Review




Structured Review

CustomArray Inc customarray™ 12k microarray
Real-time PCR analysis of selected genes based on the <t> microarray </t> results
Customarray™ 12k Microarray, supplied by CustomArray Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/customarray+12k+oligonucleotide+microarrays/microarray+surfaces/pmc03279671-34-14-13
Average 90 stars, based on 1 article reviews
customarray™ 12k microarray - by Bioz Stars, 2026-09
90/100 stars

Images

1) Product Images from "Microarray Analysis of Differentially Expressed Genes between Cysts and Trophozoites of Acanthamoeba castellanii"

Article Title: Microarray Analysis of Differentially Expressed Genes between Cysts and Trophozoites of Acanthamoeba castellanii

Journal: The Korean Journal of Parasitology

doi: 10.3347/kjp.2011.49.4.341


Figure Legend Snippet: Real-time PCR analysis of selected genes based on the microarray results

Techniques Used: Real-time Polymerase Chain Reaction, Microarray

Comparison of gene expression by microarray and KOG analysis. Cyst up-regulated genes showed higher percentages in A, D, T, W, U, O, and F articles. In J, C, and Z (cytoskeleton) articles, cyst genes were down-regulated.
Figure Legend Snippet: Comparison of gene expression by microarray and KOG analysis. Cyst up-regulated genes showed higher percentages in A, D, T, W, U, O, and F articles. In J, C, and Z (cytoskeleton) articles, cyst genes were down-regulated.

Techniques Used: Expressing, Microarray

Related Articles

Synthesized:

Article Title: Functional genomics using CRISPR-Cas systems, compositions, methods, screens and applications thereof
Article Snippet: Genome-scale lentiviral sgRNA library construction: Oligonucleotides were synthesized on the CustomArray 12K and 90K arrays (CustomArray Inc.) and amplified as sub-pools in a nested PCR. .. Genome-scale lentiviral sgRNA library construction: Oligonucleotides were synthesized on the CustomArray 12K and 90K arrays (CustomArray Inc.) and amplified as sub-pools in a nested PCR. .. A third round of PCR was performed to incorporate overhangs compatible for Gibson Assembly (NEB) into the lentiviral sgRNA AAVS1-targeting vector between the XbaI and NdeI sites.

Amplification:

Article Title: Functional genomics using CRISPR-Cas systems, compositions, methods, screens and applications thereof
Article Snippet: Genome-scale lentiviral sgRNA library construction: Oligonucleotides were synthesized on the CustomArray 12K and 90K arrays (CustomArray Inc.) and amplified as sub-pools in a nested PCR. .. Genome-scale lentiviral sgRNA library construction: Oligonucleotides were synthesized on the CustomArray 12K and 90K arrays (CustomArray Inc.) and amplified as sub-pools in a nested PCR. .. A third round of PCR was performed to incorporate overhangs compatible for Gibson Assembly (NEB) into the lentiviral sgRNA AAVS1-targeting vector between the XbaI and NdeI sites.

Nested PCR:

Article Title: Functional genomics using CRISPR-Cas systems, compositions, methods, screens and applications thereof
Article Snippet: Genome-scale lentiviral sgRNA library construction: Oligonucleotides were synthesized on the CustomArray 12K and 90K arrays (CustomArray Inc.) and amplified as sub-pools in a nested PCR. .. Genome-scale lentiviral sgRNA library construction: Oligonucleotides were synthesized on the CustomArray 12K and 90K arrays (CustomArray Inc.) and amplified as sub-pools in a nested PCR. .. A third round of PCR was performed to incorporate overhangs compatible for Gibson Assembly (NEB) into the lentiviral sgRNA AAVS1-targeting vector between the XbaI and NdeI sites.

other:

Article Title: Development of DNA Microarray for Parallel Detection of Community-Acquired Pneumonia Bacterial Pathogens
Article Snippet: In the research we used CustomArray microarrays (USA).


Article Title: CRISPR screens identify cholesterol biosynthesis as a therapeutic target on stemness and drug resistance of colon cancer
Article Snippet: Pooled Epi-Drug sgRNA library was designed using CRISPR-DO tool by He lab and synthesized as 73-mer oligonucleotides (CustomArray, NJ, USA), amplified by PCR and then cloned into lentiGuide-puro plasmid (a gift form Feng Zhang, Addgene 52963).

Article Title: Nuclear Control of Mitochondrial Homeostasis and Venetoclax Efficacy in AML via COX4I1.
Article Snippet: CRISPR and cDNA Molecular Cloning: Guide RNA oligonucleotides were synthesized either via microarray (CustomArray) for library cloning or individually (Integrated DNA Technologies) for single sgRNA constructs.

Article Title: CRISPRi screens reveal a DNA methylation-mediated 3D genome dependent causal mechanism in prostate cancer
Article Snippet: sgRNAs were synthesized as 73-mer oligonucleotides (CustomArray, USA), GAAAGGACGAAACACCGNNNNNNNNNNNNNNNNNNNNGTTTTAGAGCTAGAAATA GCAAGTTAAAATAAGGC (N’s denote the sgRNA 19–20 nucleotide target sequence) and amplified by PCR as a pool using the following primers: TAACTTGAAAGTATTTCGATTTCTTGGCTTTATATATCTTGTGGAAAGGACGAAACACCG (Forward) and ACTTTTTCAAGTTGATAACGGACTAGCCTTATTTTAACTTGCTATTTCTAGCTCTAAAAC (Reverse).

Microarray:

Article Title: Serially deposited biomolecules
Article Snippet: .. The 12K CUSTOMARRAY® microarray is commercially available as a custom gene chip that has been used for a variety of genomic assays (e.g., genotyping, gene expression, SNP analysis, etc.). .. CombiMatrix also developed the ELECTRASENSE® microarray and microarray reader based on ECD.

Gene Expression:

Article Title: Serially deposited biomolecules
Article Snippet: .. The 12K CUSTOMARRAY® microarray is commercially available as a custom gene chip that has been used for a variety of genomic assays (e.g., genotyping, gene expression, SNP analysis, etc.). .. CombiMatrix also developed the ELECTRASENSE® microarray and microarray reader based on ECD.



Similar Products

90
CustomArray Inc oligonucleotide microarrays customarray 12k
Oligonucleotide Microarrays Customarray 12k, supplied by CustomArray Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/customarray+12k+oligonucleotide+microarrays/microarray+surfaces/pm23306674-79-1-8
Average 90 stars, based on 1 article reviews
oligonucleotide microarrays customarray 12k - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

90
CombiMatrix customarray 12k oligonucleotide microarrays
Customarray 12k Oligonucleotide Microarrays, supplied by CombiMatrix, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/customarray+12k+oligonucleotide+microarrays/4x2k+custom+array/10__1128_slash_aem__03263___12-78-1-4
Average 90 stars, based on 1 article reviews
customarray 12k oligonucleotide microarrays - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

90
CustomArray Inc electrochemically synthesized oligonucleotide microarrays customarray 12k
Electrochemically Synthesized Oligonucleotide Microarrays Customarray 12k, supplied by CustomArray Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/customarray+12k+oligonucleotide+microarrays/microarray+surfaces/10__1128_slash_aem__02901___07-70-2-4
Average 90 stars, based on 1 article reviews
electrochemically synthesized oligonucleotide microarrays customarray 12k - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

Image Search Results