assays custom designed chrimson smfish probes (Biosearch Technologies Inc)
86
Structured Review
Biosearch Technologies Inc
assays custom designed chrimson smfish probes
Assays Custom Designed Chrimson Smfish Probes, supplied by Biosearch Technologies Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/custom+designed+probes/custom+fish+labelled+probes+rna+tamra/pm40975868-415-7-15
Average 86 stars, based on 1 article reviews
Assays Custom Designed Chrimson Smfish Probes, supplied by Biosearch Technologies Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/custom+designed+probes/custom+fish+labelled+probes+rna+tamra/pm40975868-415-7-15
Average 86 stars, based on 1 article reviews
assays custom designed chrimson smfish probes - by Bioz Stars,
2026-10
86/100 stars
Images
Related Articles
Over Expression:Article Title: RNA-triggered cell killing with CRISPR-Cas12a2. Article Snippet: Concentrated virus was added to cells in media containing 10 μg ml–1 polybrene; plates were gently shaken every 30 min for 3 h before the medium was replaced after 24 h. Cells with high GFP expression were sorted using the Sony MA900 cell sorting system. .. RNA-FISH probe creation and RNA-FISH quantification of Construct:Article Title: RNA-triggered cell killing with CRISPR-Cas12a2. Article Snippet: Concentrated virus was added to cells in media containing 10 μg ml–1 polybrene; plates were gently shaken every 30 min for 3 h before the medium was replaced after 24 h. Cells with high GFP expression were sorted using the Sony MA900 cell sorting system. .. RNA-FISH probe creation and RNA-FISH quantification of Fluorescence In Situ Hybridization:Article Title: RNA-triggered cell killing with CRISPR-Cas12a2. Article Snippet: Concentrated virus was added to cells in media containing 10 μg ml–1 polybrene; plates were gently shaken every 30 min for 3 h before the medium was replaced after 24 h. Cells with high GFP expression were sorted using the Sony MA900 cell sorting system. .. RNA-FISH probe creation and RNA-FISH quantification of Article Title: Sequence and structure of protein binding sites in RNA impact biomolecular condensates Article Snippet: .. Article Title: Sequence and structure of protein binding sites in RNA impact biomolecular condensates Article Snippet: Biomolecular condensates are central to subcellular compartmentalization and RNA regulation.. In the multinucleate fungus Ashbya gossypii, condensates composed of Whi3 protein and CLN3 mRNA help ensure nuclear cycle asynchrony in a shared cytoplasm.. Here, we investigated how Whi3 protein binding sites within CLN3 mRNA are specified and influence properties of the condensate. Article Title: Dynamic control of Argonautes by a rapidly evolving immunological switch Article Snippet: pals-22(pig26) Alt-R HDR donor block: CAGGTTGCATAGAGAAGAAGATGAACTCGCCGGTAAAAAGGTGTTGGAAGCGGCTGAAATAGTTGATGTG , IDT , N/A. .. Article Title: Dynamic control of Argonautes by a rapidly evolving immunological switch Article Snippet: Custom FISH probes for N. parisii ribosomal RNA , Biosearch Technologies , N/A. .. Labeling:Article Title: Discovery of Small Molecules That Inhibit MYC mRNA Translation Through hnRNPK and Induction of Stress Granule-Mediated mRNA Relocalization. Article Snippet: .. Fluorescently labeled Article Title: Discovery of Small Molecules That Inhibit MYC mRNA Translation Through hnRNPK and Induction of Stress Granule-Mediated mRNA Relocalization Article Snippet: .. Fluorescently labeled other:Article Title: Functional probing of neuronal subtypes via intersectional expression of optogenetic actuators reveals non-linear components in a linear circuit. Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Critical commercial Virus:Article Title: Dynamic control of Argonautes by a rapidly evolving immunological switch Article Snippet: Custom FISH probes for N. parisii ribosomal RNA , Biosearch Technologies , N/A. .. |