groups using two-way ANOVA and Tukey’s multiple comparisons. *** p < 0.001.

    Article Snippet: The dnmt3a sequence and the fuw-dCas9 plasmid (Addgene #84476, Watertown, MA, USA) were digested with HamI (NEB) and EcoRI (NEB) enzymes at 37 °C for 2 h, respectively.

    Techniques: Methylation, Expressing, Control, Transfection, CRISPR, Plasmid Preparation