scr control aav plasmid constructs (Addgene inc)
Addgene inc is a verified supplier 
96
Structured Review
Addgene inc
scr control aav plasmid constructs
Scr Control Aav Plasmid Constructs, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1091 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/control+aav+construct/scramble+shRNA+(Plasmid+%231864)/pmc12541345-199-7-16
Average 96 stars, based on 1091 article reviews
Scr Control Aav Plasmid Constructs, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1091 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/control+aav+construct/scramble+shRNA+(Plasmid+%231864)/pmc12541345-199-7-16
Average 96 stars, based on 1091 article reviews
scr control aav plasmid constructs - by Bioz Stars,
2026-10
96/100 stars
Images
Related Articles
shRNA:Article Title: Endogenous retroviral elements LTR8B and MER65 rewire PSG9 regulation to control trophoblast syncytialization and pre-eclampsia risk Article Snippet: .. The Article Title: Lipid turnover and GEF recruitment collectively determine Rab5 recruitment and activation during the first step of early endosome formation. Article Snippet: The shRNA was generated by cloning the target sequence into the pLKO.1-TRC cloning vector (Addgene, #10878). .. The Article Title: Actin-regulated plasticity as a key determinant of the bidirectional switch between chemoresistance and resensitization in triple-positive breast cancer. Article Snippet: Aim: Tamoxifen-induced chemoresistance promotes cancer cell survival, progression, and metastasis.. Therefore, we investigated and validated tamoxifen resistance involvement in cancer progression.. Methods: Tamoxifen resistance was induced in MCF7 cells; subsequently, fluorescence microscopy and proteomics were used to assess actin-mediated cellular alterations. Article Title: A mechanism to initiate emergency type 2 myelopoiesis. Article Snippet: .. Flag–LMO2, MYC–LMO4, Article Title: FOXO1 transcription factor modulates airway epithelial responses to viral infection Article Snippet: Stable FOXO1 deficient BEAS-2B cells (FOXO1 shRNA) were generated by transducing cells with lentivirus (MOI of 10) encoding an shRNA (GATAACTCGACTTATTGTCCTGTTTTTGCCGGGCCGGAG TTTAGCCAGTCCAACTCGA) against FOXO1 mRNA in MISSION pLKO—1-puro plasmid (Sigma-Aldrich). .. As a negative control, a lentivirus expressing scrambled shRNA, which does not target any mammalian gene, was used to transduce Article Title: Endogenous retroviral elements LTR8B and MER65 rewire PSG9 regulation to control trophoblast syncytialization and pre-eclampsia risk Article Snippet: .. The Negative Control:Article Title: Endogenous retroviral elements LTR8B and MER65 rewire PSG9 regulation to control trophoblast syncytialization and pre-eclampsia risk Article Snippet: .. The Article Title: FOXO1 transcription factor modulates airway epithelial responses to viral infection Article Snippet: Stable FOXO1 deficient BEAS-2B cells (FOXO1 shRNA) were generated by transducing cells with lentivirus (MOI of 10) encoding an shRNA (GATAACTCGACTTATTGTCCTGTTTTTGCCGGGCCGGAG TTTAGCCAGTCCAACTCGA) against FOXO1 mRNA in MISSION pLKO—1-puro plasmid (Sigma-Aldrich). .. As a negative control, a lentivirus expressing scrambled shRNA, which does not target any mammalian gene, was used to transduce Control:Article Title: Lipid turnover and GEF recruitment collectively determine Rab5 recruitment and activation during the first step of early endosome formation. Article Snippet: The shRNA was generated by cloning the target sequence into the pLKO.1-TRC cloning vector (Addgene, #10878). .. The Article Title: Actin-regulated plasticity as a key determinant of the bidirectional switch between chemoresistance and resensitization in triple-positive breast cancer. Article Snippet: Aim: Tamoxifen-induced chemoresistance promotes cancer cell survival, progression, and metastasis.. Therefore, we investigated and validated tamoxifen resistance involvement in cancer progression.. Methods: Tamoxifen resistance was induced in MCF7 cells; subsequently, fluorescence microscopy and proteomics were used to assess actin-mediated cellular alterations. Article Title: The deubiquitinase USP28 promotes esophageal squamous cell carcinoma proliferation by stabilizing ΔNp63 protein. Article Snippet: Esophageal squamous cell carcinoma (ESCC) remains a lethal malignancy with limited therapeutic options.. The deubiquitinase USP28 has emerged as a key stabilizer of the oncogenic transcription factor ΔNp63 in squamous cancers, yet its functional significance and therapeutic potential in ESCC are unexplored.. Here, we elucidate that USP28 is essential for ESCC proliferation. Expressing:Article Title: Lipid turnover and GEF recruitment collectively determine Rab5 recruitment and activation during the first step of early endosome formation. Article Snippet: The shRNA was generated by cloning the target sequence into the pLKO.1-TRC cloning vector (Addgene, #10878). .. The Article Title: FOXO1 transcription factor modulates airway epithelial responses to viral infection Article Snippet: Stable FOXO1 deficient BEAS-2B cells (FOXO1 shRNA) were generated by transducing cells with lentivirus (MOI of 10) encoding an shRNA (GATAACTCGACTTATTGTCCTGTTTTTGCCGGGCCGGAG TTTAGCCAGTCCAACTCGA) against FOXO1 mRNA in MISSION pLKO—1-puro plasmid (Sigma-Aldrich). .. As a negative control, a lentivirus expressing scrambled shRNA, which does not target any mammalian gene, was used to transduce Produced:Article Title: Lipid turnover and GEF recruitment collectively determine Rab5 recruitment and activation during the first step of early endosome formation. Article Snippet: The shRNA was generated by cloning the target sequence into the pLKO.1-TRC cloning vector (Addgene, #10878). .. The Plasmid Preparation:Article Title: Actin-regulated plasticity as a key determinant of the bidirectional switch between chemoresistance and resensitization in triple-positive breast cancer. Article Snippet: Aim: Tamoxifen-induced chemoresistance promotes cancer cell survival, progression, and metastasis.. Therefore, we investigated and validated tamoxifen resistance involvement in cancer progression.. Methods: Tamoxifen resistance was induced in MCF7 cells; subsequently, fluorescence microscopy and proteomics were used to assess actin-mediated cellular alterations. Sequencing:Article Title: Actin-regulated plasticity as a key determinant of the bidirectional switch between chemoresistance and resensitization in triple-positive breast cancer. Article Snippet: Aim: Tamoxifen-induced chemoresistance promotes cancer cell survival, progression, and metastasis.. Therefore, we investigated and validated tamoxifen resistance involvement in cancer progression.. Methods: Tamoxifen resistance was induced in MCF7 cells; subsequently, fluorescence microscopy and proteomics were used to assess actin-mediated cellular alterations. Clone Assay:Article Title: Actin-regulated plasticity as a key determinant of the bidirectional switch between chemoresistance and resensitization in triple-positive breast cancer. Article Snippet: Aim: Tamoxifen-induced chemoresistance promotes cancer cell survival, progression, and metastasis.. Therefore, we investigated and validated tamoxifen resistance involvement in cancer progression.. Methods: Tamoxifen resistance was induced in MCF7 cells; subsequently, fluorescence microscopy and proteomics were used to assess actin-mediated cellular alterations. Construct:Article Title: A mechanism to initiate emergency type 2 myelopoiesis. Article Snippet: .. Flag–LMO2, MYC–LMO4, Transduction:Article Title: FOXO1 transcription factor modulates airway epithelial responses to viral infection Article Snippet: Stable FOXO1 deficient BEAS-2B cells (FOXO1 shRNA) were generated by transducing cells with lentivirus (MOI of 10) encoding an shRNA (GATAACTCGACTTATTGTCCTGTTTTTGCCGGGCCGGAG TTTAGCCAGTCCAACTCGA) against FOXO1 mRNA in MISSION pLKO—1-puro plasmid (Sigma-Aldrich). .. As a negative control, a lentivirus expressing scrambled shRNA, which does not target any mammalian gene, was used to transduce other:Article Title: FOXO1 transcription factor modulates airway epithelial responses to viral infection. Article Snippet: BEAS-2B and NHBE cells were treated with FOXO-1 inhibitor AS1842856 (1 μmol/L; Calbiochem, San Diego, CA) or Poly(I:C) (50 μg/mL; Millipore Sigma) for 24 hours. |