Saline:Article Title: 4-Hydroxybenzoic acid rescues multisystemic disease and perinatal lethality in a mouse model of mitochondrial disease.
Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies COQ2 Origene/Quimigen Cat# TA341982; RRID: AB_3096491 COQ5 Novus Biologicals Cat# NBP2-82738; RRID: AB_3096493 COQ4 Proteintech Cat# 16654-1-AP; RRID: AB_2878296 COQ7 Proteintech Cat# 15083-1-AP; RRID: AB_2082207 VDAC Abcam Cat# ab14734; RRID: AB_443084 GFAP Millipore Cat# MAB360; RRID: AB_11212597 NeuN Abcam Cat# ab104224; RRID: AB_10711040 MBP Abcam Cat# ab218011; RRID: AB_2895537 IBA-1 FUJIFILM Wako Cat# 019-19741; RRID: AB_839504 Goat anti-Rabbit IgG (H + L) Secondary Antibody, HRP Thermo Fisher Cat# 31460; RRID: AB_228341 HRP Goat anti-mouse Ig BD Pharmigen Cat# 554002; RRID: AB_395198 Anti-mouse Alexa 594 Abcam Cat# ab150116; RRID: AB_2650601 Anti-Rabbit Alexa 488 conjugated Abcam Cat# ab150077; RRID: AB_2630356 Chemicals, peptides, and recombinant proteins Bouin’s Fluids Thermo Fisher Cat# 7211 Paraformaldehyde Panreac Applichem Cat# 2.529.311.315 Ethanol Absolute VWR Cat# 20821.330 Mayer’s Hematoxylin solution Sigma-Aldrich Cat# MHS16 Eosin Y Solution Sigma-Aldrich Cat# HT110116 Periodic Acid Sigma-Aldrich Cat# P7875-25G Schiff Reagent Sigma-Aldrich Cat# 3952016 Xylene (isomeric mixture) Sigma-Aldrich Cat# 1.08298.4000 Permount Mounting Media Thermo Fisher Cat# 15832544 ProLongTM Gold Antifade Mountant with DAPI Thermo Scientific Cat# P36931 Ammonium Chloride Sigma-Aldrich Cat# A4514 Sodium Citrate Panreac Applichem Cat# 1.416.551.211 4-Hydroxybenzoic acid Sigma-Aldrich Cat# H20059 Gadovist Bayer Cat# 735506.9 Top Vision Agarose Thermo Scientific Cat# R0491 Coenzyme Q9 Sigma-Aldrich Cat# 27597 Coenzyme Q10 Sigma-Aldrich #Cat C9538 Glacial Acetic Acid HPLC VWR (Panreac) Cat# 3.610.081.612 Sodium Acetate Sigma-Aldrich Cat# 3691771 2-Propanol HPLC Sigma-Aldrich Cat# 34863 1-Propanol HPLC Sigma-Aldrich Cat# 34871 Ethanol HPLC Scharlau Cat# ME03062500 Methanol HPLC Scharlau Cat# ME03062500 SDS Sigma-Aldrich Cat# L3771 Hexane Sigma-Aldrich Cat# 650552 DNAse/RNAse free water VWR Cat# E476 Agarose Thermo Fisher Cat# BP164-500 RedSafe Sical (Intron) Cat# 21141 PMSG MSD Animal Health Cat# 581135.2 (Continued on next page) Cell Reports --, 114148, --, 2024 13 .. REAGENT or RESOURCE SOURCE IDENTIFIER HCG DFV Divasa Farmavic Cat# 573676.1 TRI Reagent Solution (Trizol) Thermo Fisher Cat# AM9738 Cloroform VWR Cat# 83626-320 Loading Dye Thermo Fisher Cat# R0611 RIPA Buffer Thermo Scientific Cat# 89900 Halt Protease and Phosphatase Inhibitor Cocktail Thermo Scientific Cat# 78440 EDTA Sigma-Aldrich Cat# ED4SS 2-Mercaptoethanol BIO-RAD Cat# 161-0710 Laemli Sample Buffer BIO-RAD Cat# 161-0747 TGS BIO-RAD Cat# 161-0772 Spectra Multicolor Broad Range Protein Ladder Thermo Scientific Cat# 26634 Phosphate Buffered Saline Fisher Bioreagents Cat# BP399-20 Tween 20 Ultrapure Thermo ScientificTM Cat# J20605.AP Clarity Western ECL Substrate Biorad Cat# 1705061 Stripping Buffer LabClinics Cat# 60-0088 Fatty acid-free Bovine Serum Albumin Sigma-Aldrich Cat# A7030 Bradford Reagent VWR Cat# M172 TRIS Panreac Applichem Cat# 131940.1211 Succinate Sigma-Aldrich Cat# S2378 Sodium Piruvate Fisher Scientific Cat# 11360-070 Rotenone Sigma-Aldrich Cat# R8875 Oligomycin from Streptomyces diastatochromogenes Sigma-Aldrich Cat# O4876 Acetil coenzimaA trisodium salt Sigma-Aldrich Cat# A2056 Adenosine 50-diphosphate sodium salt Sigma-Aldrich Cat# A2754 5,50-Dithiobis(2-nitrobenzoic acid) Sigma-Aldrich Cat# D-8130 Carbonyl cyanide 4-(trifluoromethoxy)phenylhydrazone Sigma-Aldrich Cat# C292 Cytocrome C Sigma-Aldrich Cat# C7752 D-Manitol Thermo Fisher Cat# 125340010 EGTA Sigma-Aldrich Cat# E4378 HEPES Sigma-Aldrich Cat# H4034 L-Glutamic acid monosodium salt hydrate Sigma-Aldrich Cat# G1626 Magnesium chloride Sigma-Aldrich Cat# 5927 NADH Sigma-Aldrich Cat#N6005 Oxaloacetic acid Sigma-Aldrich Cat# O4126 Potasium Phosphate Sigma-Aldrich Cat# P3786 Potassium cyanide Sigma-Aldrich Cat# 60178 Potassium phosphate, monobasic Thermo Fisher Cat# 212595000 Sacarose Sigma-Aldrich Cat# S-0389 Hydrochloric Acid Scharlau Cat# AC07361000 DMEM (1X) + GlutaMAX Gibco Cat# 61965-059 FBS Thermo Fisher Cat# 11573397 Amino acids Thermo Fisher Cat# 11350912 Normocin Ibian Cat# ant-nr-2 DMSO Thermo Fisher Cat# 67-68-5 L-Glutamine 200mM (100X) Gibco Cat# 11500626 Glucose Panreac Applichem Cat# 1.413.411.210 (Continued on next page) 14 Cell Reports --, 114148, --, 2024 OPEN ACCESS .. REAGENT or RESOURCE SOURCE IDENTIFIER CARBONYL CYANIDE (trifluoromethoxy)phenyl hidrazone (FCCP) Sigma-Aldrich Cat# C2920-10MG Antimycin A Sigma-Aldrich Cat# A8674 Perchloric acid Panreac Applichem Cat# 142175 KOH Sigma-Aldrich Cat# 1.050.331.000 Tetrabutylammonium hydrogen sulfate Sigma-Aldrich Cat# T-7158 DMEM (1X) -Glucose Gibco Cat# 11966-025 Potassium Dihydrogen Phosphate Acros Cat# 212595000 XF Assay Medium Modified DMEM Agilent Technologies Cat# 102365-100 Trypan Blue Gibco Cat# 15250-061 Critical commercial assays Mouse Direct PCR Kit Deltaclon CAT #B40015 MINI-PROTEAN TGX Gels 4–20% 10-well, 30 BIO-RAD Cat# 456-1093 Trans-Blot Turbo Transfer Pack BIO-RAD Cat# 1704156 Brilliant III Ultra-Fast qPCR Master Mix Agilent Cat# 600880 High capacity cDNA reverse transcription kit Thermo Fisher Cat# 4368814 Seahorse XFe24 FluxPak Agilent Cat# 102340-100 Experimental models: Cell lines See Table S1 N/A Experimental models: Organisms/strains Mouse: Coq2A252V This paper N/A Oligonucleotides Primer: 3’ - GGACCAGGTTAAAATGCAGGC - 50 Applied Biosystems N/A Primer: 3’ - AGGGGACCTTGGGGAAGTTA - 50 Applied Biosystems N/A Taqman probe (FAM) Coq2 Hs00794260_m1 Applied Biosystems Cat# 4331182 Taqman probe (FAM) Coq4 Hs01082542_m1 Applied Biosystems Cat# 4331182 Taqman probe (FAM) Coq5 Hs00260456_m1 Applied Biosystems Cat# 4331182 Taqman probe (FAM) Coq7 Hs01029186_m1 Applied Biosystems Cat# 4331182 Taqman probe (VIC) Gapdh Hs99999905_m1 Applied Biosystems Cat# 4448484 OPEN ACCESS
Western Blot:Article Title: 4-Hydroxybenzoic acid rescues multisystemic disease and perinatal lethality in a mouse model of mitochondrial disease.
Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies COQ2 Origene/Quimigen Cat# TA341982; RRID: AB_3096491 COQ5 Novus Biologicals Cat# NBP2-82738; RRID: AB_3096493 COQ4 Proteintech Cat# 16654-1-AP; RRID: AB_2878296 COQ7 Proteintech Cat# 15083-1-AP; RRID: AB_2082207 VDAC Abcam Cat# ab14734; RRID: AB_443084 GFAP Millipore Cat# MAB360; RRID: AB_11212597 NeuN Abcam Cat# ab104224; RRID: AB_10711040 MBP Abcam Cat# ab218011; RRID: AB_2895537 IBA-1 FUJIFILM Wako Cat# 019-19741; RRID: AB_839504 Goat anti-Rabbit IgG (H + L) Secondary Antibody, HRP Thermo Fisher Cat# 31460; RRID: AB_228341 HRP Goat anti-mouse Ig BD Pharmigen Cat# 554002; RRID: AB_395198 Anti-mouse Alexa 594 Abcam Cat# ab150116; RRID: AB_2650601 Anti-Rabbit Alexa 488 conjugated Abcam Cat# ab150077; RRID: AB_2630356 Chemicals, peptides, and recombinant proteins Bouin’s Fluids Thermo Fisher Cat# 7211 Paraformaldehyde Panreac Applichem Cat# 2.529.311.315 Ethanol Absolute VWR Cat# 20821.330 Mayer’s Hematoxylin solution Sigma-Aldrich Cat# MHS16 Eosin Y Solution Sigma-Aldrich Cat# HT110116 Periodic Acid Sigma-Aldrich Cat# P7875-25G Schiff Reagent Sigma-Aldrich Cat# 3952016 Xylene (isomeric mixture) Sigma-Aldrich Cat# 1.08298.4000 Permount Mounting Media Thermo Fisher Cat# 15832544 ProLongTM Gold Antifade Mountant with DAPI Thermo Scientific Cat# P36931 Ammonium Chloride Sigma-Aldrich Cat# A4514 Sodium Citrate Panreac Applichem Cat# 1.416.551.211 4-Hydroxybenzoic acid Sigma-Aldrich Cat# H20059 Gadovist Bayer Cat# 735506.9 Top Vision Agarose Thermo Scientific Cat# R0491 Coenzyme Q9 Sigma-Aldrich Cat# 27597 Coenzyme Q10 Sigma-Aldrich #Cat C9538 Glacial Acetic Acid HPLC VWR (Panreac) Cat# 3.610.081.612 Sodium Acetate Sigma-Aldrich Cat# 3691771 2-Propanol HPLC Sigma-Aldrich Cat# 34863 1-Propanol HPLC Sigma-Aldrich Cat# 34871 Ethanol HPLC Scharlau Cat# ME03062500 Methanol HPLC Scharlau Cat# ME03062500 SDS Sigma-Aldrich Cat# L3771 Hexane Sigma-Aldrich Cat# 650552 DNAse/RNAse free water VWR Cat# E476 Agarose Thermo Fisher Cat# BP164-500 RedSafe Sical (Intron) Cat# 21141 PMSG MSD Animal Health Cat# 581135.2 (Continued on next page) Cell Reports --, 114148, --, 2024 13 .. REAGENT or RESOURCE SOURCE IDENTIFIER HCG DFV Divasa Farmavic Cat# 573676.1 TRI Reagent Solution (Trizol) Thermo Fisher Cat# AM9738 Cloroform VWR Cat# 83626-320 Loading Dye Thermo Fisher Cat# R0611 RIPA Buffer Thermo Scientific Cat# 89900 Halt Protease and Phosphatase Inhibitor Cocktail Thermo Scientific Cat# 78440 EDTA Sigma-Aldrich Cat# ED4SS 2-Mercaptoethanol BIO-RAD Cat# 161-0710 Laemli Sample Buffer BIO-RAD Cat# 161-0747 TGS BIO-RAD Cat# 161-0772 Spectra Multicolor Broad Range Protein Ladder Thermo Scientific Cat# 26634 Phosphate Buffered Saline Fisher Bioreagents Cat# BP399-20 Tween 20 Ultrapure Thermo ScientificTM Cat# J20605.AP Clarity Western ECL Substrate Biorad Cat# 1705061 Stripping Buffer LabClinics Cat# 60-0088 Fatty acid-free Bovine Serum Albumin Sigma-Aldrich Cat# A7030 Bradford Reagent VWR Cat# M172 TRIS Panreac Applichem Cat# 131940.1211 Succinate Sigma-Aldrich Cat# S2378 Sodium Piruvate Fisher Scientific Cat# 11360-070 Rotenone Sigma-Aldrich Cat# R8875 Oligomycin from Streptomyces diastatochromogenes Sigma-Aldrich Cat# O4876 Acetil coenzimaA trisodium salt Sigma-Aldrich Cat# A2056 Adenosine 50-diphosphate sodium salt Sigma-Aldrich Cat# A2754 5,50-Dithiobis(2-nitrobenzoic acid) Sigma-Aldrich Cat# D-8130 Carbonyl cyanide 4-(trifluoromethoxy)phenylhydrazone Sigma-Aldrich Cat# C292 Cytocrome C Sigma-Aldrich Cat# C7752 D-Manitol Thermo Fisher Cat# 125340010 EGTA Sigma-Aldrich Cat# E4378 HEPES Sigma-Aldrich Cat# H4034 L-Glutamic acid monosodium salt hydrate Sigma-Aldrich Cat# G1626 Magnesium chloride Sigma-Aldrich Cat# 5927 NADH Sigma-Aldrich Cat#N6005 Oxaloacetic acid Sigma-Aldrich Cat# O4126 Potasium Phosphate Sigma-Aldrich Cat# P3786 Potassium cyanide Sigma-Aldrich Cat# 60178 Potassium phosphate, monobasic Thermo Fisher Cat# 212595000 Sacarose Sigma-Aldrich Cat# S-0389 Hydrochloric Acid Scharlau Cat# AC07361000 DMEM (1X) + GlutaMAX Gibco Cat# 61965-059 FBS Thermo Fisher Cat# 11573397 Amino acids Thermo Fisher Cat# 11350912 Normocin Ibian Cat# ant-nr-2 DMSO Thermo Fisher Cat# 67-68-5 L-Glutamine 200mM (100X) Gibco Cat# 11500626 Glucose Panreac Applichem Cat# 1.413.411.210 (Continued on next page) 14 Cell Reports --, 114148, --, 2024 OPEN ACCESS .. REAGENT or RESOURCE SOURCE IDENTIFIER CARBONYL CYANIDE (trifluoromethoxy)phenyl hidrazone (FCCP) Sigma-Aldrich Cat# C2920-10MG Antimycin A Sigma-Aldrich Cat# A8674 Perchloric acid Panreac Applichem Cat# 142175 KOH Sigma-Aldrich Cat# 1.050.331.000 Tetrabutylammonium hydrogen sulfate Sigma-Aldrich Cat# T-7158 DMEM (1X) -Glucose Gibco Cat# 11966-025 Potassium Dihydrogen Phosphate Acros Cat# 212595000 XF Assay Medium Modified DMEM Agilent Technologies Cat# 102365-100 Trypan Blue Gibco Cat# 15250-061 Critical commercial assays Mouse Direct PCR Kit Deltaclon CAT #B40015 MINI-PROTEAN TGX Gels 4–20% 10-well, 30 BIO-RAD Cat# 456-1093 Trans-Blot Turbo Transfer Pack BIO-RAD Cat# 1704156 Brilliant III Ultra-Fast qPCR Master Mix Agilent Cat# 600880 High capacity cDNA reverse transcription kit Thermo Fisher Cat# 4368814 Seahorse XFe24 FluxPak Agilent Cat# 102340-100 Experimental models: Cell lines See Table S1 N/A Experimental models: Organisms/strains Mouse: Coq2A252V This paper N/A Oligonucleotides Primer: 3’ - GGACCAGGTTAAAATGCAGGC - 50 Applied Biosystems N/A Primer: 3’ - AGGGGACCTTGGGGAAGTTA - 50 Applied Biosystems N/A Taqman probe (FAM) Coq2 Hs00794260_m1 Applied Biosystems Cat# 4331182 Taqman probe (FAM) Coq4 Hs01082542_m1 Applied Biosystems Cat# 4331182 Taqman probe (FAM) Coq5 Hs00260456_m1 Applied Biosystems Cat# 4331182 Taqman probe (FAM) Coq7 Hs01029186_m1 Applied Biosystems Cat# 4331182 Taqman probe (VIC) Gapdh Hs99999905_m1 Applied Biosystems Cat# 4448484 OPEN ACCESS
Stripping Membranes:Article Title: 4-Hydroxybenzoic acid rescues multisystemic disease and perinatal lethality in a mouse model of mitochondrial disease.
Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies COQ2 Origene/Quimigen Cat# TA341982; RRID: AB_3096491 COQ5 Novus Biologicals Cat# NBP2-82738; RRID: AB_3096493 COQ4 Proteintech Cat# 16654-1-AP; RRID: AB_2878296 COQ7 Proteintech Cat# 15083-1-AP; RRID: AB_2082207 VDAC Abcam Cat# ab14734; RRID: AB_443084 GFAP Millipore Cat# MAB360; RRID: AB_11212597 NeuN Abcam Cat# ab104224; RRID: AB_10711040 MBP Abcam Cat# ab218011; RRID: AB_2895537 IBA-1 FUJIFILM Wako Cat# 019-19741; RRID: AB_839504 Goat anti-Rabbit IgG (H + L) Secondary Antibody, HRP Thermo Fisher Cat# 31460; RRID: AB_228341 HRP Goat anti-mouse Ig BD Pharmigen Cat# 554002; RRID: AB_395198 Anti-mouse Alexa 594 Abcam Cat# ab150116; RRID: AB_2650601 Anti-Rabbit Alexa 488 conjugated Abcam Cat# ab150077; RRID: AB_2630356 Chemicals, peptides, and recombinant proteins Bouin’s Fluids Thermo Fisher Cat# 7211 Paraformaldehyde Panreac Applichem Cat# 2.529.311.315 Ethanol Absolute VWR Cat# 20821.330 Mayer’s Hematoxylin solution Sigma-Aldrich Cat# MHS16 Eosin Y Solution Sigma-Aldrich Cat# HT110116 Periodic Acid Sigma-Aldrich Cat# P7875-25G Schiff Reagent Sigma-Aldrich Cat# 3952016 Xylene (isomeric mixture) Sigma-Aldrich Cat# 1.08298.4000 Permount Mounting Media Thermo Fisher Cat# 15832544 ProLongTM Gold Antifade Mountant with DAPI Thermo Scientific Cat# P36931 Ammonium Chloride Sigma-Aldrich Cat# A4514 Sodium Citrate Panreac Applichem Cat# 1.416.551.211 4-Hydroxybenzoic acid Sigma-Aldrich Cat# H20059 Gadovist Bayer Cat# 735506.9 Top Vision Agarose Thermo Scientific Cat# R0491 Coenzyme Q9 Sigma-Aldrich Cat# 27597 Coenzyme Q10 Sigma-Aldrich #Cat C9538 Glacial Acetic Acid HPLC VWR (Panreac) Cat# 3.610.081.612 Sodium Acetate Sigma-Aldrich Cat# 3691771 2-Propanol HPLC Sigma-Aldrich Cat# 34863 1-Propanol HPLC Sigma-Aldrich Cat# 34871 Ethanol HPLC Scharlau Cat# ME03062500 Methanol HPLC Scharlau Cat# ME03062500 SDS Sigma-Aldrich Cat# L3771 Hexane Sigma-Aldrich Cat# 650552 DNAse/RNAse free water VWR Cat# E476 Agarose Thermo Fisher Cat# BP164-500 RedSafe Sical (Intron) Cat# 21141 PMSG MSD Animal Health Cat# 581135.2 (Continued on next page) Cell Reports --, 114148, --, 2024 13 .. REAGENT or RESOURCE SOURCE IDENTIFIER HCG DFV Divasa Farmavic Cat# 573676.1 TRI Reagent Solution (Trizol) Thermo Fisher Cat# AM9738 Cloroform VWR Cat# 83626-320 Loading Dye Thermo Fisher Cat# R0611 RIPA Buffer Thermo Scientific Cat# 89900 Halt Protease and Phosphatase Inhibitor Cocktail Thermo Scientific Cat# 78440 EDTA Sigma-Aldrich Cat# ED4SS 2-Mercaptoethanol BIO-RAD Cat# 161-0710 Laemli Sample Buffer BIO-RAD Cat# 161-0747 TGS BIO-RAD Cat# 161-0772 Spectra Multicolor Broad Range Protein Ladder Thermo Scientific Cat# 26634 Phosphate Buffered Saline Fisher Bioreagents Cat# BP399-20 Tween 20 Ultrapure Thermo ScientificTM Cat# J20605.AP Clarity Western ECL Substrate Biorad Cat# 1705061 Stripping Buffer LabClinics Cat# 60-0088 Fatty acid-free Bovine Serum Albumin Sigma-Aldrich Cat# A7030 Bradford Reagent VWR Cat# M172 TRIS Panreac Applichem Cat# 131940.1211 Succinate Sigma-Aldrich Cat# S2378 Sodium Piruvate Fisher Scientific Cat# 11360-070 Rotenone Sigma-Aldrich Cat# R8875 Oligomycin from Streptomyces diastatochromogenes Sigma-Aldrich Cat# O4876 Acetil coenzimaA trisodium salt Sigma-Aldrich Cat# A2056 Adenosine 50-diphosphate sodium salt Sigma-Aldrich Cat# A2754 5,50-Dithiobis(2-nitrobenzoic acid) Sigma-Aldrich Cat# D-8130 Carbonyl cyanide 4-(trifluoromethoxy)phenylhydrazone Sigma-Aldrich Cat# C292 Cytocrome C Sigma-Aldrich Cat# C7752 D-Manitol Thermo Fisher Cat# 125340010 EGTA Sigma-Aldrich Cat# E4378 HEPES Sigma-Aldrich Cat# H4034 L-Glutamic acid monosodium salt hydrate Sigma-Aldrich Cat# G1626 Magnesium chloride Sigma-Aldrich Cat# 5927 NADH Sigma-Aldrich Cat#N6005 Oxaloacetic acid Sigma-Aldrich Cat# O4126 Potasium Phosphate Sigma-Aldrich Cat# P3786 Potassium cyanide Sigma-Aldrich Cat# 60178 Potassium phosphate, monobasic Thermo Fisher Cat# 212595000 Sacarose Sigma-Aldrich Cat# S-0389 Hydrochloric Acid Scharlau Cat# AC07361000 DMEM (1X) + GlutaMAX Gibco Cat# 61965-059 FBS Thermo Fisher Cat# 11573397 Amino acids Thermo Fisher Cat# 11350912 Normocin Ibian Cat# ant-nr-2 DMSO Thermo Fisher Cat# 67-68-5 L-Glutamine 200mM (100X) Gibco Cat# 11500626 Glucose Panreac Applichem Cat# 1.413.411.210 (Continued on next page) 14 Cell Reports --, 114148, --, 2024 OPEN ACCESS .. REAGENT or RESOURCE SOURCE IDENTIFIER CARBONYL CYANIDE (trifluoromethoxy)phenyl hidrazone (FCCP) Sigma-Aldrich Cat# C2920-10MG Antimycin A Sigma-Aldrich Cat# A8674 Perchloric acid Panreac Applichem Cat# 142175 KOH Sigma-Aldrich Cat# 1.050.331.000 Tetrabutylammonium hydrogen sulfate Sigma-Aldrich Cat# T-7158 DMEM (1X) -Glucose Gibco Cat# 11966-025 Potassium Dihydrogen Phosphate Acros Cat# 212595000 XF Assay Medium Modified DMEM Agilent Technologies Cat# 102365-100 Trypan Blue Gibco Cat# 15250-061 Critical commercial assays Mouse Direct PCR Kit Deltaclon CAT #B40015 MINI-PROTEAN TGX Gels 4–20% 10-well, 30 BIO-RAD Cat# 456-1093 Trans-Blot Turbo Transfer Pack BIO-RAD Cat# 1704156 Brilliant III Ultra-Fast qPCR Master Mix Agilent Cat# 600880 High capacity cDNA reverse transcription kit Thermo Fisher Cat# 4368814 Seahorse XFe24 FluxPak Agilent Cat# 102340-100 Experimental models: Cell lines See Table S1 N/A Experimental models: Organisms/strains Mouse: Coq2A252V This paper N/A Oligonucleotides Primer: 3’ - GGACCAGGTTAAAATGCAGGC - 50 Applied Biosystems N/A Primer: 3’ - AGGGGACCTTGGGGAAGTTA - 50 Applied Biosystems N/A Taqman probe (FAM) Coq2 Hs00794260_m1 Applied Biosystems Cat# 4331182 Taqman probe (FAM) Coq4 Hs01082542_m1 Applied Biosystems Cat# 4331182 Taqman probe (FAM) Coq5 Hs00260456_m1 Applied Biosystems Cat# 4331182 Taqman probe (FAM) Coq7 Hs01029186_m1 Applied Biosystems Cat# 4331182 Taqman probe (VIC) Gapdh Hs99999905_m1 Applied Biosystems Cat# 4448484 OPEN ACCESS
other:Article Title: Using flow cytometry to develop a competitive assay for the detection of biotin
Article Snippet: Background: Flow cytometry (FCM) has many advantages including detection of bioparticles at low concentrations.. A competitive assay for the detection of protein-binding compounds, such as biotin, was developed.. Methods: Using the fluorescein-biotin and streptavidin-display spores, biotin could be easily detected and quantified by FCM.
Article Title: A Distribution-Based Metric for Quantifying Dispersibility in Dry Powder Inhalers.
Article Snippet: Trehalose dihydrate (Fisher Scientific, Waltham, MA, USA), mannitol (Thermo Scientific, Waltham, MA, USA), and inulin (TCI Chemicals, Portland, OR, USA) were selected as model excipients to generate dry powder formulations with distinct physicochemical properties.
Control:Article Title: Single-Cell Metabolic Imaging Reveals Glycogen-Driven Adaptations in Endothelial Cells.
Article Snippet: For SRS imaging experiments, HUVECs were seeded on glass coverslips pre-coated with attach- ment factor solution (Cell Applications, Cat. #123-500) for 2 h. The HT condition was induced by adjusting the final concentration to 25 mM D-glucose (Thermo Fisher, Cat. #A16828-36), d7-glucose (Cambridge Isotope Laboratories, Cat. #DLM-2062), or 6,6-d2-glucose (Cambridge Isotope Laboratories, Cat. #DLM349), along with 5 ng mL−1 TNF-α (Gibco, Cat. #PHC3015). .. The NM condition included addition of 25 mM mannitol (Thermo Fisher, Cat. #125340025) as an osmolarity control in ECGM containing 5 mM baseline D-glucose. .. For GSK3 inhibition, 5 μm CHIR-99021 (MedChemExpress, Cat. #HY-10182), or 5 μm SB216763 (MedChemExpress, Cat. #HY-12012) was added concomitantly with the HT condition containing labeled or unlabeled glucose for the specified duration.
Sterility:Article Title: Preparing Arabidopsis thaliana root protoplasts for cryo electron tomography
Article Snippet: MATERIALS: REAGENTS - Murashige and Skoog Basal Medium (Sigma-Aldrich, cat. no. M5519) - Agar (Bio Basic, cat.no. .. FB0010) - KOH (Millipore Sigma, cat. No. 105033) - 0.2 M 4-morpholineethanesulfonic acid (MES, pH 5.7; FisherBiotech, cat. no. BP300) - 0.8 M mannitol (Acros, cat. no.125340010) - 1 M CaCl 2 (Bio Basic, cat. no. CT1330) - 2 M KCl (Fisher scientific, cat. no. P330-500) - 2 M MgCl 2 (Fisher Scientific, cat. no.M-20944) - 154 mM NaCl (Fisher Scientific, cat. no. S271) - Tris Base (Millipore Sigma, cat. no. 648310) - HCl (Millipore Sigma, cat. no. 258148) - β-Mercaptoethanol (Fisher Scientific, cat. no. BP176-100) - BSA (Roche, cat. no. 10 735 086 001) - Cellulase from ( Trichoderma sp., Sigma-Aldrich, cat. no. C0615-1G) - Pectinase from ( Aspergillus niger , Sigma-Aldrich, cat. no. P4716) - Concanavalin A (Sigma Aldrich, cat. no. C2010) - Enzyme solution (see REAGENT SETUP) - W5 solution (see REAGENT SETUP) BIOLOGICAL MATERIALS - Arabidopsis accessions: Col-0, RAE1-GFP ( ) EQUIPMENT - Square Petri Dishes (Fisher Scientific, cat no. FB0875711A) - Sorvall Legend XFR Centrifuge (Thermo Fisher Scientific, cat. no. 75004541) - 0.2-μm Syringe filter – Sterile (Fisher Scientific, cat. no. 09-719C) - Sterile Single Use Carbon Blades (Lance, cat. no. 1500321) - Petri dish with clear lid (Fisher Scientific, cat. no. FB0875712) - Micropore (3M, cat. no. 1530-1) - Sterile Cell Strainer 70 μm Nylon Mesh (Fisher Scientific, cat. no. 22-363-548) - Improved Neubauer 0.1-mm-deep hemacytometer (Hausser Scientific, cat. no. 0267110) - OMAX 40-2500X LED Digital Trinocular Compound Microscope USB Camera (OMAX, cat. No. M83EZ-SCP-C03S) - Fluorescence microscope (Nikon microscope Ti2 Eclipse or comparable) - 35 mm microscopy dishes, no. 1.5 Coverslip, 14 mm Glass Diameter, uncoated (Mattek) - 2/1 Holey Carbon-coated SiO 2 200-mesh Gold grids (Quantifoil Micro Tools GmbH, catalog number: Q2100CR1) - Tweezers (Dumont 3, 5) - Glass microscopy slides - Glass Petri dishes - Glow Discharge Cleaning System (PELCO easiGlow) - Leica EM GP2 plunger (Leica Microsystems) - Whatman filter paper grade 1 - Cryo grid boxes (custom-made) or (Thermo Fisher Scientific) - Autogrids with FIB cutout (MPI Martinsried or Thermo Fisher Scientific) - C-clips (Thermo Fisher Scientific) - C-clip insertion tools (Thermo Fisher Scientific) - EM Cryo CLEM system (Leica Microsystems) - Aquilos Cryo-Focused Ion Beam - Scanning Electron Microscope (Thermo Fisher Scientific) - Titan Krios G2 Cryo-Transmission Electron Microscope (Thermo Fisher Scientific), equipped with a BioQuantum-K3 (Gatan) REAGENT SETUP Enzyme solution: Prepare a solution containing 0.4 M mannitol, 20 mM MES (pH 5.7), 20 mM KCl, 1.5% (wt/vol) cellulase, and 0.3% (wt/vol) macerozyme. ..
Microscopy:Article Title: Preparing Arabidopsis thaliana root protoplasts for cryo electron tomography
Article Snippet: MATERIALS: REAGENTS - Murashige and Skoog Basal Medium (Sigma-Aldrich, cat. no. M5519) - Agar (Bio Basic, cat.no. .. FB0010) - KOH (Millipore Sigma, cat. No. 105033) - 0.2 M 4-morpholineethanesulfonic acid (MES, pH 5.7; FisherBiotech, cat. no. BP300) - 0.8 M mannitol (Acros, cat. no.125340010) - 1 M CaCl 2 (Bio Basic, cat. no. CT1330) - 2 M KCl (Fisher scientific, cat. no. P330-500) - 2 M MgCl 2 (Fisher Scientific, cat. no.M-20944) - 154 mM NaCl (Fisher Scientific, cat. no. S271) - Tris Base (Millipore Sigma, cat. no. 648310) - HCl (Millipore Sigma, cat. no. 258148) - β-Mercaptoethanol (Fisher Scientific, cat. no. BP176-100) - BSA (Roche, cat. no. 10 735 086 001) - Cellulase from ( Trichoderma sp., Sigma-Aldrich, cat. no. C0615-1G) - Pectinase from ( Aspergillus niger , Sigma-Aldrich, cat. no. P4716) - Concanavalin A (Sigma Aldrich, cat. no. C2010) - Enzyme solution (see REAGENT SETUP) - W5 solution (see REAGENT SETUP) BIOLOGICAL MATERIALS - Arabidopsis accessions: Col-0, RAE1-GFP ( ) EQUIPMENT - Square Petri Dishes (Fisher Scientific, cat no. FB0875711A) - Sorvall Legend XFR Centrifuge (Thermo Fisher Scientific, cat. no. 75004541) - 0.2-μm Syringe filter – Sterile (Fisher Scientific, cat. no. 09-719C) - Sterile Single Use Carbon Blades (Lance, cat. no. 1500321) - Petri dish with clear lid (Fisher Scientific, cat. no. FB0875712) - Micropore (3M, cat. no. 1530-1) - Sterile Cell Strainer 70 μm Nylon Mesh (Fisher Scientific, cat. no. 22-363-548) - Improved Neubauer 0.1-mm-deep hemacytometer (Hausser Scientific, cat. no. 0267110) - OMAX 40-2500X LED Digital Trinocular Compound Microscope USB Camera (OMAX, cat. No. M83EZ-SCP-C03S) - Fluorescence microscope (Nikon microscope Ti2 Eclipse or comparable) - 35 mm microscopy dishes, no. 1.5 Coverslip, 14 mm Glass Diameter, uncoated (Mattek) - 2/1 Holey Carbon-coated SiO 2 200-mesh Gold grids (Quantifoil Micro Tools GmbH, catalog number: Q2100CR1) - Tweezers (Dumont 3, 5) - Glass microscopy slides - Glass Petri dishes - Glow Discharge Cleaning System (PELCO easiGlow) - Leica EM GP2 plunger (Leica Microsystems) - Whatman filter paper grade 1 - Cryo grid boxes (custom-made) or (Thermo Fisher Scientific) - Autogrids with FIB cutout (MPI Martinsried or Thermo Fisher Scientific) - C-clips (Thermo Fisher Scientific) - C-clip insertion tools (Thermo Fisher Scientific) - EM Cryo CLEM system (Leica Microsystems) - Aquilos Cryo-Focused Ion Beam - Scanning Electron Microscope (Thermo Fisher Scientific) - Titan Krios G2 Cryo-Transmission Electron Microscope (Thermo Fisher Scientific), equipped with a BioQuantum-K3 (Gatan) REAGENT SETUP Enzyme solution: Prepare a solution containing 0.4 M mannitol, 20 mM MES (pH 5.7), 20 mM KCl, 1.5% (wt/vol) cellulase, and 0.3% (wt/vol) macerozyme. ..
Fluorescence:Article Title: Preparing Arabidopsis thaliana root protoplasts for cryo electron tomography
Article Snippet: MATERIALS: REAGENTS - Murashige and Skoog Basal Medium (Sigma-Aldrich, cat. no. M5519) - Agar (Bio Basic, cat.no. .. FB0010) - KOH (Millipore Sigma, cat. No. 105033) - 0.2 M 4-morpholineethanesulfonic acid (MES, pH 5.7; FisherBiotech, cat. no. BP300) - 0.8 M mannitol (Acros, cat. no.125340010) - 1 M CaCl 2 (Bio Basic, cat. no. CT1330) - 2 M KCl (Fisher scientific, cat. no. P330-500) - 2 M MgCl 2 (Fisher Scientific, cat. no.M-20944) - 154 mM NaCl (Fisher Scientific, cat. no. S271) - Tris Base (Millipore Sigma, cat. no. 648310) - HCl (Millipore Sigma, cat. no. 258148) - β-Mercaptoethanol (Fisher Scientific, cat. no. BP176-100) - BSA (Roche, cat. no. 10 735 086 001) - Cellulase from ( Trichoderma sp., Sigma-Aldrich, cat. no. C0615-1G) - Pectinase from ( Aspergillus niger , Sigma-Aldrich, cat. no. P4716) - Concanavalin A (Sigma Aldrich, cat. no. C2010) - Enzyme solution (see REAGENT SETUP) - W5 solution (see REAGENT SETUP) BIOLOGICAL MATERIALS - Arabidopsis accessions: Col-0, RAE1-GFP ( ) EQUIPMENT - Square Petri Dishes (Fisher Scientific, cat no. FB0875711A) - Sorvall Legend XFR Centrifuge (Thermo Fisher Scientific, cat. no. 75004541) - 0.2-μm Syringe filter – Sterile (Fisher Scientific, cat. no. 09-719C) - Sterile Single Use Carbon Blades (Lance, cat. no. 1500321) - Petri dish with clear lid (Fisher Scientific, cat. no. FB0875712) - Micropore (3M, cat. no. 1530-1) - Sterile Cell Strainer 70 μm Nylon Mesh (Fisher Scientific, cat. no. 22-363-548) - Improved Neubauer 0.1-mm-deep hemacytometer (Hausser Scientific, cat. no. 0267110) - OMAX 40-2500X LED Digital Trinocular Compound Microscope USB Camera (OMAX, cat. No. M83EZ-SCP-C03S) - Fluorescence microscope (Nikon microscope Ti2 Eclipse or comparable) - 35 mm microscopy dishes, no. 1.5 Coverslip, 14 mm Glass Diameter, uncoated (Mattek) - 2/1 Holey Carbon-coated SiO 2 200-mesh Gold grids (Quantifoil Micro Tools GmbH, catalog number: Q2100CR1) - Tweezers (Dumont 3, 5) - Glass microscopy slides - Glass Petri dishes - Glow Discharge Cleaning System (PELCO easiGlow) - Leica EM GP2 plunger (Leica Microsystems) - Whatman filter paper grade 1 - Cryo grid boxes (custom-made) or (Thermo Fisher Scientific) - Autogrids with FIB cutout (MPI Martinsried or Thermo Fisher Scientific) - C-clips (Thermo Fisher Scientific) - C-clip insertion tools (Thermo Fisher Scientific) - EM Cryo CLEM system (Leica Microsystems) - Aquilos Cryo-Focused Ion Beam - Scanning Electron Microscope (Thermo Fisher Scientific) - Titan Krios G2 Cryo-Transmission Electron Microscope (Thermo Fisher Scientific), equipped with a BioQuantum-K3 (Gatan) REAGENT SETUP Enzyme solution: Prepare a solution containing 0.4 M mannitol, 20 mM MES (pH 5.7), 20 mM KCl, 1.5% (wt/vol) cellulase, and 0.3% (wt/vol) macerozyme. ..
Centrifugation:Article Title: Methods of detection of compound, antibody or protein using recombinant endospores or bacteria as sensing element
Article Snippet: .. Afterward, MSG buffer (comprising 0.5M mannitol (ACROS; catalog no. 125345000), 0.5M sorbitol (ACROS; catalog no. 132735000) and 10% v/v glycerol (J. T. Baker; catalog no. 2136-01)) with the same volume as the original culture was added to resuspend the precipitate, followed by centrifugation under 5000×g for 10 minutes at 4° C. and disposal of the supernatant. ..
|