Review



crispr single guide rna (sgrna) sequences  (Synthego Inc)

 
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 90
      Buy from Supplier

    Structured Review

    Synthego Inc crispr single guide rna (sgrna) sequences
    Crispr Single Guide Rna (Sgrna) Sequences, supplied by Synthego Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/crispr+guide+sequence/synthetic+guide+rnas/pm40419770-411-0-17
    Average 90 stars, based on 1 article reviews
    crispr single guide rna (sgrna) sequences - by Bioz Stars, 2026-11
    90/100 stars

    Images

    Related Articles

    Purification:

    Article Title: Covalent Binding of Thioredoxin to TXNIP is Required for Diet-induced Insulin Resistance in the Liver.
    Article Snippet: .. Zygotic pronuclei were microinjected with purified Cas9 mRNA (100 ng/μl), in vitro–transcribed synthetic guide RNAs (Synthego, CA), and an asymmetrical ssDNA donor construct (IDT, CA). ..

    Article Title: Covalent binding of thioredoxin to TXNIP is required for diet-induced insulin resistance in the liver
    Article Snippet: .. Zygotic pronuclei were microinjected with purified Cas9 mRNA (100 ng/μl), in vitro –transcribed synthetic guide RNAs (Synthego), and an asymmetrical ssDNA donor construct (IDT). ..

    Construct:

    Article Title: Covalent Binding of Thioredoxin to TXNIP is Required for Diet-induced Insulin Resistance in the Liver.
    Article Snippet: .. Zygotic pronuclei were microinjected with purified Cas9 mRNA (100 ng/μl), in vitro–transcribed synthetic guide RNAs (Synthego, CA), and an asymmetrical ssDNA donor construct (IDT, CA). ..

    Article Title: Covalent binding of thioredoxin to TXNIP is required for diet-induced insulin resistance in the liver
    Article Snippet: .. Zygotic pronuclei were microinjected with purified Cas9 mRNA (100 ng/μl), in vitro –transcribed synthetic guide RNAs (Synthego), and an asymmetrical ssDNA donor construct (IDT). ..

    Knock-Out:

    Article Title:
    Article Snippet: Knockout cell lines were generated via electroporation of sgRNA/Cas9 nucleoprotein complexes or lentiviral transfection of the lentiCRISPR v2 plasmid, 15 provided as a gift from Feng Zhang (Addgene plasmid # 52961 ; http://n2t.net/addgene:52961 ; RRID:Addgene_52961)(4). .. To knock out St6galnac4 in murine T-ALL, 6 μL of a synthetic guide RNA (Synthego) at a concentration of 30 pM with the sequence UGCACAGUGUGAGGAGCAGA was complexed with 1 μL of Cas9-2NLS (Synthego) at 20 pM in 18 uL nucleofection buffer [120 mg/mL KH2PO4, 1.2 mg/mL NaHCO3, 0.4 mg/mL glucose, 4 mg/mL ATP disodium salt, 2.4 g/mL 20 MgCl2 • 6H2O, pH 7.4] for 10 minutes at room temperature. ..

    Concentration Assay:

    Article Title:
    Article Snippet: Knockout cell lines were generated via electroporation of sgRNA/Cas9 nucleoprotein complexes or lentiviral transfection of the lentiCRISPR v2 plasmid, 15 provided as a gift from Feng Zhang (Addgene plasmid # 52961 ; http://n2t.net/addgene:52961 ; RRID:Addgene_52961)(4). .. To knock out St6galnac4 in murine T-ALL, 6 μL of a synthetic guide RNA (Synthego) at a concentration of 30 pM with the sequence UGCACAGUGUGAGGAGCAGA was complexed with 1 μL of Cas9-2NLS (Synthego) at 20 pM in 18 uL nucleofection buffer [120 mg/mL KH2PO4, 1.2 mg/mL NaHCO3, 0.4 mg/mL glucose, 4 mg/mL ATP disodium salt, 2.4 g/mL 20 MgCl2 • 6H2O, pH 7.4] for 10 minutes at room temperature. ..

    Sequencing:

    Article Title:
    Article Snippet: Knockout cell lines were generated via electroporation of sgRNA/Cas9 nucleoprotein complexes or lentiviral transfection of the lentiCRISPR v2 plasmid, 15 provided as a gift from Feng Zhang (Addgene plasmid # 52961 ; http://n2t.net/addgene:52961 ; RRID:Addgene_52961)(4). .. To knock out St6galnac4 in murine T-ALL, 6 μL of a synthetic guide RNA (Synthego) at a concentration of 30 pM with the sequence UGCACAGUGUGAGGAGCAGA was complexed with 1 μL of Cas9-2NLS (Synthego) at 20 pM in 18 uL nucleofection buffer [120 mg/mL KH2PO4, 1.2 mg/mL NaHCO3, 0.4 mg/mL glucose, 4 mg/mL ATP disodium salt, 2.4 g/mL 20 MgCl2 • 6H2O, pH 7.4] for 10 minutes at room temperature. ..

    other:

    Article Title: BCL11A-deficient human erythropoiesis is impaired in vitro and after xenotransplantation into mice
    Article Snippet: The modified synthetic single-guide RNAs (sgRNAs) ( ) were purchased from Synthego (Menlo Park, CA) or BioSpring GmbH (Frankfurt, Germany).

    Article Title: Tegavivint triggers TECR-dependent nonapoptotic cancer cell death.
    Article Snippet: Logan Leak , Ziwei Wang , Alby J. Joseph, Brianna Johnson , Alyssa A. Chan, Cassandra M. Decosto, Leslie Magtanong , Pin-Joe Ko, Weaverly Colleen Lee , Joan Ritho, Sophia Manukian, Alec Millner, Shweta Chitkara, Jennifer J. Salinas, Rachid Skouta, Matthew G. Rees, Melissa M. Ronan, Jennifer A. Roth, Chad L. Myers , Jason Moffat , Charles Boone , Steven J. Bensinger , David A. Nathanson, G. Ekin Atilla-Gokcumen, Everett J. Moding & Scott J. Dixon

    Article Title: Multi-site phosphorylation of BCL2L13 in a TBK1- and AMPK-dependent manner reveals new modes of mitophagy regulation
    Article Snippet: The RNP complex was composed of Cas9 Protein (Alt-R-Cas9, IDT), and a synthetic single-guide RNA (sgRNA) designed to target the gene of interest, and non-targeting guides were used for controls, which were synthesized by Synthego.

    In Vitro:

    Article Title: Covalent binding of thioredoxin to TXNIP is required for diet-induced insulin resistance in the liver
    Article Snippet: .. Zygotic pronuclei were microinjected with purified Cas9 mRNA (100 ng/μl), in vitro –transcribed synthetic guide RNAs (Synthego), and an asymmetrical ssDNA donor construct (IDT). ..

    Next-Generation Sequencing:

    Article Title: Differential roles of Na V 1.2 and Na V 1.6 in neocortical pyramidal cell excitability
    Article Snippet: .. Once an sgRNA decision was finalized, the off-target list was used to identify the top 15, and next-generation sequencing (NGS) amplicon primers were designed for the on-target locus, and each of the off-target synthetic guide RNAs was obtained from Synthego. ..

    Amplification:

    Article Title: Differential roles of Na V 1.2 and Na V 1.6 in neocortical pyramidal cell excitability
    Article Snippet: .. Once an sgRNA decision was finalized, the off-target list was used to identify the top 15, and next-generation sequencing (NGS) amplicon primers were designed for the on-target locus, and each of the off-target synthetic guide RNAs was obtained from Synthego. ..



    Similar Products

    crispr guide sequence  (Benchling Inc)
    86
    Benchling Inc crispr guide sequence
    Crispr Guide Sequence, supplied by Benchling Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/crispr+guide+sequence/crispr+design+tool/pm42098104-245-1-6
    Average 86 stars, based on 1 article reviews
    crispr guide sequence - by Bioz Stars, 2026-11
    86/100 stars
    		  Buy from Supplier
    crispr cas9 guide sequence  (Synthego Inc)
    86
    Synthego Inc crispr cas9 guide sequence
    Crispr Cas9 Guide Sequence, supplied by Synthego Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/crispr+guide+sequence/analysis+crispr+ice+tool/bio_rxiv__64898__2026__04__22__719209-184-1-6
    Average 86 stars, based on 1 article reviews
    crispr cas9 guide sequence - by Bioz Stars, 2026-11
    86/100 stars
    		  Buy from Supplier
    crispr cas9 technology small guide rna sgrna sequences  (Sangon Biotech)
    86
    Sangon Biotech crispr cas9 technology small guide rna sgrna sequences
    Crispr Cas9 Technology Small Guide Rna Sgrna Sequences, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/crispr+guide+sequence/cas9+plasmid+puromycin+recombinant+sgrna/pm41070630-162-11-32
    Average 86 stars, based on 1 article reviews
    crispr cas9 technology small guide rna sgrna sequences - by Bioz Stars, 2026-11
    86/100 stars
    		  Buy from Supplier
    crispr single guide rna sgrna sequences  (Synthego Inc)
    86
    Synthego Inc crispr single guide rna sgrna sequences
    <t>CRISPR</t> <t>sgRNA/Cas9</t> complexes were injected into single-cell embryos that were then treated with L-thyroxine (0.6 µM) at 3 dpf and mestranol (25 µM) at 4 dpf. Statistical analyses were performed using proportional odds logistic regression (polr) models with MASS and emmeans libraries in R (v4.3.3). ****: p < 0.0001, ns: not significant. wt: wild-type (uninjected fabp-fgb-egfp control group), - thr : combined knockdown of all thyroid hormone receptor paralogs thraa , thrab , and thrb . Magenta borders indicate mestranol treated groups. All data were collected by an observer blinded to the condition. Sample sizes for each group, corresponding to the thrombosis grades, are indicated within their respective stack.
    Crispr Single Guide Rna Sgrna Sequences, supplied by Synthego Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/crispr+guide+sequence/sequences+sgrna/bio_rxiv__2025__09__23__677920-51-0-17
    Average 86 stars, based on 1 article reviews
    crispr single guide rna sgrna sequences - by Bioz Stars, 2026-11
    86/100 stars
    		  Buy from Supplier
    metrnlb crispr cas9 mediated mutagenesis sgrna guide sequences  (Addgene inc)
    97
    Addgene inc metrnlb crispr cas9 mediated mutagenesis sgrna guide sequences
    <t>CRISPR</t> <t>sgRNA/Cas9</t> complexes were injected into single-cell embryos that were then treated with L-thyroxine (0.6 µM) at 3 dpf and mestranol (25 µM) at 4 dpf. Statistical analyses were performed using proportional odds logistic regression (polr) models with MASS and emmeans libraries in R (v4.3.3). ****: p < 0.0001, ns: not significant. wt: wild-type (uninjected fabp-fgb-egfp control group), - thr : combined knockdown of all thyroid hormone receptor paralogs thraa , thrab , and thrb . Magenta borders indicate mestranol treated groups. All data were collected by an observer blinded to the condition. Sample sizes for each group, corresponding to the thrombosis grades, are indicated within their respective stack.
    Metrnlb Crispr Cas9 Mediated Mutagenesis Sgrna Guide Sequences, supplied by Addgene inc, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/crispr+guide+sequence/Cas9+sgRNA+vector+(Plasmid+%2368463)/10__7554_slash_elife__105430__3-401-3-18
    Average 97 stars, based on 1 article reviews
    metrnlb crispr cas9 mediated mutagenesis sgrna guide sequences - by Bioz Stars, 2026-11
    97/100 stars
    		  Buy from Supplier
    crispr guide rna (grna) sequences  (Broad Institute Inc)
    90
    Broad Institute Inc crispr guide rna (grna) sequences
    <t>CRISPR</t> <t>sgRNA/Cas9</t> complexes were injected into single-cell embryos that were then treated with L-thyroxine (0.6 µM) at 3 dpf and mestranol (25 µM) at 4 dpf. Statistical analyses were performed using proportional odds logistic regression (polr) models with MASS and emmeans libraries in R (v4.3.3). ****: p < 0.0001, ns: not significant. wt: wild-type (uninjected fabp-fgb-egfp control group), - thr : combined knockdown of all thyroid hormone receptor paralogs thraa , thrab , and thrb . Magenta borders indicate mestranol treated groups. All data were collected by an observer blinded to the condition. Sample sizes for each group, corresponding to the thrombosis grades, are indicated within their respective stack.
    Crispr Guide Rna (Grna) Sequences, supplied by Broad Institute Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/crispr+guide+sequence/crispr+guides/pm40460826-349-6-21
    Average 90 stars, based on 1 article reviews
    crispr guide rna (grna) sequences - by Bioz Stars, 2026-11
    90/100 stars
    		  Buy from Supplier
    crispr single guide rna (sgrna) sequences  (Synthego Inc)
    90
    Synthego Inc crispr single guide rna (sgrna) sequences
    <t>CRISPR</t> <t>sgRNA/Cas9</t> complexes were injected into single-cell embryos that were then treated with L-thyroxine (0.6 µM) at 3 dpf and mestranol (25 µM) at 4 dpf. Statistical analyses were performed using proportional odds logistic regression (polr) models with MASS and emmeans libraries in R (v4.3.3). ****: p < 0.0001, ns: not significant. wt: wild-type (uninjected fabp-fgb-egfp control group), - thr : combined knockdown of all thyroid hormone receptor paralogs thraa , thrab , and thrb . Magenta borders indicate mestranol treated groups. All data were collected by an observer blinded to the condition. Sample sizes for each group, corresponding to the thrombosis grades, are indicated within their respective stack.
    Crispr Single Guide Rna (Sgrna) Sequences, supplied by Synthego Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/crispr+guide+sequence/synthetic+guide+rnas/pm40419770-411-0-17
    Average 90 stars, based on 1 article reviews
    crispr single guide rna (sgrna) sequences - by Bioz Stars, 2026-11
    90/100 stars
    		  Buy from Supplier
    crispr/cas9 guide rna (grna) sequences  (ValueGene)
    90
    ValueGene crispr/cas9 guide rna (grna) sequences
    <t>CRISPR</t> <t>sgRNA/Cas9</t> complexes were injected into single-cell embryos that were then treated with L-thyroxine (0.6 µM) at 3 dpf and mestranol (25 µM) at 4 dpf. Statistical analyses were performed using proportional odds logistic regression (polr) models with MASS and emmeans libraries in R (v4.3.3). ****: p < 0.0001, ns: not significant. wt: wild-type (uninjected fabp-fgb-egfp control group), - thr : combined knockdown of all thyroid hormone receptor paralogs thraa , thrab , and thrb . Magenta borders indicate mestranol treated groups. All data were collected by an observer blinded to the condition. Sample sizes for each group, corresponding to the thrombosis grades, are indicated within their respective stack.
    Crispr/Cas9 Guide Rna (Grna) Sequences, supplied by ValueGene, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/crispr+guide+sequence/guide+rnas/us12241081-348-1-10
    Average 90 stars, based on 1 article reviews
    crispr/cas9 guide rna (grna) sequences - by Bioz Stars, 2026-11
    90/100 stars
    		  Buy from Supplier
    crispr cas9 based knockout line creation single guide rna sequences  (Addgene inc)
    96
    Addgene inc crispr cas9 based knockout line creation single guide rna sequences
    <t>CRISPR</t> <t>sgRNA/Cas9</t> complexes were injected into single-cell embryos that were then treated with L-thyroxine (0.6 µM) at 3 dpf and mestranol (25 µM) at 4 dpf. Statistical analyses were performed using proportional odds logistic regression (polr) models with MASS and emmeans libraries in R (v4.3.3). ****: p < 0.0001, ns: not significant. wt: wild-type (uninjected fabp-fgb-egfp control group), - thr : combined knockdown of all thyroid hormone receptor paralogs thraa , thrab , and thrb . Magenta borders indicate mestranol treated groups. All data were collected by an observer blinded to the condition. Sample sizes for each group, corresponding to the thrombosis grades, are indicated within their respective stack.
    Crispr Cas9 Based Knockout Line Creation Single Guide Rna Sequences, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/crispr+guide+sequence/CRISPR-SP-Cas9+reporter+(Plasmid+%2362733)/pm39982959-388-0-29
    Average 96 stars, based on 1 article reviews
    crispr cas9 based knockout line creation single guide rna sequences - by Bioz Stars, 2026-11
    96/100 stars
    		  Buy from Supplier

    Image Search Results


    CRISPR sgRNA/Cas9 complexes were injected into single-cell embryos that were then treated with L-thyroxine (0.6 µM) at 3 dpf and mestranol (25 µM) at 4 dpf. Statistical analyses were performed using proportional odds logistic regression (polr) models with MASS and emmeans libraries in R (v4.3.3). ****: p < 0.0001, ns: not significant. wt: wild-type (uninjected fabp-fgb-egfp control group), - thr : combined knockdown of all thyroid hormone receptor paralogs thraa , thrab , and thrb . Magenta borders indicate mestranol treated groups. All data were collected by an observer blinded to the condition. Sample sizes for each group, corresponding to the thrombosis grades, are indicated within their respective stack.

    Journal: bioRxiv

    Article Title: FDA-approved drug repurposing in zebrafish identifies thyroid hormone and other compounds as potential antithrombotics

    doi: 10.1101/2025.09.23.677920

    Figure Lengend Snippet: CRISPR sgRNA/Cas9 complexes were injected into single-cell embryos that were then treated with L-thyroxine (0.6 µM) at 3 dpf and mestranol (25 µM) at 4 dpf. Statistical analyses were performed using proportional odds logistic regression (polr) models with MASS and emmeans libraries in R (v4.3.3). ****: p < 0.0001, ns: not significant. wt: wild-type (uninjected fabp-fgb-egfp control group), - thr : combined knockdown of all thyroid hormone receptor paralogs thraa , thrab , and thrb . Magenta borders indicate mestranol treated groups. All data were collected by an observer blinded to the condition. Sample sizes for each group, corresponding to the thrombosis grades, are indicated within their respective stack.

    Article Snippet: CRISPR single-guide RNA (sgRNA) sequences targeting early exons were designed with the Knockout Guide Design Tool ( synthego.com ).

    Techniques: CRISPR, Injection, Control, Knockdown

    CRISPR sgRNA/Cas9 complexes were injected into single-cell embryos that were then treated with tiratricol (0.1 µM) at 3 dpf and mestranol (25 µM) at 4 dpf. Statistical analyses were performed using proportional odds logistic regression (polr) models with MASS and emmeans libraries in R (v4.3.3). To prevent infinitesimal values that would be generated by the regression models, each thrombosis grade group was incremented by one count across all treatment groups. ****: p < 0.0001, ***: p < 0.001. wt: wild-type (uninjected fabp-fgb-egfp control group), - thr : combined knockdown of all thyroid hormone receptor paralogs thraa , thrab , and thrb . Magenta borders indicate mestranol treated groups. All data were collected by an observer blinded to the condition. Sample sizes for each group, corresponding to the thrombosis grades, are indicated within their respective stack.

    Journal: bioRxiv

    Article Title: FDA-approved drug repurposing in zebrafish identifies thyroid hormone and other compounds as potential antithrombotics

    doi: 10.1101/2025.09.23.677920

    Figure Lengend Snippet: CRISPR sgRNA/Cas9 complexes were injected into single-cell embryos that were then treated with tiratricol (0.1 µM) at 3 dpf and mestranol (25 µM) at 4 dpf. Statistical analyses were performed using proportional odds logistic regression (polr) models with MASS and emmeans libraries in R (v4.3.3). To prevent infinitesimal values that would be generated by the regression models, each thrombosis grade group was incremented by one count across all treatment groups. ****: p < 0.0001, ***: p < 0.001. wt: wild-type (uninjected fabp-fgb-egfp control group), - thr : combined knockdown of all thyroid hormone receptor paralogs thraa , thrab , and thrb . Magenta borders indicate mestranol treated groups. All data were collected by an observer blinded to the condition. Sample sizes for each group, corresponding to the thrombosis grades, are indicated within their respective stack.

    Article Snippet: CRISPR single-guide RNA (sgRNA) sequences targeting early exons were designed with the Knockout Guide Design Tool ( synthego.com ).

    Techniques: CRISPR, Injection, Generated, Control, Knockdown

    CRISPR sgRNA/Cas9 complexes were injected into single-cell embryos that were then treated with L-thyroxine (0.6 µM) at 3 dpf and observed at 5 dpf. Thrombosis grades were collected simultaneously with the TTO evaluations, ensuring consistent sample use as presented in . Statistical analyses were performed using proportional odds logistic regression ( polr ) models with MASS and emmeans libraries in R (v4.3.3). ****: p < 0.0001, *: p < 0.05. - proc : genetic thrombosis line ( proc −/− ::fabp-fgb-egfp control group), - thr : combined knockdown of all thyroid hormone receptor paralogs thraa , thrab , and thrb . All data were collected by an observer blinded to the condition. Sample sizes for each group, corresponding to the thrombosis grades, are indicated within their respective stack.

    Journal: bioRxiv

    Article Title: FDA-approved drug repurposing in zebrafish identifies thyroid hormone and other compounds as potential antithrombotics

    doi: 10.1101/2025.09.23.677920

    Figure Lengend Snippet: CRISPR sgRNA/Cas9 complexes were injected into single-cell embryos that were then treated with L-thyroxine (0.6 µM) at 3 dpf and observed at 5 dpf. Thrombosis grades were collected simultaneously with the TTO evaluations, ensuring consistent sample use as presented in . Statistical analyses were performed using proportional odds logistic regression ( polr ) models with MASS and emmeans libraries in R (v4.3.3). ****: p < 0.0001, *: p < 0.05. - proc : genetic thrombosis line ( proc −/− ::fabp-fgb-egfp control group), - thr : combined knockdown of all thyroid hormone receptor paralogs thraa , thrab , and thrb . All data were collected by an observer blinded to the condition. Sample sizes for each group, corresponding to the thrombosis grades, are indicated within their respective stack.

    Article Snippet: CRISPR single-guide RNA (sgRNA) sequences targeting early exons were designed with the Knockout Guide Design Tool ( synthego.com ).

    Techniques: CRISPR, Injection, Control, Knockdown

    CRISPR sgRNA/Cas9 complexes were injected into single-cell embryos that were then treated with L-thyroxine (0.6 µM) at 3 dpf, and mestranol (25 µM) at 4 dpf, followed by assessment of laser-mediated endothelial injury at 5 dpf. Increased TTO observed in wild-type embryos treated with thyroid hormone was diminished upon thr knockdown, indicating involvement of thyroid receptor signaling. Increased TTO levels were still present in the L-thyroxine-mestranol combination groups. ****: p<0.0001, ***: p<0.001, **: p<0.01, *: p<0.05, ns: not significant. wt: wild-type (uninjected fabp-fgb-egfp control group), - thr : combined knockdown of all thyroid hormone receptor paralogs thraa , thrab , and thrb . All data were collected by an observer blinded to the condition.

    Journal: bioRxiv

    Article Title: FDA-approved drug repurposing in zebrafish identifies thyroid hormone and other compounds as potential antithrombotics

    doi: 10.1101/2025.09.23.677920

    Figure Lengend Snippet: CRISPR sgRNA/Cas9 complexes were injected into single-cell embryos that were then treated with L-thyroxine (0.6 µM) at 3 dpf, and mestranol (25 µM) at 4 dpf, followed by assessment of laser-mediated endothelial injury at 5 dpf. Increased TTO observed in wild-type embryos treated with thyroid hormone was diminished upon thr knockdown, indicating involvement of thyroid receptor signaling. Increased TTO levels were still present in the L-thyroxine-mestranol combination groups. ****: p<0.0001, ***: p<0.001, **: p<0.01, *: p<0.05, ns: not significant. wt: wild-type (uninjected fabp-fgb-egfp control group), - thr : combined knockdown of all thyroid hormone receptor paralogs thraa , thrab , and thrb . All data were collected by an observer blinded to the condition.

    Article Snippet: CRISPR single-guide RNA (sgRNA) sequences targeting early exons were designed with the Knockout Guide Design Tool ( synthego.com ).

    Techniques: CRISPR, Injection, Knockdown, Control

    After CRISPR-mediated individual knockdown of each canonical thyroid hormone receptor (- thraa , - thrab , and - thrb ) or combination (- thr ), embryos were co-treated with L-thyroxine (3 µM) and mestranol (25 µM) at 4 dpf and evaluated 24 hours later. Magenta borders indicate mestranol treated groups. ****: p < 0.0001, *: p < 0.05, ns: not significant. All data were collected by an observer blinded to the condition. Sample sizes for each group, corresponding to the thrombosis grades, are indicated within their respective stack.

    Journal: bioRxiv

    Article Title: FDA-approved drug repurposing in zebrafish identifies thyroid hormone and other compounds as potential antithrombotics

    doi: 10.1101/2025.09.23.677920

    Figure Lengend Snippet: After CRISPR-mediated individual knockdown of each canonical thyroid hormone receptor (- thraa , - thrab , and - thrb ) or combination (- thr ), embryos were co-treated with L-thyroxine (3 µM) and mestranol (25 µM) at 4 dpf and evaluated 24 hours later. Magenta borders indicate mestranol treated groups. ****: p < 0.0001, *: p < 0.05, ns: not significant. All data were collected by an observer blinded to the condition. Sample sizes for each group, corresponding to the thrombosis grades, are indicated within their respective stack.

    Article Snippet: CRISPR single-guide RNA (sgRNA) sequences targeting early exons were designed with the Knockout Guide Design Tool ( synthego.com ).

    Techniques: CRISPR, Knockdown