control cdna sample (Promega)
90
Structured Review
Promega
control cdna sample
Control Cdna Sample, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/control+cdna+sample/cdna+template/pm40537444-93-8-5
Average 90 stars, based on 1 article reviews
Control Cdna Sample, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/control+cdna+sample/cdna+template/pm40537444-93-8-5
Average 90 stars, based on 1 article reviews
control cdna sample - by Bioz Stars,
2026-09
90/100 stars
Images
Related Articles
other:Article Title: Narcissus yellow stripe virus and Narcissus mosaic virus detection in Narcissus via multiplex TaqMan-based reverse transcription-PCR assay. Article Snippet: Aims: Development of a multiplex TaqMan RT-qPCR assay to simultaneously detect Narcissus yellow stripe virus (NYSV) and Narcissus mosaic virus (NMV), frequently causing mixed narcissus infection.. Feasibility verification was confirmed in natural samples.. Methods and Results: Primers and probes were designed based on the conserved CP gene regions of NYSV or NMV and their suitability for singleplex and multiplex TaqMan RT-qPCR assays as well as for conventional RT-PCR. Article Title: Quorum sensing and RsaM regulons of the rice pathogen Pseudomonas fuscovaginae . Article Snippet: The synthesized Article Title: Identification of a Virulent Newcastle Disease Virus Strain Isolated from Pigeons ( Columbia livia ) in Northeastern Brazil Using Next-Generation Genome Sequencing Article Snippet: Next, cDNA samples were amplified employing the kit Mutagenesis:Article Title: Multi-Omic Analysis of Two Common P53 Mutations: Proteins Regulated by Mutated P53 as Potential Targets for Immunotherapy Article Snippet: .. TP53 mutation status was confirmed in the transfected cell lines using PCR and Sanger sequencing of products amplified using primers flanking the TP53 mutations (forward primer 5′ TCTTCTGTCCCTTCCCAGAA3′ and reverse primer 5′ CAAGGCCTCATTCAGCTCTC3′) and Transfection:Article Title: Multi-Omic Analysis of Two Common P53 Mutations: Proteins Regulated by Mutated P53 as Potential Targets for Immunotherapy Article Snippet: .. TP53 mutation status was confirmed in the transfected cell lines using PCR and Sanger sequencing of products amplified using primers flanking the TP53 mutations (forward primer 5′ TCTTCTGTCCCTTCCCAGAA3′ and reverse primer 5′ CAAGGCCTCATTCAGCTCTC3′) and Polymerase Chain Reaction:Article Title: Multi-Omic Analysis of Two Common P53 Mutations: Proteins Regulated by Mutated P53 as Potential Targets for Immunotherapy Article Snippet: .. TP53 mutation status was confirmed in the transfected cell lines using PCR and Sanger sequencing of products amplified using primers flanking the TP53 mutations (forward primer 5′ TCTTCTGTCCCTTCCCAGAA3′ and reverse primer 5′ CAAGGCCTCATTCAGCTCTC3′) and Article Title: Integrative Multiparametric Analysis of Circulating Cell-Free Nucleic Acids of Plasma in Healthy Individuals During Aging. Article Snippet: .. A control human genomic DNA (Promega) and a Sequencing:Article Title: Multi-Omic Analysis of Two Common P53 Mutations: Proteins Regulated by Mutated P53 as Potential Targets for Immunotherapy Article Snippet: .. TP53 mutation status was confirmed in the transfected cell lines using PCR and Sanger sequencing of products amplified using primers flanking the TP53 mutations (forward primer 5′ TCTTCTGTCCCTTCCCAGAA3′ and reverse primer 5′ CAAGGCCTCATTCAGCTCTC3′) and Amplification:Article Title: Multi-Omic Analysis of Two Common P53 Mutations: Proteins Regulated by Mutated P53 as Potential Targets for Immunotherapy Article Snippet: .. TP53 mutation status was confirmed in the transfected cell lines using PCR and Sanger sequencing of products amplified using primers flanking the TP53 mutations (forward primer 5′ TCTTCTGTCCCTTCCCAGAA3′ and reverse primer 5′ CAAGGCCTCATTCAGCTCTC3′) and Synthesized:Article Title: Multi-Omic Analysis of Two Common P53 Mutations: Proteins Regulated by Mutated P53 as Potential Targets for Immunotherapy Article Snippet: .. TP53 mutation status was confirmed in the transfected cell lines using PCR and Sanger sequencing of products amplified using primers flanking the TP53 mutations (forward primer 5′ TCTTCTGTCCCTTCCCAGAA3′ and reverse primer 5′ CAAGGCCTCATTCAGCTCTC3′) and Isolation:Article Title: Multi-Omic Analysis of Two Common P53 Mutations: Proteins Regulated by Mutated P53 as Potential Targets for Immunotherapy Article Snippet: .. TP53 mutation status was confirmed in the transfected cell lines using PCR and Sanger sequencing of products amplified using primers flanking the TP53 mutations (forward primer 5′ TCTTCTGTCCCTTCCCAGAA3′ and reverse primer 5′ CAAGGCCTCATTCAGCTCTC3′) and Quantitative RT-PCR:Article Title: Placental Alkaline Phosphatase Promotes Zika Virus Replication by Stabilizing Viral Proteins through BIP Article Snippet: One microgram of RNA was transcribed into cDNA using random primers and Moloney murine leukemia virus reverse transcriptase (Promega, Charbonnieres, France). .. RT-qPCR was performed using the resulting Real-time Polymerase Chain Reaction:Article Title: Placental Alkaline Phosphatase Promotes Zika Virus Replication by Stabilizing Viral Proteins through BIP Article Snippet: One microgram of RNA was transcribed into cDNA using random primers and Moloney murine leukemia virus reverse transcriptase (Promega, Charbonnieres, France). .. RT-qPCR was performed using the resulting Control:Article Title: Integrative Multiparametric Analysis of Circulating Cell-Free Nucleic Acids of Plasma in Healthy Individuals During Aging. Article Snippet: .. A control human genomic DNA (Promega) and a |
