label it plasmid delivery control cy3 (Mirus Bio)
Mirus Bio is a verified supplier 
Mirus Bio manufactures this product 
96
Structured Review
Mirus Bio
label it plasmid delivery control cy3
Label It Plasmid Delivery Control Cy3, supplied by Mirus Bio, used in various techniques. Bioz Stars score: 96/100, based on 1903 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/cy3+kit/Label+IT+Nucleic+Acid+Labeling+Kit/pm41344099-56-0-8
Average 96 stars, based on 1903 article reviews
Label It Plasmid Delivery Control Cy3, supplied by Mirus Bio, used in various techniques. Bioz Stars score: 96/100, based on 1903 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/cy3+kit/Label+IT+Nucleic+Acid+Labeling+Kit/pm41344099-56-0-8
Average 96 stars, based on 1903 article reviews
label it plasmid delivery control cy3 - by Bioz Stars,
2026-10
96/100 stars
Images
Related Articles
Labeling:Article Title: Unveiling a missing component of the atypical type IV secretion system required for natural transformation of Helicobacter pylori Article Snippet: .. When cultures reached exponential phase (18-24h), OD was normalized to 4 in 20 μL and 200 ng of λ-DNA (New England Biolabs), labelled with Cy3 using Article Title: Cu(II) and Zn(II) Enhance Antibiotic Resistance Gene Transformation by Regulating Type IV Pili-Mediated DNA Uptake. Article Snippet: Natural transformation represents one of the major dissemination pathways of antibiotic resistance genes (ARGs) in the environment.. It can be facilitated by heavy metals, which is traditionally attributed to the induction of oxidative stress and an SOS response.. Here, we demonstrate an alternative mechanism involving type IV pili (T4P), the molecular machinery for extracellular DNA (eDNA) uptake. Article Title: Ionizable Polymeric Micelles Targeting Transferrin Receptor 1 Enhance Systemic mRNA Delivery to the Brain. Article Snippet: The samples were incubated at 37 °C for 1 h, followed by RNA extraction using the RNeasy Mini Kit. cDNA was then synthesized through reverse transcription using the High Capacity RNA-to-cDNA Kit (Applied Biosystems, Foster City, CA, USA). .. Finally, qPCR was performed on an Applied Biosystems 7500 Fast Real-Time PCR System us i ng the spe c i fi ed p r ime r/p robe pa i r s : (Fo rwa rd : GTGGTGTGCAGCGAGAATAG, Reverse: CGCTCGTTGTAGATGTCGTTAG, Probe: TTGCAGTTCTTCATGCCCGTGTTG) To evaluate the structural stability of mRNA/PMs in serum, mRNA was double labeled with Cy3 and Cy5 using the Label IT Cy3 Labeling Kit and Article Title: Ionizable Polymeric Micelles Targeting Transferrin Receptor 1 Enhance Systemic mRNA Delivery to the Brain. Article Snippet: .. mRNA was labeled with Cy5 using the Real-time Polymerase Chain Reaction:Article Title: Ionizable Polymeric Micelles Targeting Transferrin Receptor 1 Enhance Systemic mRNA Delivery to the Brain. Article Snippet: The samples were incubated at 37 °C for 1 h, followed by RNA extraction using the RNeasy Mini Kit. cDNA was then synthesized through reverse transcription using the High Capacity RNA-to-cDNA Kit (Applied Biosystems, Foster City, CA, USA). .. Finally, qPCR was performed on an Applied Biosystems 7500 Fast Real-Time PCR System us i ng the spe c i fi ed p r ime r/p robe pa i r s : (Fo rwa rd : GTGGTGTGCAGCGAGAATAG, Reverse: CGCTCGTTGTAGATGTCGTTAG, Probe: TTGCAGTTCTTCATGCCCGTGTTG) To evaluate the structural stability of mRNA/PMs in serum, mRNA was double labeled with Cy3 and Cy5 using the Label IT Cy3 Labeling Kit and Encapsulation:Article Title: Ionizable Polymeric Micelles Targeting Transferrin Receptor 1 Enhance Systemic mRNA Delivery to the Brain. Article Snippet: The samples were incubated at 37 °C for 1 h, followed by RNA extraction using the RNeasy Mini Kit. cDNA was then synthesized through reverse transcription using the High Capacity RNA-to-cDNA Kit (Applied Biosystems, Foster City, CA, USA). .. Finally, qPCR was performed on an Applied Biosystems 7500 Fast Real-Time PCR System us i ng the spe c i fi ed p r ime r/p robe pa i r s : (Fo rwa rd : GTGGTGTGCAGCGAGAATAG, Reverse: CGCTCGTTGTAGATGTCGTTAG, Probe: TTGCAGTTCTTCATGCCCGTGTTG) To evaluate the structural stability of mRNA/PMs in serum, mRNA was double labeled with Cy3 and Cy5 using the Label IT Cy3 Labeling Kit and CCK-8 Assay:Article Title: Transfersomes with core and surface‐loaded NF‐κB p65 siRNA for enhanced transdermal transfection and effective treatment of psoriasis Article Snippet: DMEM, trypsin, fetal bovine serum, and penicillin‐streptomycin were purchased from Gibco. .. Mirus other:Article Title: Comparison of Receptor‐Mediated Endocytosis and Its Application to Enhance DNA Transfection by TFAMoplex Article Snippet: The Cy3-DNA was obtained from Mirus Biosciences (MIR 7905), while MFP488-DNA was labeled according to the manufacturers protocol and purified via |
