control shrna shctrl (OriGene)
OriGene is a verified supplier 
OriGene manufactures this product 
95
Structured Review
OriGene
control shrna shctrl
Control Shrna Shctrl, supplied by OriGene, used in various techniques. Bioz Stars score: 95/100, based on 152 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/control+vector/Scrambled+shRNA+control+in+pGFP-V-RS+shRNA+Vector/pm26279301-240-17-23
Average 95 stars, based on 152 article reviews
Control Shrna Shctrl, supplied by OriGene, used in various techniques. Bioz Stars score: 95/100, based on 152 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/control+vector/Scrambled+shRNA+control+in+pGFP-V-RS+shRNA+Vector/pm26279301-240-17-23
Average 95 stars, based on 152 article reviews
control shrna shctrl - by Bioz Stars,
2026-09
95/100 stars
Images
1) Product Images from "Ras association domain family member 10 suppresses gastric cancer growth by cooperating with GSTP1 to regulate JNK/c-Jun/AP-1 pathway."
Article Title: Ras association domain family member 10 suppresses gastric cancer growth by cooperating with GSTP1 to regulate JNK/c-Jun/AP-1 pathway.
Journal: Oncogene
doi: 10.1038/onc.2015.300
Figure Legend Snippet: Figure 3. Effect of RASSF10 on cell growth and cell migration/invasion. (a) Overexpression of RASSF10 in AGS and MKN45 cells after stable transfection with RASSF10 expression vectors was confirmed by western blotting. (b) MTS viability assays showed RASSF10 expression significantly suppressed growth of AGS and MKN45 cells. (c) Colony-formation ability of AGS and MKN45 cells was significantly inhibited by RASSF10 expression. (d1) RASSF10 expression was knocked down in GES-1 cells by transfection of shRNA against RASSF10. (d2) Cell growth of GES-1 was significantly increased after knockdown of RASSF10. (e) Cell migration ability was significantly inhibited by RASSF10 expression in AGS cells as indicated by wound-healing assay. (f) Cell invasiveness was significantly reduced by RASSF10 expression in AGS and MKN45 cells as indicated by matrigel invasion assay.
Techniques Used: Migration, Over Expression, Stable Transfection, Expressing, Western Blot, Transfection, shRNA, Knockdown, Wound Healing Assay, Invasion Assay
Related Articles
shRNA:Article Title: Hippocampal Ring Finger Protein 10-dependent signaling supports cognitive flexibility Article Snippet: .. For shRNA experiments, sequences for mouse RNF10 shRNA (mature antisense TCAGGTTGATCTTCTTAGGG) and Article Title: S1P-S1PR1 signaling impairs CD8 + T cell metabolism and effector function in tumors Article Snippet: HEK 293 T (ATCC) cells were cultured in T75 tissue culture flasks (Falcon, NY, USA) under standard conditions (37 °C, 5% CO2). .. Cells were maintained in complete DMEM (Gibco, Thermo Fisher Scientific) supplemented with:10% fetal bovine serum (FBS; Gibco), 1% penicillin–streptomycin (Gibco) For lentiviral production, HEK293T cells were co-transfected with: 15 μg lentiviral expression plasmid encoding S1pr1 shRNA, Eif2ak3 shRNA, or Article Title: MYB/AKT3 axis is a key driver of ovarian cancer growth, aggressiveness, and chemoresistance Article Snippet: .. For RNA interference mediated gene silencing, four independent short hairpin RNA (shRNA) expression constructs for MYB (pGFP-V-RS-shMYB #1, #2, #3 and #4) and Article Title: AURKB and PI3K/AKT/mTOR pathways converge to regulate TERT expression Article Snippet: Human AURKB shRNA Plasmid Kit , OriGene , Cat#:TL320607. .. Article Title: Peroxisome Proliferator-Activated Receptor Family of Lipid-Activated Nuclear Receptors Alpha Silencing Promotes Oxidative Stress and Hypertrophic Phenotype in Rat Cardiac Cells Article Snippet: In detail, 250 ng of plasmids were transfected using Lipofectamine 2000 (Thermo Fischer Scientific, Waltham, MA, USA) following the manufacturer’s instructions. .. The following shRNA plasmids were used: 29-mer scrambled shRNA cassette in Expressing:Article Title: S1P-S1PR1 signaling impairs CD8 + T cell metabolism and effector function in tumors Article Snippet: HEK 293 T (ATCC) cells were cultured in T75 tissue culture flasks (Falcon, NY, USA) under standard conditions (37 °C, 5% CO2). .. Cells were maintained in complete DMEM (Gibco, Thermo Fisher Scientific) supplemented with:10% fetal bovine serum (FBS; Gibco), 1% penicillin–streptomycin (Gibco) For lentiviral production, HEK293T cells were co-transfected with: 15 μg lentiviral expression plasmid encoding S1pr1 shRNA, Eif2ak3 shRNA, or Article Title: MYB/AKT3 axis is a key driver of ovarian cancer growth, aggressiveness, and chemoresistance Article Snippet: .. For RNA interference mediated gene silencing, four independent short hairpin RNA (shRNA) expression constructs for MYB (pGFP-V-RS-shMYB #1, #2, #3 and #4) and Plasmid Preparation:Article Title: S1P-S1PR1 signaling impairs CD8 + T cell metabolism and effector function in tumors Article Snippet: HEK 293 T (ATCC) cells were cultured in T75 tissue culture flasks (Falcon, NY, USA) under standard conditions (37 °C, 5% CO2). .. Cells were maintained in complete DMEM (Gibco, Thermo Fisher Scientific) supplemented with:10% fetal bovine serum (FBS; Gibco), 1% penicillin–streptomycin (Gibco) For lentiviral production, HEK293T cells were co-transfected with: 15 μg lentiviral expression plasmid encoding S1pr1 shRNA, Eif2ak3 shRNA, or Article Title: Intellectual disability-causing mutations in KIF11 impair microtubule dynamics and dendritic arborization Article Snippet: .. DIV14-16 Primary hippocampal mouse neurons, plated in 35 mm Mattek No1.5 dishes were simultaneously transfected via combiMag and Lipofectamine with 0.5 μg EB3-miRFP703 (Addgene #79994) or mRuby-Synaptophysin [(pEF Synaptophysin-mRuby was a gift from Edwin Chapman (Addgene plasmid # 188980; http://n2t.net/addgene:188980 ; RRID:Addgene_188980)] or mApple-PSD95 [mApple-PSD95-N-14 was a gift from Michael Davidson (Addgene plasmid # 54941; http://n2t.net/addgene:54941 ; RRID:Addgene_54941)] and either 0.5 μg Control:Article Title: S1P-S1PR1 signaling impairs CD8 + T cell metabolism and effector function in tumors Article Snippet: HEK 293 T (ATCC) cells were cultured in T75 tissue culture flasks (Falcon, NY, USA) under standard conditions (37 °C, 5% CO2). .. Cells were maintained in complete DMEM (Gibco, Thermo Fisher Scientific) supplemented with:10% fetal bovine serum (FBS; Gibco), 1% penicillin–streptomycin (Gibco) For lentiviral production, HEK293T cells were co-transfected with: 15 μg lentiviral expression plasmid encoding S1pr1 shRNA, Eif2ak3 shRNA, or Article Title: MYB/AKT3 axis is a key driver of ovarian cancer growth, aggressiveness, and chemoresistance Article Snippet: .. For RNA interference mediated gene silencing, four independent short hairpin RNA (shRNA) expression constructs for MYB (pGFP-V-RS-shMYB #1, #2, #3 and #4) and Article Title: The expression level of CACNA1C-encoded Ca V 1.2 is a tipping point between promotion and inhibition of dendritic growth in neurons Article Snippet: .. pGFP-V-RS-Ca V 1.2-shRNA and Article Title: Peroxisome Proliferator-Activated Receptor Family of Lipid-Activated Nuclear Receptors Alpha Silencing Promotes Oxidative Stress and Hypertrophic Phenotype in Rat Cardiac Cells Article Snippet: In detail, 250 ng of plasmids were transfected using Lipofectamine 2000 (Thermo Fischer Scientific, Waltham, MA, USA) following the manufacturer’s instructions. .. The following shRNA plasmids were used: 29-mer scrambled shRNA cassette in Transfection:Article Title: S1P-S1PR1 signaling impairs CD8 + T cell metabolism and effector function in tumors Article Snippet: HEK 293 T (ATCC) cells were cultured in T75 tissue culture flasks (Falcon, NY, USA) under standard conditions (37 °C, 5% CO2). .. Cells were maintained in complete DMEM (Gibco, Thermo Fisher Scientific) supplemented with:10% fetal bovine serum (FBS; Gibco), 1% penicillin–streptomycin (Gibco) For lentiviral production, HEK293T cells were co-transfected with: 15 μg lentiviral expression plasmid encoding S1pr1 shRNA, Eif2ak3 shRNA, or Article Title: Intellectual disability-causing mutations in KIF11 impair microtubule dynamics and dendritic arborization Article Snippet: .. DIV14-16 Primary hippocampal mouse neurons, plated in 35 mm Mattek No1.5 dishes were simultaneously transfected via combiMag and Lipofectamine with 0.5 μg EB3-miRFP703 (Addgene #79994) or mRuby-Synaptophysin [(pEF Synaptophysin-mRuby was a gift from Edwin Chapman (Addgene plasmid # 188980; http://n2t.net/addgene:188980 ; RRID:Addgene_188980)] or mApple-PSD95 [mApple-PSD95-N-14 was a gift from Michael Davidson (Addgene plasmid # 54941; http://n2t.net/addgene:54941 ; RRID:Addgene_54941)] and either 0.5 μg Construct:Article Title: MYB/AKT3 axis is a key driver of ovarian cancer growth, aggressiveness, and chemoresistance Article Snippet: .. For RNA interference mediated gene silencing, four independent short hairpin RNA (shRNA) expression constructs for MYB (pGFP-V-RS-shMYB #1, #2, #3 and #4) and Article Title: Intellectual disability-causing mutations in KIF11 impair microtubule dynamics and dendritic arborization Article Snippet: .. DIV14-16 Primary hippocampal mouse neurons, plated in 35 mm Mattek No1.5 dishes were simultaneously transfected via combiMag and Lipofectamine with 0.5 μg EB3-miRFP703 (Addgene #79994) or mRuby-Synaptophysin [(pEF Synaptophysin-mRuby was a gift from Edwin Chapman (Addgene plasmid # 188980; http://n2t.net/addgene:188980 ; RRID:Addgene_188980)] or mApple-PSD95 [mApple-PSD95-N-14 was a gift from Michael Davidson (Addgene plasmid # 54941; http://n2t.net/addgene:54941 ; RRID:Addgene_54941)] and either 0.5 μg Article Title: Peroxisome Proliferator-Activated Receptor Family of Lipid-Activated Nuclear Receptors Alpha Silencing Promotes Oxidative Stress and Hypertrophic Phenotype in Rat Cardiac Cells Article Snippet: In detail, 250 ng of plasmids were transfected using Lipofectamine 2000 (Thermo Fischer Scientific, Waltham, MA, USA) following the manufacturer’s instructions. .. The following shRNA plasmids were used: 29-mer scrambled shRNA cassette in Retroviral:Article Title: Peroxisome Proliferator-Activated Receptor Family of Lipid-Activated Nuclear Receptors Alpha Silencing Promotes Oxidative Stress and Hypertrophic Phenotype in Rat Cardiac Cells Article Snippet: In detail, 250 ng of plasmids were transfected using Lipofectamine 2000 (Thermo Fischer Scientific, Waltham, MA, USA) following the manufacturer’s instructions. .. The following shRNA plasmids were used: 29-mer scrambled shRNA cassette in |
